SNP marker for detecting pepper rust and application thereof

Abstract

The application provides a SNP marker for detecting pepper rust and application, the SNP marker is 30616-314, the 314th base from the 5' end is T or C, the SNP marker corresponds to a genotype, and when the genotype is CC, the genotype is high in resistance to pepper rust; when the genotype is CT, the genotype is medium in resistance to pepper rust. The SNP marker can accurately detect the morphology of pepper rust, and through gene means, the detection period can be greatly shortened, and the detection accuracy can be improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of SNP marker, and particularly relates to a SNP marker for detecting pepper rust and application thereof. BACKGROUND

[0002] Pepper rust is a fungal disease caused by Coleosporium zanthoxyli. Pepper rust is a leaf disease that occurs universally in pepper cultivation areas. Pepper rust mainly damages leaves, especially young leaves, and a small part of it damages the fruits and petioles of peppers, which can cause a large number of leaves to fall off, resulting in the emergence of new leaves on the pepper tree. This not only affects the nutrient accumulation of the pepper tree in the current year and the yield and quality of the pepper in the next year, but also has a great threat to the life of the pepper tree. In China, chemical control methods are mainly used to prevent and control pepper rust, but long-term use of chemical pesticides leads to drug resistance of the pathogen and serious environmental pollution. Therefore, it is urgent to find and establish a green control method. At present, the development and utilization of disease-resistant varieties is the most economical and effective method for disease control. At present, field observation and artificial inoculation of pathogens are commonly used to evaluate the resistance of different varieties (clones) of pepper to rust. However, the field observation period is relatively long and is greatly affected by the environment. However, the artificial inoculation method cannot completely simulate the natural environment, and the results are not completely reliable. Therefore, finding an accurate and rapid resistance identification method is a key problem in the process of pepper rust resistance breeding research.

[0003] Single nucleotide polymorphisms (SNP) mainly refers to the polymorphism caused by the substitution of a single nucleotide in the genomic sequence. SNPs are the most abundant in all genetic variations. As the third generation of molecular marker technology, SNPs have the advantages of high marker density, wide distribution, automatic detection and large-scale screening, strong representation, genetic stability, and low mutation frequency compared with the previous two generations of molecular markers. Although the research on plants started late, it has developed very rapidly. With the maturity of sequencing technology and the reduction of cost, rapid detection of SNPs in woody plants has become possible and the technology has become more mature. SNP marker-assisted breeding methods have received more and more attention. Plant diseases occur frequently and widely, causing very serious adverse effects in production. However, there are many plant species with long growth cycles in our production, and the method of disease-resistant breeding is currently the most recognized method for disease control. However, the efficiency of this method is very low for some plants with long growth cycles. However, the use of molecular marker-assisted breeding selection can greatly improve our breeding efficiency. On the other hand, a disease-resistant variety that has been shown to be resistant to disease may lose its resistance over time, posing a great challenge to pepper disease-resistant breeding. Therefore, it is particularly important to continuously select new disease-resistant varieties.

[0004] Disease-resistant breeding relies on disease resistance identification. Traditional artificial inoculation and long-term field observations can lead to discrepancies in judgment standards due to interference from human factors and environmental factors. Therefore, using molecular markers to identify the disease resistance of different Zanthoxylum bungeanum varieties during the seedling stage and select disease-resistant varieties for cultivation can save considerable time and significantly shorten the breeding cycle. However, progress in Zanthoxylum bungeanum molecular biology has been slower than that of other woody plants, and there are currently no reports on the development and screening of SNP molecular markers associated with rust resistance genes in Zanthoxylum bungeanum. Summary of the Invention

[0005] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a SNP marker for detecting pepper rust and its application, so as to provide a molecular biology method for rapid detection of pepper rust.

[0006] The technical solution of the present invention to solve the above technical problems is as follows: The present invention provides a SNP marker for detecting pepper rust, the SNP marker is 30616-314, and the gene sequence where the SNP marker is located is shown in SEQ ID NO.1, wherein the SNP marker is at the 314th base from the 5' end of the above gene sequence; the base of the SNP marker is T or C.

