A molecular marker for sex identification of hippolyte japonica and application thereof
By using a DNA fragment with the nucleotide sequence SEQ ID No. 1 as a molecular marker in Hawaiian snapping shrimp, combined with PCR amplification and gel electrophoresis, the problem of early sex identification in Hawaiian snapping shrimp has been solved, and high-accuracy male-female differentiation has been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF ZOOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2024-10-10
- Publication Date
- 2026-05-01
AI Technical Summary
Existing technologies cannot effectively identify the sex of Hawaiian mantis shrimp at an early stage, especially in the incomplete larval stage. Morphological identification is difficult and relies on experience, which is inaccurate.
The DNA fragment with SEQ ID No. 1 was used as a molecular marker. The sex of Hawaiian hook shrimp was identified by PCR amplification and gel electrophoresis. A 292 bp DNA fragment was amplified using specific PCR primers to distinguish between males and females.
It has achieved accurate sex identification of adult and juvenile Hawaiian mantis shrimp with an accuracy rate of 100%, simplified the identification process, avoided dependence on morphological characteristics, and provided stable and reliable results.
Smart Images
Figure CN119177278B_ABST
Abstract
Description
A molecular marker for sex identification of Hawaiian snapping shrimp and its application Technical Field
[0001] This invention belongs to the field of Hawaiian mantis shrimp technology, specifically relating to a molecular marker for sex identification of Hawaiian mantis shrimp and its application. Background Technology
[0002] Hawaiian mantis shrimp (Parhyale hawaiensis) is an important model organism for crustaceans, playing a crucial role in scientific research, particularly in exploring embryonic development, appendage regeneration, tidal rhythms, and environmental pollution. It also serves as high-quality feed for economically important animals such as shrimp and fish, resulting in high yields and economic value. Currently, many aquaculture crustaceans can achieve asexual reproduction through sex control techniques, thereby increasing yields and improving quality. Hawaiian mantis shrimp are dioecious, with males being larger and growing faster than females; however, early sex identification and control are still not possible. With the increasing demand for early sex identification in scientific research and sex-controlled breeding, developing convenient sex identification methods is of great significance.
[0003] Currently, sex determination of Hawaiian mantis shrimp primarily relies on external morphological characteristics. Males exhibit strong, enlarged second branchial appendages, numerous olfactory hairs on the first antennae, a longer flagellum on the second antennae, typically possess shoe-shaped receptors, and larger compound eyes. Female Hawaiian mantis shrimp are characterized by four pairs of spawning valves on their thorax, located on the inner side of the coxae of the thoracic appendages. Furthermore, the male's genital pore is located on the ventral surface of the eighth thoracic segment, while the female's is located on the ventral surface of the sixth thoracic segment.
[0004] However, for juvenile Hawaiian snapping shrimp, many sex-related characteristics are not fully developed due to the developmental stage, making it difficult to identify the sex of juvenile Hawaiian snapping shrimp through morphological characteristics. Furthermore, the subtle morphological differences in Hawaiian snapping shrimp are difficult to discern for those lacking a morphological background. Therefore, developing a simple and easy-to-implement method for sex determination is both practically and scientifically necessary. Summary of the Invention
[0005] The technical problem to be solved by this invention is to provide a molecular marker for sex identification of Hawaiian amphioxus. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.
[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:
[0007] This invention provides a molecular marker for sex identification of Hawaiian snapping shrimp, or the application of a substance for detecting the molecular marker for sex identification of Hawaiian snapping shrimp in the identification or auxiliary identification of the sex of Hawaiian snapping shrimp. The molecular marker for sex identification of Hawaiian snapping shrimp is a DNA fragment with nucleotide sequence SEQ ID No. 1, positions 27-318.
[0008] The present invention also provides the application of a substance for detecting whether the genome of Hawaiian snap shrimp contains a DNA fragment with nucleotides at positions 27-318 of SEQ ID No. 1 in the identification or auxiliary identification of the sex of Hawaiian snap shrimp.
