Primer combination for identifying Laping spotted pigs and identification method of Laping spotted pigs

Abstract

The invention relates to the technical field of biology, in particular to a primer combination for identifying Leyping spotted pigs and an identification method of the primer combination, six specific SNP molecular markers (SNP1-SNP6) are obtained through whole genome screening, six pairs of specific PCR primers are designed and developed on the basis of the sites, the nucleotide sequences of the primers are shown as SEQ ID NO.1-12, and the primer combination is used for identifying the Leyping spotted pigs. And when the genotypes of the to-be-detected sample at the SNP1-SNP6 sites are CC, TT, TT, AA, CC and GG respectively, the to-be-detected sample can be confirmed as a purebred individual of the Licping spotted pig. Compared with a traditional phenotype identification method, the molecular marker detection system established by the invention has the advantages of high detection efficiency, good accuracy and flux. The technical scheme provided by the invention provides important technical support for genetic resource conservation, variety purity identification and genetic improvement of the Leyping spotted pigs, and has remarkable application value in the field of livestock breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, and more particularly, to a primer combination for identifying Leiping flower pigs and a method for identifying the same. BACKGROUND

[0002] Leiping flower pigs are a rare local pig breed in Jiangxi Province, China, known for their strong resistance to adversity and delicate meat quality. However, in recent years, due to the blind pursuit of economic benefits, breeders have introduced a large number of foreign breeds such as Duroc and Landrace for crossbreeding, resulting in a serious mixing of the genetic background of Leiping flower pigs. According to statistics, the proportion of purebred Leiping flower pigs in Jiangxi is less than 30%.

[0003] Traditional identification relies on phenotypic characteristics such as coat color (black and white patches) and head shape (wrinkles on the forehead), but there are significant drawbacks:

[0004] Environmental interference: nutritional levels and feeding conditions can significantly change the appearance of pigs;

[0005] Hybrid confusion: hybrid offspring may retain the patchy characteristics, but their genetic composition has changed;

[0006] Subjective error: the difference in judgment of phenotypic standards by different identification personnel can be more than 20%.

[0007] Existing molecular identification techniques (such as SSR markers) have partially solved the above problems, but they have low throughput, high cost, and insufficient stability of the sites. Single nucleotide polymorphism (SNP) as the third generation of molecular markers has the advantages of abundant sites, genetic stability, and high degree of automation in detection, but a high-specificity SNP marker combination system has not yet been established in Leiping flower pigs.

[0008] Therefore, we propose a primer combination for identifying Leiping flower pigs and a method for identifying the same to solve the above problems. SUMMARY

[0009] In order to overcome the above-mentioned defects of the prior art, the embodiments of the present application provide a primer combination for identifying Leiping flower pigs and a method for identifying the same to solve the problems raised in the background art.

[0010] To achieve the above-mentioned purpose, the present application provides the following technical solutions: a primer combination for identifying Leiping flower pigs and a method for identifying the same, comprising primer pairs capable of amplifying any 1-6 SNP sites:

[0011] SNP1: located at position 207,753,485 of pig chromosome 1 (CHR1), with polymorphism C / T;

[0012] SNP2: located at position 77,167,117 of pig chromosome 7 (CHR7), with polymorphism T / C;

[0013] SNP3: located at position 143,013,672 of porcine chromosome 13 (CHR13), with a T / C polymorphism;

[0014] SNP4: located at position 35,413,298 of porcine chromosome 14 (CHR14), with the polymorphism A / G;

[0015] SNP5: located at position 27,187,729 of porcine chromosome 14 (CHR14), with a polymorphism of C / A;

[0016] SNP6: Located at position 45,287,494 of porcine chromosome 16 (CHR16), the polymorphism is G / A.

[0017] In a preferred embodiment, the primer pair amplifies any 4-6 of the SNP1-SNP6 sites.

[0018] In a preferred embodiment, the primer pair amplifies any 5-6 of the SNP1-SNP6 sites.

[0019] In a preferred embodiment, the primer pair amplifies all six sites of SNP1-SNP6.