[0007] The present invention provides a primer set for detecting the SNP marker of the above-mentioned pepper rust disease, the primer set comprising a common primer 30616-314-F, a normal base primer 30616-314-R1 and a mutant base primer 30616-314-R2; wherein the nucleotide sequence of 30616-314-F is shown in SEQ ID NO.2; the nucleotide sequence of 30616-314-R1 is shown in SEQ ID NO.3; and the nucleotide sequence of 30616-314-R2 is shown in SEQ ID NO.4.

[0008] The present invention provides a kit for detecting the above-mentioned SNP marker, comprising the above-mentioned primer set.

[0009] The present invention provides an application of the SNP marker, the primer set or the kit in disease-resistant breeding of Zanthoxylum bungeanum.

[0010] The present invention also provides a method for detecting Zanthoxylum bungeanum rust, which determines the Zanthoxylum bungeanum rust resistance type by detecting the above-mentioned SNP markers on the Zanthoxylum bungeanum to be tested.

[0011] Further, the specific steps are as follows:

[0012] (1) extracting the Zanthoxylum bungeanum genomic DNA to be tested;

[0013] (2) using the three primers mentioned above to form a normal base primer pair 30616-314-F, 30616-314-R1 and a mutant base primer pair 30616-314-F, 30616-314-R2, respectively, and using the normal base primer pair and the mutant base primer to perform PCR amplification on the Zanthoxylum bungeanum genomic DNA to be tested in step (1) to obtain a PCR amplification product;

[0014] (3) Detect the PCR amplification products to determine the type of resistance of the tested Zanthoxylum bungeanum to Zanthoxylum bungeanum; if a band is amplified only by the mutant base primer pair, it indicates that the tested Zanthoxylum bungeanum is highly resistant to Zanthoxylum bungeanum; if bands are amplified by both the mutant base primer pair and the normal base primer pair, it indicates that the tested Zanthoxylum bungeanum is moderately resistant to Zanthoxylum bungeanum; if no band is amplified by the mutant base primer pair, it indicates that the tested Zanthoxylum bungeanum is susceptible to Zanthoxylum bungeanum.

[0015] The present invention has the following beneficial effects: based on the results of previous field identification and inoculated pathogen identification, and based on the transcriptome sequencing results of healthy and diseased resistant and susceptible varieties of Zanthoxylum bungeanum, this study screened genes that may be related to resistance by analyzing the differential gene expression in disease-resistant and susceptible Zanthoxylum bungeanum varieties (asexual lines) and related gene function annotation results, and searched for SNP markers that may be related to Zanthoxylum bungeanum rust resistance. The SNP markers were genotyped using allele-specific PCR technology, and SNP molecular markers related to Zanthoxylum bungeanum rust resistance were developed. The markers were used to identify germplasm resources, in order to provide a rapid and accurate molecular biology method for the screening and identification of Zanthoxylum bungeanum rust-resistant germplasm, thereby promoting the healthy development of the Zanthoxylum bungeanum industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results of 1-20 pairs of normal primers for amplifying the genomic DNA of Youkang and Tengjiao materials;

[0017] Figure 2 The results of 1-20 pairs of mutant primers amplifying the genomic DNA of Youkang and Tengjiao materials;

[0018] Figure 3 The amplification results of mutant primer No. 2 in 12 resistant and susceptible materials are shown. DETAILED DESCRIPTION

[0019] The following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. In the examples, where specific conditions are not specified, the experiments were performed under conventional conditions or those recommended by the manufacturer. Reagents or instruments used, where the manufacturer is not specified, are commercially available conventional products.

[0020] Example 1: Screening of disease resistance genes and SNP markers

[0021] (1) Test materials

[0022] ① Test strain: Coleosporium zanthoxyli. (Accession number: NL4: MN608178.1, ITS: MN611081.1) was preserved in the Forest Pathology Laboratory of Sichuan Agricultural University.

[0023] ② Test Plants: Two-year-old healthy plants of the "Tengjiao" and "Youkang" varieties were collected from the Modern Agriculture Research and Development Base of Sichuan Agricultural University in Chongzhou, Chengdu, Sichuan Province. Forty Zanthoxylum bungeanum varieties were collected from Zanthoxylum bungeanum cultivation areas in Meishan, Zigong, Liangshan, Chongqing, and Yunnan Provinces of Sichuan Province. See Table 1 for details.