[0009] In the above applications, the substance contains PCR primers for amplifying genomic DNA fragments of Hawaiian snapping shrimp, including the Hawaiian snapping shrimp sex identification molecular marker.
[0010] In the above applications, the PCR primers are primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA with the nucleotide sequence SEQ ID No. 2, and the reverse primer is a single-stranded DNA with the nucleotide sequence SEQ ID No. 3.
[0011] This invention also provides a method for identifying or assisting in the identification of the sex of Hawaiian mantis shrimp, the method comprising the following steps:
[0012] (1) Using the genomic DNA of the Hawaiian snapping shrimp to be identified as a template, PCR amplification was performed using any of the aforementioned PCR primers to obtain the PCR product;
[0013] (2) The sex of Hawaiian shrimp can be determined based on whether the PCR product contains the aforementioned molecular markers for sex identification of Hawaiian shrimp.
[0014] This invention also provides a method for identifying or assisting in the identification of the sex of Hawaiian mantis shrimp, the method comprising the following steps:
[0015] (1) Using the genomic DNA of the Hawaiian snapping shrimp to be identified as a template, PCR amplification was performed using any of the PCR primers described above to obtain the PCR product;
[0016] (2) The sex of Hawaiian hook shrimp is determined based on whether the PCR product contains a specific DNA fragment, the size of which is 292 bp.
[0017] Specifically, the aforementioned PCR procedure is as follows: The PCR amplification system is 25 μL, including 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCR mix, and 8 μL of dd H2O. The PCR reaction program is: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 55℃ annealing for 25 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ extension for 10 min.
[0018] The sequence of the upstream primer is SEQ ID No. 2, and the sequence of the downstream primer is SEQ ID No. 3.
[0019] In the above method, if the PCR product contains the sex identification molecular marker of the Hawaiian snapping shrimp or contains a DNA fragment of 292 bp, the Hawaiian snapping shrimp to be identified is or is a candidate for male Hawaiian snapping shrimp; if the PCR product does not contain the sex identification molecular marker of the Hawaiian snapping shrimp or does not contain a DNA fragment of 292 bp, the Hawaiian snapping shrimp to be identified is or is a candidate for female Hawaiian snapping shrimp.
[0020] The aforementioned DNA molecules also fall within the scope of protection of this invention.
[0021] The aforementioned DNA with SEQ ID No. 1 is used in the analysis of Hawaiian snap shrimp germplasm resources or in molecular marker-assisted breeding.
[0022] The aforementioned PCR primers were used in the analysis of Hawaiian snap shrimp germplasm resources or in molecular marker-assisted breeding.
[0023] The advantages of this invention are that currently, there is a lack of effective genetic molecular markers for sexing the Hawaiian amphipod (Parhyale hawaiensis). Sexing of Hawaiian amphipods is mainly based on morphological classification, but this method cannot effectively distinguish immature larvae. Furthermore, developmental defects can lead to similarities between males and females. For example, features such as the second gill foot are not fully developed in males during the larval stage, resulting in less significant differences between males and females. Therefore, morphological identification cannot completely and accurately differentiate Hawaiian amphipods in their larval stage or in individuals with developmental defects. As an important model species in the amphipod order, the Hawaiian amphipod (Parhyale hawaiensis) provides molecular markers that can effectively identify the sex of both adults and larvae. Sexing can be achieved simply and quickly using methods such as polymerase chain reaction (PCR) and gel electrophoresis, improving the scope and accuracy of sex identification. The results are stable, reliable, reproducible, and simple, thus eliminating reliance on experience and established criteria for identifying external morphology.
[0024] In this invention, molecular genetic markers and morphological identification were performed on 15 adult males and females and 4 juveniles, confirming that the accuracy of the molecular markers reached 100%. Moreover, the method is reproducible, does not require reliance on experience to judge morphological characteristics, and only needs to determine sex based on the number of bands in the experimental results. Attached Figure Description
[0025] Figure 1 shows the gel electrophoresis results of 10 adult male Hawaiian snap shrimp. The markers are 2500bp DNA markers, and from top to bottom, they are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.