[0020] In a preferred embodiment, the method comprises at least one pair of primers:

[0021] SNP1 site primer: forward SEQ ID NO.1, reverse SEQ ID NO.2;

[0022] SNP2 site primer: forward SEQ ID NO.3, reverse SEQ ID NO.4;

[0023] SNP3 site primers: forward SEQ ID NO.5, reverse SEQ ID NO.6;

[0024] SNP4 site primer: forward SEQ ID NO.7, reverse SEQ ID NO.8;

[0025] SNP5 site primer: forward SEQ ID NO.9, reverse SEQ ID NO.10;

[0026] SNP6 site primer: forward SEQ ID NO.11, reverse SEQ ID NO.12.

[0027] In a preferred embodiment, a method for identifying Leping spotted pigs comprises the following steps:

[0028] Step S1: extracting genomic DNA from the pigs to be tested;

[0029] Step S2: PCR amplification of SNP1-SNP6 loci using the primer sets of claims 1-5;

[0030] Step S3: Sequencing of the amplification products to obtain the genotypes of each SNP locus;

[0031] Step S4: If the genotypes of SNP1-SNP6 loci are CC, TT, TT, AA, CC, and GG in sequence, it is determined as a Laiwu pig purebred individual.

[0032] In a preferred embodiment, the genomic DNA of the individual to be tested in step S1 is obtained from the ear tissue of the individual to be tested.

[0033] In a preferred embodiment, step S4 further comprises:

[0034] If the genotype of any SNP locus does not meet the Laiwu pig purebred standard, it is directly excluded as a Laiwu pig;

[0035] If all loci meet the standard, the breed probability is calculated by the Bayes formula;

[0036] The calculation formula of Bayes theorem is as follows:

[0037]

[0038] Wherein, Pi represents the frequency of the genotype corresponding to other breeds in the i-th SNP locus in the SNP locus combination, and i is an integer from 1 to 6.

[0039] In a preferred embodiment, the genotype frequency of the SNP locus satisfies:

[0040] In Laiwu pigs, the target genotype frequency of each SNP locus is 1;

[0041] In other pig breeds, the target genotype frequency is ≤0.006.

[0042] The technical effects and advantages of the present application are:

[0043] 1. Ultra-high specificity: 6 SNP loci are all fixed homozygous genotypes in Laiwu pigs, such as SNP1: CC, while the target genotype frequency of other pig breeds is ≤0.006; based on the Bayes probability model, the identification accuracy of 3 locus combinations reaches 99.97%, and that of 4 loci reaches 99.99%.

[0044] 2. High efficiency and low cost: only ordinary PCR instrument and sequencing equipment are needed, and the cost of detecting a single sample is low; 96 / 384 samples can be processed at the same time, which is suitable for large-scale pig farm screening.

[0045] 3. Exclusion mechanism: any SNP locus that does not meet the standard can be determined as a non-purebred.

[0046] 4. Probability mechanism: when all the conditions are met, the probability of the breed is calculated to avoid false negatives.

[0047] 5. Application value: provides a molecular identity card for the local pig germplasm bank; suppresses the behavior of using hybrid pigs to impersonate Leping flower pigs in the market, and safeguards the breeding households' premium income. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 The figure is a genotype frequency histogram of SNP1 site in the embodiment of the present application.

[0049] Figure 2 The figure is a genotype frequency histogram of SNP2 site in the embodiment of the present application.

[0050] Figure 3 The figure is a genotype frequency histogram of SNP3 site in the embodiment of the present application.

[0051] Figure 4 The figure is a genotype frequency histogram of SNP4 site in the embodiment of the present application.

[0052] Figure 5 The figure is a genotype frequency histogram of SNP5 site in the embodiment of the present application.

[0053] Figure 6 The figure is a genotype frequency histogram of SNP6 site in the embodiment of the present application. DETAILED DESCRIPTION

[0054] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0055] Reference Figures 1-6 The inventors found 6 SNP sites affecting the phenotype of Leping flower pigs, which are SNP1 site to SNP6 site in Table 1.

[0056] Table 1: 6 SNP sites affecting the phenotype of Leping flower pigs

[0057]

[0058] The screening method of the above SNP site is as follows: first, determine the appearance similar and widely circulated in the market of Jiangxi local pig breeds such as Leping flower pig, Binhu black pig, Yushan black pig, Gandong black pig and Hang pig, and divide them into Leping flower pig and other pigs two groups; the allele frequency of each SNP site is calculated respectively, and then the results of the two groups are compared, and the SNP site with frequency of 0 or 1 in Leping flower pig and great difference with other pigs is screened out.