[0024] ③ Transcriptome Data Source: RNA was extracted from tissues or cells using standard extraction methods. RNA samples were then rigorously quality-controlled, and RNA integrity was accurately measured using an Agilent 2100 bioanalyzer, with RNA integrity and total amount as primary indicators. RNA extraction, library construction, and sequencing were performed by Beijing Novogene Bioinformatics Technology Co., Ltd.

[0025] Table 1 Sources of tested Zanthoxylum bungeanum varieties (lines)

[0026]

[0027]

[0028] (2) Screening of disease resistance genes and SNP markers

[0029] Based on the transcriptome sequencing data, the gene expression levels are analyzed. After obtaining the gene expression amount, the expression data can be statistically analyzed to screen genes with significant differences between different samples.

[0030] According to different experimental conditions, we selected appropriate software to perform gene expression difference significance analysis, as shown in Table 2. The Nr, Nt, Pfam, KOG / COG, Swiss-prot, KEGG, and GO databases were compared to annotate gene functions. The results were sorted by chromosome coordinates and duplicate reads were removed using tools such as samtools and picard-tools. Finally, SNPCalling and InDel Calling were performed respectively using the variant detection software GATK3 (Van der Auwera et al, 2013). The original results were filtered (SNPs with a quality value of less than 40 and a distance of less than 2 were filtered out) to obtain the analysis results. Based on the gene function annotation results and the significance of the differentially expressed genes, non-synonymous mutation markers in the coding regions with significantly different read values ​​between Tengjiao and Youkang were selected.

[0031] Table 2 Software used for differential expression analysis and differential gene screening criteria

[0032]

[0033] Based on the statistical results of gene expression levels and differential gene expression analysis, genes with significant differences were found. In addition, through the gene function annotation results, the results of the screened differential genes in the gene function annotation were searched, and genes that may be related to the disease resistance of Zanthoxylum bungeanum were selected as candidate disease resistance genes. The screening results are shown in Table 3.

[0034] Table 3 Candidate disease resistance genes

[0035]

[0036] Based on the results of SNP calling, the unigene sequences and SNP marker information of the candidate genes were screened, and non-synonymous mutation markers in the coding regions with significantly different read values ​​between Tengjiao and Youkang were selected as candidate SNP markers. The screening results are shown in Table 4.

[0037] Table 4 SNP marker information of screening genes

[0038]

[0039]

[0040] Example 2: Design and screening of SNP primers

[0041] According to the gene and SNP marker information screened out in Example 1, the Unigene sequence was used as the reference sequence and allele-specific PCR (AS-PCR) technology was used to perform SNP marker analysis. Three primers were designed for each SNP marker, one common primer and two specific primers. The 3' end bases of the specific primers were matched with the two base types of the SNP marker, and the specific primers formed primer pairs with the common primers for PCR amplification. Primers were designed using Primerprimer5.0 and Oligo7.0 software. A total of 20 pairs of primers were designed. The designed primers were synthesized by the Chengdu Synthesis Department of Youkang Biotechnology Co., Ltd. Using DNA from leaves of pepper and Youkang varieties (clones) as templates, PCR amplification was performed using a 25uL reaction system (see Table 5 for the PCR reaction system). The PCR products were detected by electrophoresis on 1% agarose gel. After testing, a pair of SNP marker-specific primers were obtained: 30616-314-F, 30616-314-R1, and 30616-314-R2. The nucleotide sequence of the common primer 30616-314-F is: CGGCATCATACTAGAA GACT (SEQ ID NO. 2); the nucleotide sequence of the normal base primer 30616-314-R1 is: GCTCCAGAG GGTCCATA (SEQ ID NO. 3); and the nucleotide sequence of the mutant base primer 30616-314-R2 is: GCTCCA GAGGGTCCATG (SEQ ID NO. 4).