[0026] Figure 2 shows the gel electrophoresis results of five adult female Hawaiian snapping shrimp. The markers are 2500bp DNA markers, and from top to bottom, they are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.
[0027] Figure 3 shows the gel electrophoresis results of four juvenile amphipods. Lanes 1 and 6 contain 2500bp DNA markers, with the markers from top to bottom being 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 2-5 contain amphipods 1, 2, 3, and 4, respectively. Detailed Implementation
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0030] Example 1: Development of DNA Molecular Markers
[0031] Sexually mature Hawaiian mantis shrimp cultured in Example 5 were selected, and their sex was determined by the following morphological criteria.
[0032] Morphological characteristics: Males are characterized by a strong, enlarged second branchial foot, numerous olfactory hairs on the first antennae, a longer flagellum on the second antennae, typically possessing shoe-shaped receptors, and larger compound eyes. Female Hawaiian mantis shrimp are characterized primarily by four pairs of spawning valves on the thorax, located on the inner side of the coxae of the thoracic legs. Furthermore, the male's genital opening is located on the ventral surface of the eighth thoracic segment, while the female's is located on the ventral surface of the sixth thoracic segment.
[0033] Genomic DNA was extracted from the aforementioned morphologically identified female and male Hawaiian amphioxus shrimp and sequenced using the Illumina NovaSeq 6000 high-throughput sequencing platform, with 100 Gb of sequencing data from each sex. By comparing the sequencing depth of the resequencing data from males and females and the differences in their genomes, genomic regions with sex-specific genome sequences were identified. Comparison revealed a sequence of approximately 300 base pairs in the male genome that was absent in the female genome. Furthermore, no similar homologous sequences were found in the entire genome of the male Hawaiian amphioxus shrimp, indicating that this sequence is specific. Therefore, this fragment can be designated as a potential sex-specific molecular marker (SEQ ID No. 1).
[0034] SEQ ID No.1
[0035] 5'-CGTATTTCTGACAGAGACGACTATTTGATCAACCCGTTCCATCAAATGGATAACACGAAGAACTTTGATGTTCCTTTTGACTACATGTCGGCCATGATGTACCATGTGAGTATTTGTAACGTTAAGCAGCATACCATTCGTAATTTGCTACGTCTGCACGGATCTCAGGCAGTCGAATTTTGCATTGATGGGTCT CATGCAAAAACAATTTTTCACCTTTAACAACTTCAAATAATTCTAGTAGCTATGTTGAACGCAGTATATGTAGCTACTAACTATCCTGAAATTTATTGCAAAGTGCCGCGTATAAGACAGCTGATACGATTAATGTTGCCAATTTTAGCGCTCAACTGATTTATTAAAATGAATTTCTGCACTGCTGATACTG-3'.
[0036] Based on SEQ ID No. 1, amplification primer pairs were designed in the conserved regions on both sides of it. The amplification primer pairs consist of upstream primer F and downstream primer R, and their specific nucleotide sequences are as follows:
[0037] F (SEQ ID No. 2): 5'-GATCAACCCGTTCCATC-3';
[0038] R (SEQ ID No. 3): 5'-CAGCTGTCTTATACGCGGCAC-3'.
[0039] Primer pair F / R can amplify a DNA fragment with nucleotide sequence 27-318 of SEQ ID No. 1 in the genome of male Hawaiian snapping shrimp, but cannot amplify a DNA fragment with nucleotide sequence 27-318 of SEQ ID No. 1 in the genome of female Hawaiian snapping shrimp.
