O-acetylhomoserine-producing microorganism and method for producing O-acetylhomoserine or L-methionine using same

Abstract

The present application relates to: a microorganism in which the activity of an N-acetyltransferase protein of the GNAT family is attenuated; a method for producing O-acetyl homoserine and L-methionine using the same; a composition for the production of O-acetyl homoserine, which comprises the microorganism; and to the use of said microorganism for the production of O-acetyl homoserine or L-methionine.

Description

Technical Field

[0001] The present disclosure relates to a microorganism in which the activity of a GNAT family N-acetyltransferase protein is attenuated; a method for producing O-acetyl homoserine and L-methionine using the same; a composition for producing O-acetyl homoserine, the composition comprising the microorganism; and use of the microorganism for producing O-acetyl homoserine or L-methionine. Background Art

[0002] O-acetyl homoserine can be used as a precursor of methionine (one of the essential amino acids in the body). Methionine is one of the essential amino acids in the body and has been widely used in feed and food additives, infusion solutions, and as a raw material for pharmaceutical products.

[0003] Methionine is produced by biological or chemical synthesis. In this regard, a two-step method for producing L-methionine from an L-methionine precursor produced by fermentation through an enzymatic conversion reaction is disclosed (International Publication No. WO2008 / 013432).

[0004] In the above two-step method, O-succinyl homoserine and O-acetyl homoserine can be used as methionine precursors. Therefore, the production of O-acetyl homoserine in high yield is important for the economical production of methionine on a large scale. Summary of the invention

[0005]

Technical issues

[0006] The present inventors have developed a microorganism of the genus Corynebacterium that produces O-acetyl homoserine, and a method for producing O-acetyl homoserine or L-methionine using the same, thereby completing the present disclosure.

[0007]

Technical solution

[0008] An object of the present disclosure is to provide a Corynebacterium microorganism having O-acetylhomoserine-producing ability, in which the activity of a GNAT family N-acetyltransferase protein is attenuated.

[0009] Another object of the present disclosure is to provide a method for producing O-acetyl homoserine, the method comprising the step of culturing a microorganism in a culture medium.

[0010] Another object of the present disclosure is to provide a method for producing L-methionine, the method comprising the step of culturing a microorganism in a culture medium.

[0011] Another object of the present disclosure is to provide a composition for producing O-acetyl homoserine, the composition comprising the microorganism.

[0012] Another object of the present disclosure is to provide use of the microorganism of the present disclosure for producing O-acetyl homoserine or L-methionine.

[0013]

Beneficial Effects

[0014] Compared with chemical synthesis, the microorganism producing O-acetyl homoserine disclosed in the present invention can produce O-acetyl homoserine in an environmentally friendly and efficient manner. In addition, the produced O-acetyl homoserine can be used as a precursor for synthesizing methionine and acetic acid by O-acetyl homoserine sulfhydrylase, thereby achieving efficient bioconversion of L-methionine, and the converted L-methionine can be widely used in the production of animal feed or animal feed additives and human food or food additives. DETAILED DESCRIPTION

[0015] The present disclosure will be described in detail below. Meanwhile, each description and embodiment disclosed in the present disclosure may also be applied to other descriptions and embodiments. That is to say, all combinations of the various elements disclosed in the present disclosure fall within the scope of the present disclosure. In addition, the scope of the present disclosure is not limited by the specific description described below.

[0016] In addition, many papers and patent documents are referenced and cited throughout the specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to further clarify the level and scope of the subject matter to which the present disclosure belongs.

[0017] One aspect of the present disclosure provides a Corynebacterium microorganism having an ability to produce O-acetyl homoserine, in which the activity of a GNAT family N-acetyltransferase protein is attenuated.

[0018] As used herein, the term "GNAT family N-acetyltransferase" refers to an N-acetyltransferase belonging to the GNAT (Gcn5-related N-acetyltransferase) family.

[0019] Specifically, the GNAT family N-acetyltransferase is known in the art, and the protein and gene sequences of the GNAT family N-acetyltransferase can be obtained from known databases, and examples thereof may include NCBI GenBank, etc., but are not limited thereto. More specifically, the GNAT family N-acetyltransferase may have and / or may include the amino acid sequence shown in SEQ ID NO: 1, or may be substantially composed of or may be composed of the amino acid sequence. For example, the protein composed of SEQ ID NO: 1 may refer to a protein inherently present in a microorganism of the genus Corynebacterium, which is encoded by the known NCgl0959 gene, but is not limited thereto, specifically, refers to a GNAT family N-acetyltransferase composed of the amino acid sequence of SEQ ID NO: 1 inherently present in a microorganism of the genus Corynebacterium, more specifically, refers to a GNAT family N-acetyltransferase of Corynebacterium glutamicum ATCC 13032 encoded by the NCgl0959 gene, but is not limited thereto.