[0042] Table 5 PCR reaction system

[0043]

[0044] Using the genomic DNA of the leaves of the rust-resistant material Youkang and the rust-susceptible material Tengjiao as templates, normal base primers and common primers were used to form primer pairs, and PCR amplification was performed using 2×TaqPCRMasterMix enzyme. The amplified products were detected by electrophoresis using 1% agarose. The electrophoresis detection results are as follows Figure 1 As shown (1-20 are primer numbers, with two lanes below each numbered primer, the left lane is the rust-resistant material Youkang, and the right lane is the rust-susceptible material Tengjiao), among which primer No. 7 only has a band in the susceptible material Tengjiao, and the amplified fragment size is consistent with the target fragment size, and the band shows polymorphism. The normal base primer pairs of primers No. 1, 2, 5, 11, and 12 did not amplify bands. Primers No. 3, 4, 6, 8, 9, 10, 13, 14, 15, 16, 17, 18, 19, and 20 amplified bands in both Youkang and Tengjiao materials and did not have polymorphism.

[0045] Using the genomic DNA of the leaves of the rust-resistant material Youkang and the rust-susceptible material Tengjiao as templates, the mutant base primers and the common primers formed a primer pair, and 2× TaqPCR MasterMix enzyme was used for PCR amplification. The amplified products were detected by electrophoresis using 1% agarose. The electrophoresis detection results are as follows Figure 2 As shown (1 to 20 are primer numbers, with two lanes below each numbered primer, the left lane is the rust-resistant material Youkang, and the right lane is the rust-susceptible material Tengjiao), primer No. 2 only produced a band in the disease-resistant material Youkang, but not in the susceptible material Tengjiao. The amplified fragment size was consistent with the target fragment size, and the bands showed polymorphism. The mutant base primer pairs of primers No. 1, 5, 11, and 12 did not amplify bands. Primers No. 3, 4, 6, 7, 8, 9, 10, 13, 14, 15, 16, 17, 18, 19, and 20 amplified bands in both Youkang and Tengjiao materials and did not show polymorphism.

[0046] Example 3: Construction of Zanthoxylum bungeanum resistance and sensitivity difference population

[0047] The results of field observations over many years showed that Youkang, Xintengjiao, Luqing No. 1, Luqing No. 2, Yuanshi Tuotuojiao, and Dayexiujiao were resistant to the disease, while Tengjiao, Zaoshu Jiuyeqing, Hanyuan Grape Green Pepper, Pingchang Green Pepper, Jinyang Green Pepper, and Huishuijiao were susceptible to the disease. There were 12 varieties (clones) of Zanthoxylum bungeanum with different resistance and susceptibility levels, as detailed in Table 6.

[0048] Table 6 Sources of tested Zanthoxylum bungeanum varieties (lines) and their resistance performance in the field

[0049]

[0050]

[0051] Example 4: Validation of disease resistance-related SNP primers

[0052] (1) Genomic DNA from Zanthoxylum bungeanum leaves was extracted using the Ecoray Plant Tissue DNA Extraction Kit (CTAB method). The extraction method was improved during use, taking into account the characteristics of Zanthoxylum bungeanum itself that is rich in polyphenols and polysaccharides. The DNA concentration and purity were detected using an ultramicrospectrophotometer and 1% agarose gel electrophoresis. The DNA was diluted to 40 ng / μL and stored at -20°C for future use.

[0053] (2) When PCR amplification is performed using specific primers designed based on the screened SNP markers, the amplified products of the disease-resistant and susceptible materials will show polymorphic bands after agarose gel electrophoresis. The band difference of allele-specific PCR is generally the presence or absence of the band. The primer pairs with differential bands in the pepper and Youkanglin materials were screened out, and then the leaf genomic DNA of the Zanthoxylum bungeanum varieties (clones) of the constructed resistance-susceptibility differential group was used as a template for PCR amplification to verify the stability and accuracy of the marker. The primer pairs with high consistency between the field performance and the molecular marker amplification identification results and stable amplification were selected as SNP molecular markers, and the resistance of different Zanthoxylum bungeanum varieties (lines) was analyzed based on their amplified band patterns.

[0054] According to the constructed resistance-susceptibility differential populations, genomic DNA of 6 rust-resistant materials (Youkang, Xintengjiao, Luqing No. 2, Dayexiujiao, Luqing No. 1 and Yuanshituotuojiao) and 6 rust-susceptible materials (Tengjiao, Zaoshu Jiuyeqing, Hanyuan Grape Green Pepper, Pingchang Green Pepper, Jinyang Green Pepper and Huishuijiao) were used as templates. The primers with polymorphism in Youkang and Tengjiao materials were further verified by allele-specific PCR, and the PCR amplification products were detected by 1% agarose gel electrophoresis.