[0040] Example 2: Identifying the sex of sexually mature Hawaiian snapping shrimp using male-specific molecular markers
[0041] Ten sexually mature male Hawaiian shrimp (numbered M1-10) and five female Hawaiian shrimp (numbered F1-F5) bred in Example 5 were selected. The specific identification steps are as follows:
[0042] 1. Take one leg of the aforementioned Hawaiian amphioxus and extract genomic DNA using the Tiangen DP316 micro-sample genomic DNA extraction kit. Using the genomic DNA as a template, perform PCR amplification using the aforementioned primers F and R. The PCR amplification system is 25 μL, including 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCR mix, and 8 μL of dd H2O. PCR reaction program: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 55℃ annealing for 25 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ extension for 10 min.
[0043] 2. Perform agarose gel electrophoresis on the amplified PCR products. The procedure for detecting PCR products by agarose gel electrophoresis is as follows: First, weigh 0.25g of agarose, measure 25ml of 1×TAE buffer to prepare a 1% gel solution, then heat the solution to boiling to completely dissolve the agarose. Add 2μl of GelStain nucleic acid dye (TransGold GS101-02), pour into the electrophoresis tank, and allow it to solidify. After solidification, aspirate 3μl of the PCR product into the well, and add a 1000bp DNA marker to an empty well. Run the gel at 220V for 15 minutes.
[0044] The results (Figures 1 and 2, and Table 1) showed that the PCR products of male Hawaiian amphioxus (M1-M10) identified by morphological characteristics all contained a target band in the 250-500 bp range, while the PCR products of female Hawaiian amphioxus identified by morphological characteristics did not contain this target band. The target bands from the aforementioned male Hawaiian amphioxus (M1-M10) were recovered and sequenced. Sequencing results showed that the nucleotide sequence of the target band in the male Hawaiian amphioxus was identical to nucleotides 27-318 of SEQ ID No. 1. Therefore, the aforementioned molecular marker can effectively distinguish between males and females with an accuracy rate of 100%.
[0045] Table 1
[0046]
[0047] Example 3: Sex determination of juvenile Hawaiian snapping shrimp using male-specific molecular markers
[0048] Juvenile amphipods bred in Example 5 were selected. The specific identification steps are as follows:
[0049] 1. Take one leg from the aforementioned Hawaiian snapping shrimp larvae and extract genomic DNA using the Tiangen DP316 micro-sample genomic DNA extraction kit. Using the genomic DNA as a template, perform PCR amplification using the aforementioned primers F and R. The PCR amplification system is 25 μL, including 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFiPCR mix, and 8 μL of dd H2O. The PCR reaction program is: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 55℃ annealing for 25 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ extension for 10 min.
[0050] 2. Perform agarose gel electrophoresis on the amplified PCR products. The procedure for detecting PCR products by agarose gel electrophoresis is as follows: First, weigh 0.25g of agarose, measure 25ml of 1×TAE buffer to prepare a 1% gel solution, then heat the solution to boiling to completely dissolve the agarose. Add 2μl of GelStain nucleic acid dye (TransGold GS101-02), pour into the electrophoresis tank, and allow it to solidify. After solidification, aspirate 3μl of the PCR product into the well, and add a 1000bp DNA marker to an empty well. Run the gel at 220V for 15 minutes.
[0051] The results (Figure 3) showed that the PCR products of lane 1 (labeled as Hawaiian snapping shrimp 1) and lane 2 (labeled as Hawaiian snapping shrimp 2) both contained a target band in the 250-500 bp range, indicating that Hawaiian snapping shrimp 1 and Hawaiian snapping shrimp 2 were male. The PCR products of lane 3 (labeled as Hawaiian snapping shrimp 3) and lane 4 (labeled as Hawaiian snapping shrimp 4) did not contain a target band in the 250-500 bp range. The target bands from the aforementioned male Hawaiian snapping shrimp 1 and Hawaiian snapping shrimp 2 were recovered and sequenced. The sequencing results showed that the nucleotide sequence of the target band in Hawaiian snapping shrimp 1 and Hawaiian snapping shrimp 2 was the nucleotides 27-318 of SEQ ID No. 1.
