A molecular marker primer for CDC34 gene related to egg weight trait and its application

Abstract

The invention relates to a CDC34 gene molecular marker primer related to egg weight trait and an application thereof, and belongs to the field of biotechnology. The molecular marker of the invention is located at the 3100727th base of chromosome 28 of the chicken reference genome GRCg7b version, the base mutation is A and G, and the genotype is A / A, A / G and G / G. The egg weight of A / A genotype chickens at 31 weeks of age is higher than that of A / G and G / G genotype individuals, and the egg weight of A / G genotype chickens at 31 weeks of age is significantly higher than that of G / G genotype individuals. The invention utilizes forward and reverse primer pairs to amplify a fragment containing the above-mentioned molecular marker site, and performs Sanger sequencing on the amplified product, so as to quickly and accurately identify the genotype of the individual. It can be used as a genetic marker for chicken breeding, and chickens with appropriate egg weight at 31 weeks of age can be selected; the egg weight trait of chickens at 31 weeks of age can be efficiently and accurately detected, and the uniformity of egg weight of chicken flocks can be improved, which has important value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a CDC34 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight has a strong correlation with egg production, chick birth weight, hatchability of breeding eggs, and eggshell quality. Studies have shown that egg weight is negatively correlated with egg production, and too high egg weight will affect the egg production of breeding hens. Egg weight will also affect the birth weight of chicks, and the egg weight of breeding eggs is strongly positively correlated with the birth weight of chicks. Too high or too low egg weight will significantly affect the fertilization rate and hatchability of breeding eggs. Egg weight will also affect the quality of eggshells, and it has a certain negative correlation with eggshell thickness. Breeding the number of eggs and the uniformity of egg weight is conducive to improving the fertilization rate and hatchability of breeding eggs, improving the number and quality of eggs laid during the egg-laying cycle, and is conducive to the hatching and sale of chicks. However, egg weight will increase with the increase of egg-laying age. Breeding after the egg weight of breeding eggs is stable will not only take a long time, but also cause huge waste of feeding costs. Therefore, using molecular markers to accurately identify genotypes associated with egg weight traits after 31 weeks of age and applying them to early breeding selection can speed up the breeding cycle, reduce time and feeding costs, and improve resource utilization.

[0003] The CDC34 gene is related to neuronal development and bone development. Studies have shown that CDC34 plays an important regulatory role in limb regeneration and embryonic bone development, is related to chicken growth and development, and may also be involved in calcium deposition and mineralization during eggshell formation, indicating that the CDC34 gene may be closely related to egg weight, which needs further study. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art and to propose a CDC34 gene molecular marker primer related to the egg weight trait and its application to quickly detect and screen the egg weight of chickens at 31 weeks of age.

[0005] The present invention measured the egg weight of hens, performed SNP genotyping using whole genome resequencing technology, and screened the CDC34 gene molecular marker significantly correlated with the egg weight trait of chickens at 31 weeks of age through whole genome association analysis, providing new gene and molecular marker resources for the breeding of chickens with the egg weight trait at 31 weeks of age.

[0006] The present invention solves the technical problem through the following technical solutions: firstly, a CDC34 gene molecular marker primer related to egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 3100727th base on chromosome 28 of the chicken reference genome GRCg7b version, and the base is mutated to A or G. The sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 at the 186th base.

[0007] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to egg weight traits in chickens at 31 weeks of age. The detection method comprises the following steps:

[0008] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 356 bp in length and contains the 3100727th base of chicken chromosome 28;

[0009] Step 2: Sanger sequencing of the PCR product;

[0010] The third step is to determine the genotype of the SNP molecular marker at base 3100727 of chicken chromosome 28 based on the sequencing results of the second step.

[0011] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0012] Upstream primer: 5'-AATGCTCGGTGTGTGGGTTT-3' (SEQ ID NO: 1)

[0013] Downstream primer: 5'-GAGAATCCTCGTGCAATTTGGC-3' (SEQ ID NO: 2)

[0014] The final concentration of the reaction system is 25 μl.