[0055] The results are analyzed as follows: After verification, only the mutant base primer pair No. 2 can satisfy the requirement of having bands in the disease-resistant materials and no bands in the susceptible materials, which has a certain stability. Figure 3 (No. 1-6 are Youkang, New Vine Pepper, Luqing No. 2, Big Leaf Stinky Pepper, Luqing No. 1 and Original Tuotuo Pepper; No. 7-12 are Vine Pepper, Early Mature Nine-Leaf Green, Hanyuan Grape Green Pepper, Pingchang Green Pepper, Jinyang Green Pepper and Huishui Pepper).

[0056] The SNP molecular identification results of different Zanthoxylum bungeanum varieties (clones) were analyzed for consistency with the field phenotypic traits. The analysis results are shown in Table 7. The mutant base primer pair No. 2 can quickly detect the disease resistance of different varieties (clones) to Zanthoxylum bungeanum rust and is a SNP molecular marker with certain application value.

[0057] Table 7 Molecular identification results of different varieties (clones) and consistency analysis of field phenotypic traits

[0058]

[0059]

[0060] Example 5: SNP markers used for identification of rust-resistant strains of Zanthoxylum bungeanum and verification of Zanthoxylum bungeanum inoculation

[0061] (1) Using the selected SNP markers, PCR amplification was performed using genomic DNA from 40 Zanthoxylum bungeanum varieties collected from the Modern Agricultural Research and Development Base of Sichuan Agricultural University in Meishan, Zigong, Liangshan, Chongqing, Yunnan, and other areas of Sichuan Province as templates, followed by 1% agarose gel electrophoresis. The SNP reaction system and procedures were the same as in 1.4. The results of molecular marker resistance identification were statistically analyzed for early screening and identification of Zanthoxylum bungeanum resistance in different Zanthoxylum bungeanum varieties (lines).

[0062] (2) Six Zanthoxylum bungeanum materials were randomly selected from the 40 samples for molecular marker resistance identification, and Zanthoxylum bungeanum leaves of similar developmental stage and size were selected for leaf in vitro analysis. Leaves were taken from the 3rd and 4th nodes starting from the stem tip. 90 healthy leaves were treated for each genotype, with 3 replicates. The leaves were cleaned with a brush in distilled water on the back before inoculation, and the rust spore suspension was sprayed to cover the leaf surface and used for subsequent experiments. The inoculated leaves were wrapped in polypropylene plastic bags and kept at 90%-100% humidity for 24 hours. The control leaves (90 leaves for each genotype) were treated with distilled water.

[0063] (3) The incidence and severity of disease on each leaf were recorded 10 days after inoculation and used to calculate the disease index (DI) for each genotype. The resistance evaluation criteria are as follows: DI = 0 for immunity (I); "high resistance (HR)" (0 ≤ DI < 0.2); "resistance (R)" (0.2 ≤ DI < 0.4); "susceptible (S)" (0.40 ≤ DI < 0.60); and "highly susceptible (HS)" (0.60 ≤ DI < 1). See Table 8 for details.

[0064] Table 8 Grading standards for severity of pepper rust

[0065]

[0066]

[0067] Disease index = [∑(number of disease points × disease level) / (total number of survey points × highest level of disease index)] × 100.

[0068] Using primers 30616-314-F and 30616-314-R related to Zanthoxylum bungeanum rust, resistance identification was conducted on 40 Zanthoxylum bungeanum materials collected from the Modern Agricultural Research and Development Base of Sichuan Agricultural University, Meishan City, Zigong City and other Zanthoxylum bungeanum cultivation areas. The results showed that 14 varieties including 'Youkang', 'Luqing No. 2' and 'Xin Tengjiao' were able to amplify a band of 330bp in size and were preliminarily judged as disease-resistant varieties; 26 varieties including 'Tengjiao', 'Zaoshu Jiuyeqing' and 'Hanyuan Grape Green Pepper' could not amplify a band of 330bp in size and were preliminarily judged as susceptible varieties. Six materials were randomly selected from the 40 materials for artificial inoculation resistance identification. Among them, the artificial inoculation disease indexes of 'Youkang', 'Luqing No. 2', and 'Xintengjiao' were 0.12, 0.15, and 0.10, respectively, indicating that they were resistant varieties; the artificial inoculation disease indexes of 'Tengjiao', 'Zaoshu Jiuyeqing', and 'Hanyuan Grape Green Pepper' were 0.34, 0.57, and 0.57, respectively, indicating that they were susceptible varieties. The results were consistent with the resistance identification results (see Table 9 for details).