[0020] In addition, the GNAT family N-acetyltransferase of the present disclosure may include the amino acid sequence shown in SEQ ID NO: 1 and an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with SEQ ID NO: 1. It is also obvious that any amino acid sequence having deletion, modification, substitution, conservative substitution or addition in part of the sequence may also fall within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and has the same or corresponding biological activity as the GNAT family N-acetyltransferase of the present disclosure.

[0021] In the present disclosure, although described as 'a polypeptide or protein comprising an amino acid sequence shown in a specific SEQ ID NO.', 'a polypeptide or protein consisting of an amino acid sequence shown in a specific SEQ ID NO.' or 'a polypeptide or protein having an amino acid sequence shown in a specific SEQ ID NO.', it is obvious that any protein having an amino acid sequence with deletion, modification, substitution, conservative substitution or addition in part of the sequence can be used in the present disclosure as long as the protein has the same or corresponding activity as a polypeptide consisting of an amino acid sequence of the corresponding SEQ ID NO. For example, there are cases where sequence additions, naturally occurring mutations, silent mutations or conservative substitutions thereof are present at the N-terminus and / or C-terminus of the amino acid sequence that do not change the function of the protein.

[0022] For example, there are cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions at the N-terminus, C-terminus and / or within the amino acid sequence that do not alter the function of the GNAT family N-acetyltransferase of the present disclosure.

[0023] As used herein, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions can generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. In addition, amino acids can be divided into amino acids with charged side chains and amino acids with uncharged side chains. Amino acids with charged side chains include aspartic acid, glutamic acid, lysine, arginine, and histidine, and amino acids with uncharged side chains can also be divided into non-polar amino acids or polar amino acids. Non-polar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline, and polar amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine. Generally, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Generally, conservative substitutions have little or no effect on the activity of the protein or polypeptide.

[0024] In addition, the GNAT family N-acetyltransferase can also include the deletion or addition of amino acids that have the least effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated to a signal (or leader) sequence at the N-terminus of the protein, which co-translationally or post-translationally directs the transfer of the protein. The polypeptide can also be conjugated to other sequences or linkers for identification, purification or synthesis of the polypeptide.

[0025] As used herein, the term "homology" or "identity" refers to the degree of similarity between two given amino acid sequences or nucleotide sequences, and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0026] The sequence homology or identity of conservative polynucleotides or polypeptides is determined by standard comparison algorithms, and the default gap penalty established by the used program can be used together. Basically, homologous or identical sequences can hybridize with all or part of the sequence under medium or high stringency conditions. Obviously, hybridization also includes polynucleotides and polynucleotides containing universal codons or codons that take into account codon degeneracy.

[0027] Known computer algorithms (such as the "FASTA" program) can be used to determine whether any two polynucleotide or polypeptide sequences have homology, similarity or identity, for example using the default parameters in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]:2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) can be used for determination, which is implemented as follows: the Needleman program (version 5.0.0 or later) in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (including the GCG program package ((Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [et al., J MOLEC BIOL 215]:403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073). For example, BLAST of the National Center for Biotechnology Information, or ClustalW can be used to determine homology, similarity or identity.

[0028] Homology, similarity or identity between polynucleotides or polypeptides can be determined by comparing sequence information using the GAP computer program, for example, as described by Needleman et al. (1970), J Mol Biol. 48:443 and as disclosed by Smith and Waterman, Adv. Appl. Math (1981) 2:482. In short, the GAP program defines homology, similarity or identity as the value obtained by dividing the number of similar aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) a binary comparison matrix (including a value of 1 for identity and a value of 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as disclosed in Schwartz and Dayhoff, ed., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap open penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

[0029] As used herein, the term "corresponding to" refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a listed residue in a polypeptide. Identifying an amino acid at a corresponding position can be determining a specific amino acid in a sequence with reference to a specific sequence. As used herein, a "corresponding region" generally refers to a similar or corresponding position in a related protein or a reference protein.

[0030] For example, an arbitrary amino acid sequence is aligned with SEQ ID NO: 1, and on this basis, each amino acid residue in the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, the sequence alignment algorithm described in the present disclosure can determine the position of an amino acid or the position of a modification such as a substitution, insertion or deletion by comparing it with the position of an amino acid in a query sequence (also referred to as a "reference sequence").

[0031] For this alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277), etc. can be used, but are not limited to these, and sequence alignment programs, pairwise sequence alignment algorithms, etc. known in the art can be appropriately used.