[0059] Accordingly, the inventors designed a primer combination for identifying Leping flower pig breeds, and the primer combination comprises any 1-6 kinds of primer pairs in Table 2:

[0060] Table 2 primer combination for identifying Leping flower pig breeds

[0061]

[0062] The inventors use the primer combination for identifying Leping flower pig breeds to identify Leping flower pig breeds, and the identification method comprises the following steps:

[0063] (1) Collecting ear tissue samples of the test individual, and extracting genomic DNA;

[0064] (2) Using the genomic DNA as a template, using the primer group as claimed in claim 1 to perform PCR amplification;

[0065] (3) Sequencing, genotyping the 6 SNP sites of the SNP molecular marker combination in claim 1, and obtaining the genotypes of the 6 SNP sites;

[0066] (4) According to the genotype, determining whether the test individual is a Leping flower pig; if one of the genotypes corresponding to the selected SNP site combination does not conform to the genotype corresponding to the Leping flower pig, it is determined that the test individual does not belong to the Leping flower pig; if all the genotypes corresponding to the selected SNP site combination conform to the genotype corresponding to the Leping flower pig, then according to Bayes' theorem, the probability that the test individual belongs to the Leping flower pig is determined.

[0067] In the identification method of the present application, one or several sites in SNP1-SNP6 are used for identification of Leping flower pig breeds, and the corresponding upstream and downstream primers are used for PCR amplification. The present application does not have special limitations on the PCR amplification method, and the conventional PCR amplification method in the art can be used.

[0068] Preferably, the genotypes and gene frequencies of the SNP sites in Leping flower pig and other breeds are shown in Table 3.

[0069] Table 3 Genotype and gene frequency of 6 SNP sites in Leping flower pig and other breeds

[0070]

[0071]

[0072] In the formula, the genotype frequencies of other breeds refer to the genotype frequencies of Binhu black pig, Yushan black pig, Gandong black pig and Hang pig as a group.

[0073] For example, if SNP1, SNP2 and SNP3 are selected, and the combined genotype is CC, TT and TT, the probability that the individual belongs to Leping flower pig is P = 1 / (1+0.06x0.06x0.06) = 0.9997.

[0074] SNP1 (1_207753485): the base sequence (5'-3') of about 250 bp (about 500 bp in total) upstream and downstream of it is shown in SEQ ID NO. 1. At position 250 of the sequence, the genotype of Leping flower pig is CC, while the genotype of other pig breeds at this site is CT or TT.

[0075] CCTTCACAGAAATATCTAGCTGGTGTTTAAGCAAACAACTATACATCATAACCCAAAGTTGACATATAAAATTAATCTTCACAGTCTCTATCAAAGATGGATCTGAGTAGAAAGCTGGTGAGTTATGATAACATAGATTGGGCAAAGATGAATCTTTGGCATGAAGGAAGTCTGGAAAATGCAGTGAAATTATGACGCACTAGGAGAAGAAAGAAGGTATTGGTATGGTTGGTACAGTATGTGGGAAGTTCTTTGCACATTGTACAATTACTGTGTTTCTTTTTCTAATTACATATTTTAATTGTTGCGAGTTCCATCCCACTCTTTGGTCTACTGATAATCTCTTTTTTAAATTAAATTTTCTTGGAATATAGTTGATTTACAATGTTGTGTTAGTTTCAGGTGTATAGCAAGGTGAATCAGTTATACATATACATATATCCATTCCTTTTTAGATTCTCTTCCCATATAGGTCACTACAGAGTATTGAGTAGATTTCC.

[0076] SNP2 (7_77167117): The base sequence (5'-3') of about 250 bp upstream and downstream (about 500 bp in total) is shown in SEQ ID NO. 2. At position 250 of this sequence, the genotype of Leping Hua pig is TT, while the genotype of other pig breeds at this site is CT or CC.