[0069] Table 9 Disease resistance identification results

[0070]

[0071]

[0072] Note: “-” means no target band; “+” means target band;

[0073] The nucleotide sequence of the SNP marker in the present invention is as follows:

[0074] GGCGCCGGCATCATACTAGAAGACTGAAAGAATGGGAGCAAAAAAATTTGATAAATGAGTTGAGACAAGGGAGGGAGCTAGCAGAGCTGCTTAAAGTTCAGCTCAACACACCTTTCATTTTTCTCCTCAGATGATCAAGCTCGAGAAATGTTAGTTCAAAAGATTATG TCTTCATATGAGAAAGTGCTTCACATGCTCAACTTCAACAACTCATCATCGACTCTAGATCCGCAGCTGACAGGACTCATGATCAAATCCCCAACTTCTTTAGGCATGAGTTCATGGAGCAATCTGGACTTTGAGGGAAGTGTTATGGACCCTCTGGAGC(SEQ ID NO.1).

[0075] The above merely describes preferred embodiments of the present application, and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A primer set for detecting SNP markers of Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum rust, characterized in that: The primer set includes a common primer 30616-314-F, a normal base primer 30616-314-R1 and a mutant base primer 30616-314-R2; wherein the nucleotide sequence of 30616-314-F is shown in SEQ ID NO.2; the nucleotide sequence of 30616-314-R1 is shown in SEQ ID NO.3; the nucleotide sequence of 30616-314-R2 is shown in SEQ ID NO.4; the SNP marker is 30616-314, and the gene sequence where the SNP marker is located is shown in SEQ ID NO.1, wherein the SNP marker is at the 314th base from the 5' end of the gene sequence; the base of the SNP marker is T or C.

2. A kit for detecting SNP markers of Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum rust, characterized in that, Comprising the primer set of claim 1; the SNP marker is 30616-314, the gene sequence where the SNP marker is located is shown in SEQ ID NO.1, wherein the SNP marker is at the 314th base from the 5' end of the gene sequence; the base of the SNP marker is T or C.

3. the application of the primer set described in claim 1 or the test kit described in claim 2 in the breeding of Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum rust, is characterized in that, The SNP marker is 30616-314, and the gene sequence where the SNP marker is located is shown in SEQ ID NO.1, wherein the SNP marker is at the 314th base from the 5' end of the gene sequence; the base of the SNP marker is T or C.

4. A method for detecting Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum rust, characterized in that, The type of Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum is determined by detecting a SNP marker for Zanthoxylum bungeanum resistance to Zanthoxylum bungeanum rust. The SNP marker is 30616-314, and the gene sequence where the SNP marker is located is shown in SEQ ID NO.1, wherein the SNP marker is at the 314th base from the 5' end of the gene sequence; the base of the SNP marker is T or C.

5. The method according to claim 4, wherein The specific steps are as follows: (1) Extracting genomic DNA from Zanthoxylum bungeanum to be tested; (2) using the three primers in claim 1 to form a normal base primer pair 30616-314-F, 30616-314-R1 and a mutant base primer pair 30616-314-F, 30616-314-R2, respectively, and using the normal base primer pair and the mutant base primer pair to perform PCR amplification on the Zanthoxylum bungeanum genomic DNA to be tested in step (1), respectively, to obtain a PCR amplification product; (3) Detect the PCR amplification products to determine the type of resistance of the tested pepper to pepper rust. If only the mutant base primer pair amplifies a band, it means that the tested pepper is highly resistant to pepper rust. If both the mutant base primer pair and the normal base primer pair amplify bands, it means that the tested pepper is moderately resistant to pepper rust. If no band is amplified by the mutant base primer pair, it means that the tested pepper is susceptible to pepper rust.

Images