[0032] As used herein, the term "O-acetyl homoserine" is a specific intermediate substance in the methionine biosynthesis pathway of microorganisms, and refers to an acetyl derivative of L-homoserine. O-acetyl homoserine can be produced by an enzyme activity that transfers an acetyl group of acetyl-CoA to homoserine using homoserine and acetyl-CoA as substrates.

[0033] As used herein, the term "microorganism (or strain)" includes all wild-type microorganisms or naturally or artificially genetically modified microorganisms, and it can be a microorganism in which a specific mechanism is weakened or enhanced due to the insertion of exogenous genes or the enhancement or inactivation of the activity of endogenous genes, and it can be a microorganism comprising a genetic modification for producing a target polypeptide, protein or product.

[0034] As used herein, the term "microorganism having O-acetyl homoserine production ability" includes such microorganisms: it is a eukaryotic or prokaryotic microorganism capable of producing O-acetyl homoserine in a living organism, and its parent microorganism that does not have O-acetyl homoserine production ability is endowed with O-acetyl homoserine production ability, or is endogenously endowed with O-acetyl homoserine production ability. O-acetyl homoserine production ability can be provided or promoted by species improvement. The microorganism having O-acetyl homoserine production ability can be a strain producing L-lysine, L-threonine, L-isoleucine or L-methionine, or can be a derivative strain thereof, but is not limited thereto.

[0035] For the purpose of the present disclosure, the microorganism producing O-acetyl homoserine is characterized in that the desired O-acetyl homoserine production capacity is enhanced compared to the endogenous activity by weakening the activity of the GNAT family N-acetyltransferase protein, and can be a genetically modified microorganism or a recombinant microorganism, but is not limited thereto. Specifically, the recombinant strain with enhanced O-acetyl homoserine production capacity can be a microorganism with enhanced O-acetyl homoserine production capacity compared to a natural wild-type microorganism or an unmodified microorganism having endogenous activity of the GNAT family N-acetyltransferase protein, but is not limited thereto.

[0036] For example, the O-acetyl homoserine-producing microorganism may be a microorganism that endogenously comprises a protein consisting of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with SEQ ID NO: 1.

[0037] For example, the microorganism producing O-acetyl homoserine can be a microorganism that endogenously includes a polynucleotide sequence encoding a protein including an amino acid sequence having at least 80% homology to SEQ ID NO: 1, or the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 2.

[0038] For example, compared to the parent strain before modification or the unmodified microorganism having endogenous activity of the GNAT family N-acetyltransferase protein, the microorganism with enhanced productivity can have an increased O-acetyl homoserine productivity of about 1% or more, specifically, about 1% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 21% or more, about 22% or more, about 23% or more, about 24% or more, about 25% or more, about 26% or more, about 27% or more, about 28% or more, about 29% or more, or about 30% or more (the upper limit is not particularly limited, but can be, for example, about 100% or less, about 50% or less, about 45% or less, or about 40% or less, or about 35% or less), but the increase is not limited thereto, as long as the productivity has an increase of + value compared to the productivity of the parent strain before modification or the unmodified microorganism. In another example, the recombinant strain with enhanced production capacity can have an enhanced O-acetyl homoserine production capacity of about 1.1 times or more, about 1.2 times or more, about 1.21 times or more, about 1.22 times or more, about 1.23 times or more, about 1.24 times or more, about 1.25 times or more, about 1.26 times or more, about 1.27 times or more, about 1.28 times or more, about 1.29 times or more, about 1.30 times or more (the upper limit is not particularly limited, but can be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, or about 1.4 times or less), compared to the parent strain or unmodified microorganism before modification, but is not limited thereto.

[0039] As used herein, the term "unmodified microorganism" does not exclude the bacterial strain comprising a mutation that may occur naturally in the microorganism, and may be a wild-type strain or a natural strain itself, or may be a strain before the genetic variation caused by natural or artificial factors changes the character. For example, an unmodified microorganism may refer to a strain in which the GNAT family N-acetyltransferase protein activity described herein is not weakened or has not yet weakened compared to the endogenous activity." unmodified microorganism" may be used interchangeably with "strain before modification", "microorganism before modification", "unchanged strain", "unmodified strain", "unchanged microorganism" or "reference microorganism".

[0040] The microorganism with O-acetyl homoserine production ability can be a prokaryotic cell or a eukaryotic cell, specifically, a prokaryotic cell. Prokaryotic cells can include, for example, Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacterium sp., Pseudomonas sp., Leptospira sp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., and Norcardia sp., or fungi, or microbial strains in yeast. Specifically, prokaryotic cells can be microbial strains in Escherichia sp., Corynebacterium sp., Leptospira sp., or fungi. More specifically, it may be a microorganism strain of the genus Corynebacterium.