[0015] Chicken DNA to be tested 50 ng,

[0016] 2 x Accurate Taq Master Mix 12.5 μl,

[0017] Upstream primer 1 μl,

[0018] Downstream primer 1 μl,

[0019] Add sterile water to 25 μl.

[0020] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 356 bp in length, and contains the 3100727th base of chicken chromosome 28.

[0021] In the third step, the judgment standard is that the egg weight of chickens with A / A genotype at 31 weeks of age is higher than that of A / G and G / G genotypes, and the egg weight of A / G genotype chickens at 31 weeks of age is higher than that of G / G genotype individuals.

[0022] The present invention detects the genotype of the egg weight trait of chickens at 31 weeks of age by using the CDC34 gene molecular marker, and obtains that the egg weight of chickens with A / A genotype at 31 weeks of age is higher than that of individuals with A / G and G / G genotypes, and the egg weight of chickens with A / G genotype at 31 weeks of age is higher than that of individuals with G / G genotypes. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can realize the selection of the egg weight trait of chickens at different periods. In breeding, according to the breeding goal, individuals with A / G and G / G genotypes can be eliminated, and individuals with A / A genotype can be retained, and the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with larger and uniform egg weight at 31 weeks of age can be selected; the egg weight trait of chickens at 31 weeks of age can be efficiently and quickly identified, and the uniformity of the egg weight of the chicken flock can be improved, providing a scientific basis for the early breeding of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate and can be carried out in a laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Manhattan plot of genome-wide association analysis of egg weight at 31 weeks of age.

[0024] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0025] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0026] Example 1

[0027] In this example, the egg weight of recessive White Rock hens at 31 weeks of age was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The CDC34 gene molecular marker significantly associated with egg weight at 31 weeks of age was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0028] In this example, the following experiment was conducted to identify and apply the CDC34 gene molecular marker related to the egg weight trait of chickens at 31 weeks of age.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and egg weight phenotype determination at 31 weeks of age

[0031] A total of 2273 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the entire process. At 31 weeks of age, the egg weight of each chicken was recorded as the phenotypic data of egg weight at 31 weeks of age.

[0032] (2) Extraction of genomic DNA

[0033] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0034] (3) PCR amplification

[0035] The fragment containing the 3100727th base of chromosome 28 was amplified using the genomic DNA extracted as above as a template.

[0036] Upstream primer: 5'-AATGCTCGGTGTGTGGGTTT-3' (SEQ ID NO: 1)

[0037] Downstream primer: 5'-GAGAATCCTCGTGCAATTTGGC-3' (SEQ ID NO: 2) The final concentration of the reaction system is 25 μl.

[0038] DNA to be tested 50 ng,

[0039] 2 x Accurate Taq Master Mix 12.5 μl,

[0040] Upstream primer 1 μl,

[0041] Downstream primer 1 μl,

[0042] Add sterile water to 25 μl.

[0043] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 356bp was amplified, containing the SNP molecular marker at the 3100727th base site of chicken chromosome 28. The sequence of the amplified product is as follows:

[0044] SEQ ID NO: 3

[0045] AATGCTCGGTGTGTGGGTTTGGGCTGAGGAGATTGGGGTTAGGAGGGGGTAAGGGAAGCGTGTGCTGTTGGAGGGATGCAGGTGCGGGAGAATCGAGGGGAGAGACCTGAGGGGAGCGGGGAGGGCCCAGGTGTGGGTTGTGGTGTGAGGGAGCAGTTGGGGGTGGCTCGGGGCAGCT ACCAGGGAGCGTGAGGGGTGCTGAGGACCAGGGAACTGGCCAGGCTTGTTGCTGGGGCCTTTGGACGCTGTGGCTTATGGAGTTGGGCTGCTTGTGGGGGTCTGGCAGGAGGAGCTGCCAGCAGGGGCAAAGGGAGCTGAAGTGCTGCTGTTTGTTGCCAAATTGCACGAGGATTCTC

