SNP (Single Nucleotide Polymorphism) site related to ear and stem postures in mature period of millet, molecular marker and application of SNP site and molecular marker

Abstract

The invention discloses SNP (Single Nucleotide Polymorphism) loci related to ear and stem postures in the mature period of millet, a molecular marker and application of the SNP loci, the SNP loci comprise a first SNP locus and a second SNP locus, the first SNP locus is located at the 49086726th site of the second chromosome of the millet, and the allelic variation of the first SNP locus is A / T, and the second SNP locus is located at the 49086726th site of the second chromosome of the millet; the second SNP site is located at the 49102814th site of the second chromosome, and the allelic variation of the second SNP site is A / C. The invention provides an SNP site obviously related to the mature-period spike stem posture character, and develops a molecular marker related to the mature-period spike stem posture character of the millet, so that a genome DNA sequence is associated with the mature-period spike stem posture character of the millet, and establishment of a millet molecular marker assisted breeding system is facilitated; and a direction and a basis can be provided for finer positioning and millet breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biomolecules, and in particular relates to SNP sites and molecular markers related to the posture of ear stems in the mature stage of millet, and applications thereof. Background Art

[0002] Millet (Setaria italica) is an annual herbaceous crop with strong drought tolerance and water conservation. The posture of the panicle stalk (spike stalk) during millet maturity will affect millet's resistance to lodging. As a diploid self-pollinating crop, millet has a small genome, is easy to operate, has a short reproductive cycle, and is relatively simple in inheritance. It now has a high-quality reference genome sequence, and the publication of the millet SSR genetic linkage map has laid a good foundation for the genetic analysis of millet. Although the whole genome sequence of millet has been sequenced, there are few reports on the genetic association studies of the panicle stalk posture traits of millet at maturity; therefore, it is necessary to develop, utilize, identify or predict molecular markers for the panicle stalk posture of millet at maturity in order to breed better varieties. Summary of the invention

[0003] Based on the above background, the present invention provides SNP loci, molecular markers and applications thereof related to the panicle-stem posture at the mature stage of millet, so as to breed better varieties.

[0004] The technical solution of the present invention is:

[0005] The SNP sites related to the posture of the ear stem in the millet maturity period include a first SNP site and a second SNP site. The first SNP site is located at position 49086726 of chromosome 2 of millet, and its allele variation is A / T; the second SNP site is located at position 49102814 of chromosome 2, and its allele variation is A / C.

[0006] Based on the same inventive concept, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNP in the millet genome in any of the following applications, the application comprising:

[0007] 1) Application in predicting the posture of ear stems at the maturity stage of millet;

[0008] 2) Application in identification or auxiliary identification of panicle stem posture traits at the maturity stage of millet;

[0009] 3) Application in the improvement of millet ear-stem posture during maturity period, related breeding or auxiliary breeding;

[0010] The SNP sites include a first SNP site and a second SNP site, the first SNP site is located at position 49086726 of chromosome 2 of millet, and its allele variation is A / T; the second SNP site is located at position 49102814 of chromosome 2, and its allele variation is A / C.

[0011] Based on the same inventive concept, the present invention also provides a molecular marker related to the panicle-stem posture at the mature stage of millet, the molecular marker comprising a first molecular marker and a second molecular marker, the first molecular marker comprising the 49086726th site of chromosome 2 of millet; the nucleotide sequence of the first molecular marker is shown as SEQ ID No. 1;

[0012] The second molecular marker includes position 49102814 of chromosome 2, and the nucleotide sequence of the second molecular marker is shown as SEQ ID No.2.

[0013] Based on the same inventive concept, the present invention provides the use of molecular markers related to the posture of the panicle stem at the mature stage of millet in any of the following applications, the application comprising:

[0014] 1) Application in predicting the posture of ear stems at the maturity stage of millet;

[0015] 2) Application in identification or auxiliary identification of panicle stem posture traits at the maturity stage of millet;

[0016] 3) Application in breeding or auxiliary breeding for improvement of the ear-stem posture at the mature stage of millet.