[0052] Example 4: Collection and Identification of Hawaiian Shrimp
[0053] Origin of Hawaiian Shrimp: The first generation of Hawaiian Shrimp was collected from the wild in Haikou City, Hainan Province. Subsequent Hawaiian Shrimp were entirely produced through natural reproduction. The collected Hawaiian Shrimp exhibit the following morphological characteristics: The body is slightly laterally compressed, with prominent lateral lobes on the head. Eyes are large, oval, and dark brown. Thoracic segments are smooth, with blunt tips on the lower posterior angles of abdominal segments 1-3. The telson has two triangular lobes, each ending in a bristle. The first antenna is slightly shorter, with the three segments of the peduncle being almost equal in length and bearing long bristles on the lower margin. The flagellum is slightly longer than the peduncle, with 12 segments. The second antenna is longer than the first, with a longer terminal segment of the peduncle and long bristles; the flagellum is also relatively long, with 20 segments. Female antennae are thinner and weaker. The anterior margin of the labrum is slightly arched and covered with fine hairs. The mandibular incisors and molars are well-developed, but there are no palps. The labrum lacks an inner lobe, while the lateral lobes are more prominent. The maxillae have a narrow inner plate with a bristle at the end, and a toothed spine at the apex of the outer plate; the palps are single-segmented with a bristle at the end. The anterior margin of the inner plate of the second maxilla has a long, strong bristle. The inner and outer plates of the maxillae are relatively small, with well-developed, four-segmented palps. The basal plates of segments 1-4 are broad, while the 5th and 6th basal plates have anteroposterior lobes. The parotid legs are subchelate. In males, the first parotid leg is smaller, the posterior inferior angle of the long segment is pointed, the carpus is triangular, the propodus is oval, the palmar margin is obliquely truncate and has small spines, the palmar corner has two spines, the ventral margin has a projection with bristles, and the dactyls are claw-like. The second parotid leg in males is strong, the long segment has an anterior distal projection, the posterior distal angle is pointed, the carpus is short, located between the long and propodus, without a projection, the propodus is oval and large, the dorsal margin is smooth, the palmar margin is oblique and long, with one small spine, the palmar corner is divided by two small spines, the ventral margin is shorter, and the dactyls are claw-like. The first parotid leg in females is similar to that in males, and the second parotid leg in females is similar to the first parotid leg but larger, the posterior lobe of the carpus is more prominent, and the palmar margin of the propodus is more obliquely arched. The third and fourth peregrine legs are simple, while the fifth through seventh peregrine legs are more robust. The coxae are oval, and the long, carpal, and propodus segments have small spines on their lateral margins. The dactyls are claw-like and have one ventral spine. The first and second caudate limbs have stalked and marginal spines. The third caudate limb is short, with long, spine-bearing exolimbs and very small endolimbs ending in a bristle. These characteristics are consistent with the description in "Ren Xianqiu. Fauna Sinica: Invertebrates, Volume 41, Subphylum Crustacea, Order Amphipoda, Suborder Acanthocephala (I). Beijing: Science Press, 2006, 395-396".
[0054] The sequencing identification method is as follows: Genomic DNA of Hawaiian snapping shrimp was extracted using an animal tissue genomic DNA extraction kit (Tiangen Biotech, Beijing, China). The COI gene was selected for amplification and sequencing. The upstream primer sequence (5'-3') of the COI gene is: GGTCAACAAATCATAAAGATATTGG, and the downstream primer sequence (5'-3') is: TAAACTTCAGGGTGACCAAAAAATCA. The PCR amplification system was 25 μL, including 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, 10 μL of 2× M5 HiPer plus Taq HiFi PCR mix, and 8 μL of dd H2O. The PCR reaction program was: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 55℃ annealing for 25 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ extension for 10 min. The obtained PCR products were sequenced by Sangon Biotech Co., Ltd. The sequencing identification results showed that the COI gene sequence of Hawaiian snapping shrimp is as shown below.