[0046] SEQ ID NO: 4

[0047] AATGCTCGGTGTGTGGGTTTGGGCTGAGGAGATTGGGGTTAGGAGGGGGTAAGGGAAGCGTGTGCTGTTGGAGGGATGCAGGTGCGGGAGAATCGAGGGGAGAGACCTGAGGGGAGCGGGGAGGGCCCAGGTGTGGGTTGTGGTGTGAGGGAGCAGTTGGGGGTGGCTCGGGGCAGCT ACCAGGGGGCGTGAGGGGTGCTGAGGACCAGGGAACTGGCCAGGCTTGTTGCTGGGGCCTTTGGACGCTGTGGCTTATGGAGTTGGGCTGCTTGTGGGGGTCTGGCAGGAGGAGCTGCCAGCAGGGGCAAAGGGAGCTGAAGTGCTGCTGTTTGTTGCCAAATTGCACGAGGATTCTC

[0048] (4) Sanger sequencing and genotyping

[0049] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0050] 2. Correlation Analysis

[0051] 2273 recessive White Lock hens with clear records of egg weight phenotype at 31 weeks of age were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and egg weight trait at 31 weeks of age of the experimental chickens. P<0.05 indicated significant differences. The results are shown in Table 1. The egg weight of the three genotypes at 31 weeks of age was significantly different (P<0.05). The average egg weight of A / A genotype individuals at 31 weeks of age was 52.84g, which was higher than 52.16g (P<0.05) of A / G genotype individuals and 51.35g (P<0.05) of G / G genotype individuals. The egg weight of A / G genotype individuals at 31 weeks of age was higher than that of G / G genotype individuals (P<0.05). The results showed that the chicken CDC34 gene molecular marker was significantly correlated with the phenotype of egg weight at 31 weeks of age. According to the actual breeding goals, A / A genotype individuals can be selected to breed chickens with larger egg weight at 31 weeks of age, thereby improving the overall egg weight and uniformity at 31 weeks of age and improving the breeding efficiency.

[0052] Table 1. Association analysis between CDC34 gene molecular marker and egg weight at 31 weeks of age

[0053]

[0054] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0055] Example 2

[0056] Genotype frequencies of different varieties

[0057] 1. Blood Sample Collection

[0058] Blood samples from 16 breeds, including White Leghorn laying hens, Beijing oily chickens, big bone chickens, Daweishan miniature chickens, Wenchang chickens, Wuding chickens, Piao chickens, bearded chickens, Tibetan chickens, Jingxing yellow chickens, Camellia chickens, Fujian Hetian chickens, Liyang chickens, Xinghua chickens, Guangxi Sanhuang chickens and Kebao broilers, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0059] 2. Extraction of Genomic DNA

[0060] Take the blood sample obtained in step 1 and use the Omega genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0061] 3. Genotype detection

[0062] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's G / G genotype, A / G genotype, and A / A genotype.

[0063] 4. Results Analysis

[0064] White Leghorn laying hens are a common commercial laying hen breed with high egg production and moderate and uniform egg weight. Beijing Oily Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Jingxing Yellow Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken and Guangxi Sanhuang Chicken are well-known local chicken breeds in China. Cobb broiler chickens are a common commercial broiler breed with large body size, poor egg production performance and large egg weight. Among the 16 populations described, this locus is highly homozygous in the Cobb broiler population and is polymorphic in the other 15 populations. The frequency of the A allele in the Cobb broiler population is higher than that in other breeds, see Table 2. These results all confirm that this SNP locus can be used as a molecular marker for the egg weight trait.

[0065] Table 2. Distribution of allele frequencies of CDC34 gene molecular markers in different varieties

[0066] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a detection primer for a SNP site of the CDC34 gene related to egg weight, characterized in that: The nucleotide sequences of the detection primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The SNP site is located at base 3100727 on chromosome 28 of the chicken reference genome GRCg7b version, and the base mutates to A or G. The detection primers are used to detect the egg weight trait of chickens at 31 weeks of age. The egg weight of chickens with A / A genotype at the SNP site at 31 weeks of age is higher than that of chickens with A / G and G / G genotypes, and the egg weight of chickens with A / G genotype at 31 weeks of age is higher than that of chickens with G / G genotype.

2. The use of the detection primers for the SNP site of the CDC34 gene related to the egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the amplified product is 356 bp in length and contains the 3100727th base of chromosome 28 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 3100727 on chromosome 28 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the SNP site of the CDC34 gene related to the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images