[0017] Based on the same inventive concept, the present invention also provides a method for predicting the posture of the ear stem of millet at maturity, using a specific probe or chip for detecting the SNP site to detect the millet genomic DNA of the prediction object, obtain the base situation of the allele variation site of the SNP site, and predict the performance of the ear stem posture trait of the millet at maturity according to the base situation;

[0018] Alternatively, the DNA of a single leaf or seed of millet is used as a template, and the primers corresponding to the above-mentioned molecular markers are used for PCR amplification. The amplified products are sequenced and identified, and the performance of the panicle stem posture traits of millet at maturity is predicted based on the identification results.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides SNP sites that are significantly correlated with the ear stem posture traits at maturity, and based on this, develops molecular markers related to the ear stem posture traits at maturity of millet, thereby linking the genomic DNA sequence with the ear stem posture traits at maturity of millet, which is beneficial to the establishment of a molecular marker-assisted breeding system for millet, and can provide direction and basis for more precise positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The millet population structure analysis of Example 1 of the present invention;

[0022] Figure 2 LD attenuation distribution diagram of Example 1 of the present invention;

[0023] Figure 3 The Manhattan plot and QQ-Plot plot of the ear stem posture traits at maturity in Example 1 of the present invention, the portion above the dotted line in the figure is the SNP site with significant difference, p<0.01. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0027] Example 1: Determination of SNP loci and molecular markers associated with the posture of the ear stem at maturity of millet

[0028] In this example, 203 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwahonggu×Henan 4·2SE165. 5·Xiaomaohuang·Xia1f, Chaoxianggu×Xuandasui 5·2SE mixed·8f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f hybrid varieties, 203 millet materials were sown in the experimental field of Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field tests were conducted, and each millet material was planted in 2 rows, with a row length of 2m, a row spacing of 50cm, and a plant spacing of 3-5cm. According to local routine management, each material selected millet in the middle of the row (3 plants in total) at maturity to measure field traits.

[0029] DNA samples were extracted from 203 millet materials (leaves). After the DNA quality inspection was qualified, it was quantitatively and qualitatively checked by NanoDropND-2000, Thermo Scientific, and the DNA integrity was tested by gel electrophoresis. According to the conventional method and its standard process, the experimental samples were amplified, fragmented, precipitated, resuspended, hybridized on the chip, and washed according to the standard process of the chip.

[0030] 1) Original millet chip data processing

[0031] First, the raw data obtained by scanning with the GeneTitan system was imported into the software Affymetrix Power Tools, and the raw data was clustered and genotyped using the software. Finally, the PLINK format data was exported through the Affymetrix Power Tools software for subsequent data analysis. The PLINK format data was further converted into SNP VCF format data using the PLINK program, and the VCF format data was further analyzed.

[0032] 2) Conversion of chip SNP data

[0033] The total SNP VCF files were screened and the VCF files of SNPs of maturity traits were obtained according to the number of samples with phenotypes at different stages. Vcftools was used for processing.

[0034] 3) Sample population structure analysis

[0035] ADMIXTURE program was used to perform principal component analysis to obtain the population clustering of the samples.

[0036] 4) Linkage disequilibrium (LD) analysis

[0037] The linkage disequilibrium coefficient (r2) is used to measure the linkage disequilibrium level between SNP sites on chromosomes. When r2 = 0, it means that the population is in linkage equilibrium or has no LD. The larger the r2, the closer the distance between SNP sites. Generally, when r2 is greater than or equal to 0.8, the two sites are considered to be in linkage disequilibrium. The distance between sites corresponding to the decay of r2 to half is used as the linkage disequilibrium decay distance. The VCFtools software is used to calculate the decay value of linkage disequilibrium, and a nonlinear regression model is used to draw a trend graph of the decay of r2 as the physical distance between SNP sites increases.

[0038] 5) GWAS analysis of chip data and prediction of candidate genes

[0039] Based on the customized SNP chip (Affymetrix chip) with 82738 loci, we further screened the SNP loci that appeared in at least 95% of the samples, and obtained a total of 55688 SNP loci in the mature stage. Entering the formal GWAS analysis, the R package GWASpoly analysis process was used to perform various phenotypic association analyses at different developmental stages. In the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure + kinship) was used to draw QQ-Plot graphs and Manhattan graphs. For the SNPs with significant phenotypic associations, we searched for genes within 10kb upstream and downstream, and annotated the SNP loci functionally. The results showed that the significant SNP associated with the posture of the ear stem in the mature stage of millet was located on chromosome 2 (2_49086726). The polymorphism of this locus is A / T, and the additive is 6.84. And by Figure 1 It can be seen that the clustering of ADMIXTURE needs to calculate the CV error (correlation error) under different K values. The trend of K value is to decrease first and then increase ( Figure 1 ), the K value at the beginning of the rise is the number of ancestral groups with the best genetic background. This experiment can be divided into approximately 35 ancestral groups. Figure 2 It can be seen that the LD decay distance of the foxtail millet genome in this embodiment is 9 M. A smaller LD decay distance is beneficial to narrowing the candidate regions for subsequent association analysis and improving the accuracy of the association results.