[0077] ATACTGTAGTAAGATTTATGCTCAAGAGCTTCCCAGGCTGACAGGATGTCAGAAACATCTGCAATCTGCCCCTTGTTTGGTCTTTCCCTCCCCTCTTCAGGTGCAGGAATCCTCATCTCAAGGTCTGAGTCTGGGGAACAGGACCTAAATAGTTGTCCATTAATTTTCATTGGTGAAAAAACTGTGGAACTGCTCATAATTATGCTATCTACGATAGACATGATAGTGTTAGACATTATAAAAGTTAAC ACTAATAATGTTTTCAGTTAGAGTCAGAATTTAGAATACCTAAGATTTAATCTTCATTTACTATGGATAATAGCACTAAGAACAGGAGTTCCCGTTGTGGCGCAGCAGAAACGAATCCGACTAGG AACCTTGAGGTTTTGGGTTCAATCCCTGGCCTCACTCAGTGGGTTAAGGATCCGGCATTGCCGTGAGCTGTGGTGTAGGTCACAGACACAGCTCAGATCTGGCATTGCTGTGGCTGTGGCTGTGG.

[0078] SNP3 (13_143013672): The base sequence (5'-3') of about 250 bp upstream and downstream (total about 500 bp) is shown in SEQ ID NO. 3. At position 250 of this sequence, the genotype of Leping Hua pig is TT, while the genotype of other pig breeds at this site is CT or CC.

[0079] ACCTCATTTTAAACCATAATCTGAGTAAACATATCCTTGAAATACTCTTTCAATTTTCTCTGTCTTCGTTAGGGTAATACTCCCTAAGACTATACATGCCATTATTAAAACAGTGCTATTATATATTGTGTTAAATCCCAAGTGAGCACAAATACATACATCCACATTAGTATATATAGTTGTGCTTTTTATCCCGATCAAGAGAGAAGCACTTTTTTTCCTTCCTGAGATTTTTAATTGCAAAAATCCCTTAATGGGCTTACATTGCACATCCAAGGTTCTGTAAACTCTTGTCTCCACTTTATATTCTACTGGCCTCTTTCTTGTGCATTTCAGAATCAGAACAAAAAGCCAGTCAAAGAAAGAAAATCCTTGCAAAGTGCTGTTCTAATACTGCTGCCTCCTACTCTTCAACTTAATGTTTATTAGCTGCTTGGGTTTGTAATGAATTGATAAGGAGTTTATAGAGATTAAAAATCCTCACAAGAGTCATCATCTAC.

[0080] SNP4 (14_135413298): the base sequence (5'-3') of about 250bp (about 500bp in total) on and downstream thereof is shown in SEQ ID NO. 4. At position 250 of the sequence, the Laiwu mini-pig genotype is AA, while the genotype of other pig species at the site is GA or GG.

[0081] AGTGGGCAGGCTGCCTACCGTCCAGTGAGCGAAGCAAGAGCATGGACGGGATGAGGGTGAGGGAGGGACGGGGGCCAGGGGCAGGGGCAGGAGGCTGACCCGTGGGTAGTTTAATTCTCCGAGAGCAGTGGGAAACCCTTGAGGGTGAGGTGCTTTACATATCACCCTGGGGAGTTCCCGTTATGGCTCAGTGGGTTAAGCACCCGACTAGGATCCATGAGGATGCAAGTTGGATCCCTGGCCGCGCTCAGTGGGTTACGGATCTGGCGTTGCCGTGAGCTTCGGTGTAGGTCACAGACAGGCTTGGATCCCACATTGCCGTGGCTGTAGCATAAGCCTGGGCTGCAGCTCTGATTCAGTCCCTTAGCCTGGGAACTTCCATATGCCACAGGTGTGGCCCTAAAAAGAAAAAAACAATCCCTCTGGCTGCTGGAGGAGAAGGGATTCTGGGAAGACAAGACTGGAGGGTGGGGGTGAGAGCTGGGACCGTGTGAGGCGGC.

[0082] SNP5 (14_27187729): the base sequence (5'-3') of about 250 bp (about 500 bp in total) on and downstream thereof is shown in SEQ ID NO. 5. At the 250th position of the sequence, the Laiwu mini-pig genotype is CC, while the genotype of other pig species at the site is AC or AA.