[0055] Based on the COI gene sequence of the Hawaiian mantis shrimp, a BLAST comparison of the COI gene was performed on the NCBI website. The results showed that the COI sequence of the Hawaiian mantis shrimp was 100% similar to the COI sequence of the Hawaiian mantis shrimp (Parhyale hawaiensis). Combining morphological and molecular identification results, the Hawaiian mantis shrimp was identified as Hawaiian mantis shrimp (Parhyale hawaiensis).
[0056] COI gene sequence of Hawaiian snap shrimp:
[0057] 5'--3'.
[0058] Example 5: Method for artificially raising and breeding Hawaiian snap shrimp
[0059] Artificial seawater with a salinity of 30%: Add 30 g of sea salt to 1 L of deionized water, and use a handheld refractometer to measure the salinity of the artificial seawater. The result is artificial seawater with a salinity of 30%.
[0060] Hawaiian mantis shrimp reproduce by carrying eggs. The steps for raising and breeding Hawaiian mantis shrimp are as follows:
[0061] 1. Mating
[0062] Sexually mature Hawaiian shrimp were selected, and male and female individuals were identified. 500-600 male Hawaiian shrimp and 500-600 female Hawaiian shrimp (male-to-female ratio of 1:1) were placed in the same rearing box (the rearing box was pre-filled with artificial seawater with a salinity of 30% and a height of 10cm). The rearing box was then placed in a small Hawaiian shrimp breeding room with an indoor temperature of 26-28℃ and an indoor humidity of 40-60%.
[0063] Feed the cichlids once a week with either artificial or natural food. The artificial food consists of cichlid pellets (small granules) purchased from Dolphin Aquarium Co., Ltd., Pengjiang District, Jiangmen City, Guangdong Province, and spirulina tablets (sinking type, thin type) purchased from Marine Nutrition Products, Inc., USA. The natural food includes carrots, kelp, withered leaves, snapdragons, cucumbers, apples, potatoes, bananas, cantaloupe, watermelon, pears, or peaches. Change the water in the adult Hawaiian snapping shrimp enclosure weekly with artificial seawater at a salinity of 30%. Place a substrate, such as coral stone or fine sand, at the bottom of the enclosure.
[0064] Before and after mating, the oxygen flow rate is adjusted to 1.5-4.5 liters / min (2 L / min is optimal) using an oxygen generator. The water flow brought about by oxygenation promotes swimming and chasing among adult Hawaiian snapping shrimp, thus facilitating successful reproduction. Simultaneously, the water temperature is controlled at 26-28℃ using a heating device.
[0065] 2. Embryo culture
[0066] Female Hawaiian snapping shrimp carrying eggs were anesthetized with carbon dioxide for 10-15 seconds. Fertilized eggs were removed from the abdomen of the female and placed in 6cm culture dishes (pre-filled with culture medium to 1 / 3-2 / 3 of the dish volume), with no more than 25 fertilized eggs per dish. The dishes were placed on moistened absorbent sponges (to reduce seawater evaporation), and then the dishes and sponges were placed in a rectangular tray and cultured in an artificial climate chamber (26°C, 80% relative humidity, 8h light / 16h dark) for 10-12 days. The Hawaiian snapping shrimp embryos hatched, yielding juvenile Hawaiian snapping shrimp. The culture medium for the in vitro cultured Hawaiian snapping shrimp embryos was changed daily, and any dead embryos were removed during each change.
[0067] The above-mentioned absorbent sponge should be soaked in distilled water every three days.
[0068] The antibiotics mentioned above may be penicillin, streptomycin, amphotericin B, and griseofulvin.
[0069] The reserved volume in the petri dish allows for the dissolution of oxygen from the air by the culture medium, providing sufficient oxygen for embryo hatching. The culture medium is filtered artificial seawater containing antibiotics. The specific preparation method is as follows: the artificial seawater is filtered through a diaphragm vacuum pump, where the filter membrane has a pore size of 0.02 micrometers, and the antibiotics contain 0.0015% by volume. Before use, the culture medium in the glass bottle is gently shaken to dissolve oxygen from the air, achieving pre-oxygenation.