[0040] Example 2: Based on the SNP sites located in the above example, this example develops molecular markers related to the posture of the ear stem at the mature stage of millet, the molecular markers include a first molecular marker and a second molecular marker, the first molecular marker includes the 49086726th site of chromosome 2 of millet; the nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1;

[0041] The second molecular marker includes position 49102814 of chromosome 2, and the nucleotide sequence of the second molecular marker is shown as SEQ ID No.2.

[0042] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and is specifically as follows:

[0043] ACAGATTTGCGCAACTGCACAGAGATGTGTACAGT[A / T]GGGGATGCGAGAGAGGTGGTGTTAACACTCCATGA, the 36th base is an A / T allele variation.

[0044] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and is specifically as follows:

[0045] CCTTCCTAACCAATAAAACCAACTGAATAGAAGGA[A / C]GGACGAATTCACATACCTGCAGGGTTAACGCGCTT, the 36th base is the A / C allele variation.

[0046] The above molecular markers can be applied to predict the posture of the ear stem at maturity. Specifically, according to routine operations, Primer Premier is used to design molecular primers corresponding to the molecular markers (this is a conventional technology and will not be described in detail here. It was commissioned to Beijing Compson Biotechnology Co., Ltd.), and the genome of millet is used as a template. Specifically, the DNA of millet leaves or seeds can be used as a template, and primers are used for PCR amplification. The amplification products are sequenced and identified, and the posture of the ear stem of millet at maturity is predicted based on the identification results.

[0047] Example 3: SNP marker verification

[0048] Statistics were collected on the ear stem postures of 203 materials in Example 1 at maturity, among which 63 materials had hooked ear stems at maturity, 52 were strongly bent, 53 were straight, and the rest were moderately bent.

[0049] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP locus associated with the posture of the ear stem at the maturity stage of millet, characterized in that: The SNP sites include a first SNP site and a second SNP site, the first SNP site is located at position 49086726 of chromosome 2 of millet, and its allele variation is A / T; the second SNP site is located at position 49102814 of chromosome 2, and its allele variation is A / C.

2. Use of a substance for detecting the polymorphism or genotype of SNP in a millet genome in any of the following, characterized in that: The applications include: 1) Application in predicting the posture of ear stems at the maturity stage of millet; 2) Application in identification or auxiliary identification of panicle stem posture traits at the maturity stage of millet; 3) Application in the improvement of millet ear-stem posture during maturity period, related breeding or auxiliary breeding; The SNP sites include a first SNP site and a second SNP site, the first SNP site is located at position 49086726 of chromosome 2 of millet, and its allele variation is A / T; the second SNP site is located at position 49102814 of chromosome 2, and its allele variation is A / C.

3. A molecular marker related to the posture of the ear stem at the maturity stage of millet, characterized in that: The molecular marker includes a first molecular marker and a second molecular marker, the first molecular marker includes the 49086726th position of chromosome 2 of millet; the nucleotide sequence of the first molecular marker is shown as SEQ ID No.1; the second molecular marker includes the 49102814th position of chromosome 2, and the nucleotide sequence of the second molecular marker is shown as SEQ ID No.

2.

4. Use of the molecular marker associated with the posture of the panicle stem at the mature stage of millet according to claim 3 in any of the following applications, characterized in that: The applications include: 1) Application in predicting the posture of ear stems at the maturity stage of millet; 2) Application in identification or auxiliary identification of panicle stem posture traits at the maturity stage of millet; 3) Application in breeding or auxiliary breeding for improvement of the ear-stem posture at the mature stage of millet.

5. A method for predicting the posture of the ear stem of millet at maturity, characterized in that: Using a specific probe or chip for detecting the SNP site described in claim 1, the millet genomic DNA of the prediction object is detected to obtain the base situation of the allele variation site of the SNP site described in claim 1, and predict the performance of the panicle stem posture trait of the millet at maturity according to the base situation; Alternatively, the DNA of a single leaf or seed of millet is used as a template, and the primers corresponding to the molecular marker of claim 3 are used for PCR amplification, and the amplified products are sequenced and identified, and the performance of the panicle stem posture traits of millet at maturity is predicted based on the identification results.

Images