[0083] CTGTCCTTCACATGCCTCAGTTACGCATAACACAGTGAAATGTATGTTACTTAACTGGATTTGTTAGTGGTAATTGGACTCGTTAATTATCATAAAATTGTATTTGTAACCAACGGTGACTGAAATTGGATGTCAAGTTTGATTGTGGTTTAAAAGTGAAATGTCAGGTCCTGGAGGTACCATGTCCTGGAAGAGATGCCTGAATGTCAGCCTGCTCACCCAGGCTGAGTTTTTCTGCAAGTCTGGGCAAGCATGTTGTACAGTCGAGTTTATTGACCTACAGGCAATGGAAAACTGGACAGCTTCCCCAAAGATCTGACCTGGGCAGACCACTGCACTCACAGTTGGGGATCAAAGAAGTCATCTTCTGGCTGCCATGAAGAGAAAGCAGATCTGTGCTATCAGAGGATGGTGCTGGGGGGGAGAGAGGATGGAGGGTGGAGGCAGAGACAAAAACTCCTGGGTTTCCAGAGAGCTCTTCAATTCCTTGCTTAAGGGAC.

[0084] SNP6 (16_45287494): the base sequence (5'-3') of about 250 bp (about 500 bp in total) on and downstream thereof is shown in SEQ ID NO. 6. At position 250 of the sequence, the Laiwu mini-pig genotype is GG, while the genotype of other pig species at the site is AG or AA.

[0085] AAGATATTTGAATATTGGAGCTAAACCCTAAAACTGCCTCTGATTAAAAATAATAGTGATACTGTCTAACAGATGAACACGGGTTCTACCCATGTTTACTTGGTTAGGGGGAAAAGGGCATTTCTTTGGTAGCCAATGGTGAAATAATATATTGTGATTATTATTGAGTGATATACTTGGAAAAATGTAATTATGTTTTAAAAATGAGATTCTTAGTGCTTTCAGTGGTATTATAATTCAAACAAATGGATTGGTGTGGTAATTTTTGCGTGTCTATAAATATTAAAGATGGTAATTTTAAAAAAAGAAACTAATTTAAATTATTCACATCAAGACCAAAGAGTTCACTTTGAGCCTTCTTTATGAACTTATCTTTATTAAGTCTACACCAAATATAATTTTCCTGACCTGTTCAAAATAAGGTAATAGTTACCTCTTGGCTTCCACCCAGTGTTTATATGAAACAAGCTAATAGGCACCCCACATACCCCAATTTTGTC.

[0086] A primer combination for identifying Laiwu flower pig, comprising primer pairs capable of amplifying any 1-6 SNP sites of the following:

[0087] SNP1: located at 207,753,485 of pig chromosome 1 (CHR1), polymorphism is C / T;

[0088] SNP2: located at 77,167,117 of pig chromosome 7 (CHR7), polymorphism is T / C;

[0089] SNP3: located at 143,013,672 of pig chromosome 13 (CHR13), polymorphism is T / C;

[0090] SNP4: located at 35,413,298 of pig chromosome 14 (CHR14), polymorphism is A / G;

[0091] SNP5: located at 27,187,729 of pig chromosome 14 (CHR14), polymorphism is C / A;

[0092] SNP6: located at 45,287,494 of pig chromosome 16 (CHR16), polymorphism is G / A.

[0093] The primer pair amplifies any 4-6 of the SNP1-SNP6 sites;

[0094] The primer pair amplifies any 5-6 of the SNP1-SNP6 sites;

[0095] The primer pair amplifies all 6 of the SNP1-SNP6 sites;

[0096] The primer pair comprises at least one of the following pairs:

[0097] SNP1 site primers: forward SEQ ID NO. 1, reverse SEQ ID NO. 2;

[0098] SNP2 site primers: forward SEQ ID NO. 3, reverse SEQ ID NO. 4;

[0099] SNP3 site primers: forward SEQ ID NO. 5, reverse SEQ ID NO. 6;

[0100] SNP4 site primers: forward SEQ ID NO. 7, reverse SEQ ID NO. 8;

[0101] SNP5 site primers: forward SEQ ID NO. 9, reverse SEQ ID NO. 10;

[0102] SNP6 site primers: forward SEQ ID NO. 11, reverse SEQ ID NO. 12.