[0070] 3. Larval stage
[0071] Transfer the Hawaiian hook shrimp larvae obtained in step 2 to a beaker through a filter. Then transfer the Hawaiian hook shrimp larvae in the beaker to a new rearing box. The rearing method is the same as in step 1, mating. After 7-8 weeks of rearing until they reach sexual maturity, they can be reared and bred according to steps 1 and 2.
[0072] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The application of a molecular marker for sex identification of Hawaiian snapping shrimp or a substance that detects the molecular marker for sex identification of Hawaiian snapping shrimp in the identification or auxiliary identification of the sex of Hawaiian snapping shrimp, wherein the molecular marker for sex identification of Hawaiian snapping shrimp is a DNA fragment with the nucleotide sequence of positions 27-318 of SEQ ID No. 1; Hawaiian snapping shrimp containing the molecular marker for sex identification of Hawaiian snapping shrimp are or are candidates for male Hawaiian snapping shrimp, and Hawaiian snapping shrimp not containing the molecular marker for sex identification of Hawaiian snapping shrimp are or are candidates for female Hawaiian snapping shrimp.
2. The application according to claim 1, characterized in that, The substance contains PCR primers for amplifying genomic DNA fragments of Hawaiian snapper, including the aforementioned Hawaiian snapper sex identification molecular marker.
3. The application according to claim 2, characterized in that, The PCR primers are primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA with the nucleotide sequence SEQ ID No. 2, and the reverse primer is a single-stranded DNA with the nucleotide sequence SEQ ID No.
3.
4. A method for identifying or assisting in the identification of the sex of Hawaiian mantis shrimp, characterized in that, The method includes the following steps: (1) using the genomic DNA of the Hawaiian snapping shrimp to be identified as a template, performing PCR amplification using the PCR primers described in claim 2 to obtain a PCR product; (2) identifying the sex of the Hawaiian snapping shrimp based on whether the PCR product contains the Hawaiian snapping shrimp sex identification molecular marker described in claim 1; the Hawaiian snapping shrimp to be identified whose PCR product contains the Hawaiian snapping shrimp sex identification molecular marker is or is a candidate male Hawaiian snapping shrimp, and the Hawaiian snapping shrimp to be identified whose PCR product does not contain the Hawaiian snapping shrimp sex identification molecular marker is or is a candidate female Hawaiian snapping shrimp.
5. A method for identifying or assisting in the identification of the sex of Hawaiian mantis shrimp, characterized in that, The method includes the following steps: (1) using the genomic DNA of the Hawaiian snapping shrimp to be identified as a template, performing PCR amplification using the PCR primers described in claim 3 to obtain a PCR product; (2) identifying the sex of the Hawaiian snapping shrimp based on whether the PCR product contains a specific DNA fragment, wherein the size of the specific DNA fragment is 292 bp; the Hawaiian snapping shrimp to be identified whose PCR product contains the DNA fragment of 292 bp is male or a candidate for male Hawaiian snapping shrimp, and the Hawaiian snapping shrimp to be identified whose PCR product does not contain the DNA fragment of 292 bp is female or a candidate for female Hawaiian snapping shrimp.
6. The application of DNA with nucleotide sequence SEQ ID No. 1 from position 27 to 318 in the analysis of Hawaiian snap shrimp germplasm resources or molecular marker-assisted breeding; the method of analysis of Hawaiian snap shrimp germplasm resources or molecular marker-assisted breeding is to identify or assist in the identification of Hawaiian snap shrimp sex.
7. The application of the PCR primers described in claim 2 or 3 in the analysis of Hawaiian snap shrimp germplasm resources or in molecular marker-assisted breeding; wherein the method of analyzing Hawaiian snap shrimp germplasm resources or in molecular marker-assisted breeding is to identify or assist in the identification of Hawaiian snap shrimp sex.