[0103] A method for identifying Leping flower pigs, comprising the following steps:

[0104] Step S1: extracting genomic DNA of the pig to be tested; the genomic DNA of the pig to be tested in step S1 is obtained from the ear tissue of the pig to be tested;

[0105] Step S2: using the primer set of claims 1-5 to perform PCR amplification on the SNP1-SNP6 sites;

[0106] Step S3: sequencing the amplification product to obtain the genotype of each SNP site;

[0107] Step S4: if the genotypes of the SNP1-SNP6 sites are CC, TT, TT, AA, CC, and GG in sequence, it is determined to be a purebred Leping flower pig, and step S4 further comprises:

[0108] If the genotype of any SNP site does not meet the standard of a purebred Leping flower pig, it is directly excluded as a Leping flower pig;

[0109] If all sites meet the standard, the breed probability is calculated by the Bayes formula;

[0110] The calculation formula of the Bayes theorem is as follows:

[0111]

[0112] Wherein, Pi represents the frequency of the genotype of other varieties corresponding to the i th SNP site in the SNP site combination, i is an integer from 1 to 6;

[0113] The genotype frequency of the SNP site satisfies:

[0114] In the Leping pig, the target genotype frequency of each SNP site is 1;

[0115] In other pig breeds, the target genotype frequency is ≤0.006.

[0116] Finally: the above only for the preferred embodiments of the present application, and not for limiting the present application, any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application, should be included in the protection scope of the present application.

Claims

1. A primer combination for identifying Leping spotted pigs, characterized in that: Contains primer pairs that can amplify any 1-6 of the following SNP sites: SNP1: located at position 207,753,485 of porcine chromosome 1 (CHR1), with a C / T polymorphism; SNP2: located at positions 77, 167, and 117 of porcine chromosome 7 (CHR7), with a T / C polymorphism; SNP3: located at position 143,013,672 of porcine chromosome 13 (CHR13), with a T / C polymorphism; SNP4: located at position 35,413,298 of porcine chromosome 14 (CHR14), with the polymorphism of A / G; SNP5: located at position 27,187,729 of porcine chromosome 14 (CHR14), with a polymorphism of C / A; SNP6: Located at position 45,287,494 of porcine chromosome 16 (CHR16), the polymorphism is G / A.

2. The primer combination for identifying Leping spotted pig according to claim 1, characterized in that: The primer pair amplifies any 4-6 of the SNP1-SNP6 sites.

3. The primer combination for identifying Leping spotted pig according to claim 1, characterized in that: The primer pair amplifies any 5-6 of the SNP1-SNP6 sites.

4. The primer combination for identifying Leping spotted pig according to claim 1, characterized in that: The primer pair amplifies all six sites SNP1-SNP6.

5. The primer combination for identifying Leping spotted pig according to claim 3, characterized in that: Contains at least one of the following primers: SNP1 site primer: forward SEQ ID NO.1, reverse SEQ ID NO.2; SNP2 site primers: forward SEQ ID NO.3, reverse SEQ ID NO.4; SNP3 locus Primers: forward SEQ ID NO.5, reverse SEQ ID NO.6; SNP4 locus Primers: forward SEQ ID NO.7, reverse SEQ ID NO.8; SNP5 site primer: forward SEQ ID NO.9, reverse SEQ ID NO.10; SNP6 site primer: forward SEQ ID NO.11, reverse SEQ ID NO.

12.

6. The method for identifying Leping spotted pigs according to any one of claims 1 to 5, characterized in that: The following steps are involved: Step S1: extracting genomic DNA from the pigs to be tested; Step S2: performing PCR amplification on the SNP1-SNP6 sites using the primer set described in claims 1-5; Step S3: Sequencing the amplified product to obtain the genotype of each SNP site; Step S4: If the genotypes of the SNP1-SNP6 sites are CC, TT, TT, AA, CC, and GG, respectively, the pig is determined to be a purebred Leping spotted pig individual.

7. The method for identifying Leping spotted pigs according to claim 6, characterized in that: In step S1, the genomic DNA of the individual to be tested is obtained from the ear tissue of the individual to be tested.

8. The method for identifying Leping spotted pigs according to claim 6, characterized in that: Step S4 further comprises: If the genotype of any SNP site does not meet the purebred standard of Leping Hua pig, it will be directly excluded as Leping Hua pig; If all sites meet the criteria, the variety probability is calculated using the Bayesian formula; The calculation formula of Bayes' theorem is as follows: Where Pi represents the frequency of the corresponding genotypes of other varieties in the i-th SNP site in the SNP site combination, and i is an integer from 1 to 6.

9. The method for identifying Leping spotted pigs according to claim 6, characterized in that: The genotype frequency of the SNP site satisfies: In Leping spotted pigs, the target genotype frequency of each SNP site is 1; In other pig breeds, the target genotype frequency was ≤0.006.

Images