[0041] In the present disclosure, "microorganisms of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium. Specifically, it may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium serrata. flavescens), more specifically, Corynebacterium glutamicum.

[0042] The unmodified microorganism may be a microorganism comprising an amino acid sequence consisting of SEQ ID NO: 1, or a polynucleotide consisting of SEQ ID NO: 2.

[0043] Meanwhile, it is known that Corynebacterium microorganisms are capable of producing O-acetyl homoserine, but their production capacity is significantly low, and the gene or mechanism responsible for the production mechanism has not yet been revealed. Therefore, the Corynebacterium microorganisms of the present disclosure that produce O-acetyl homoserine can include all of the following: natural wild-type microorganisms themselves, Corynebacterium microorganisms with improved O-acetyl homoserine production capacity by enhancing or weakening the activity of genes related to the O-acetyl homoserine production mechanism, and Corynebacterium microorganisms with improved O-acetyl homoserine production capacity by introducing or enhancing the activity of exogenous genes.

[0044] As used herein, the term "reduction" of polypeptide activity has all concepts covering reduced activity or loss of activity compared to endogenous activity. Reduction can be used interchangeably with terms such as inactivation, lack, downregulation, reduction, decrease, weakening, etc.

[0045] Specifically, attenuation may be, but is not limited to, inactivation. Inactivation may mean that the protein is not expressed at all, or even if expressed, its activity is absent or attenuated, compared to the parent strain or a strain in which the protein consisting of the amino acid sequence of SEQ ID NO: 1 is not modified.

[0046] The attenuation may also include: the activity of the polypeptide itself is weakened or disappears compared with the original polypeptide activity of the microorganism due to the variation of the polynucleotide encoding the polypeptide; the overall polypeptide activity level and / or concentration (expression level) in the cell is lower than that of the natural strain due to the inhibition of gene expression of the polynucleotide encoding the polypeptide or the inhibition of translation into the polypeptide; the polynucleotide is not expressed at all; and / or there is no polypeptide activity even when the polynucleotide is expressed.

[0047] "Endogenous activity" refers to the activity of a specific polypeptide originally present in a parent strain or a wild-type or unmodified microorganism before the trait is changed when the trait is changed due to genetic variation caused by natural or artificial factors. This can be used interchangeably with "activity before modification". "Inactivation, lack, reduction, downregulation, decrease or attenuation" of a polypeptide activity compared to its endogenous activity means that the activity of the polypeptide is reduced compared to the activity of a specific polypeptide originally present in a parent strain or an unmodified microorganism before the trait is changed.

[0048] The reduction of the activity of such a polypeptide can be carried out by any method known in the art, but is not limited thereto, and can be achieved by applying various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2): 2773-2793; Sambrook et al., Molecular Cloning 2012, etc.).

[0049] Specifically, attenuating the activity of the polypeptide of the present disclosure can be achieved by:

[0050] 1) Deletion of all or part of the gene encoding the polypeptide;

[0051] 2) modifying the expression control region (or expression control sequence) to reduce the expression of the gene encoding the polypeptide;

[0052] 3) Modifying the amino acid sequence constituting the polypeptide to eliminate or weaken the activity of the polypeptide (for example, deleting / replacing / adding one or more amino acids in the amino acid sequence);

[0053] 4) Modifying a gene sequence encoding a polypeptide to eliminate or weaken the activity of the polypeptide (for example, deleting / replacing / adding one or more nucleotides in the nucleotide sequence of the polypeptide gene to encode the modified polypeptide, thereby eliminating or weakening the activity of the polypeptide);

[0054] 5) modifying the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0055] 6) introducing an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to a gene transcript encoding a polypeptide;

[0056] 7) adding a sequence complementary to the Shine-Dalgarno sequence of the gene encoding the polypeptide upstream of the Shine-Dalgarno sequence to form a secondary structure that prevents ribosomes from attaching;

[0057] 8) adding a promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (reverse transcription engineering, RTE); or

[0058] 9) A combination of two or more selected from 1) to 8), but not particularly limited thereto.

[0059] For example,

[0060] 1) Deleting part or all of a gene encoding a polypeptide may be by deleting all of the polynucleotide encoding the endogenous target polypeptide in the chromosome, replacing it with a polynucleotide in which some nucleotides are deleted, or replacing it with a marker gene.

[0061] In addition, 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative substitution or conservative substitution or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling transcription and translation termination, but is not limited thereto.

[0062] In addition, 3) and 4) modification of the amino acid sequence or polynucleotide sequence may be a mutation in the sequence through deletion, insertion, non-conservative substitution or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or replacement with an amino acid sequence or polynucleotide sequence improved to have no activity, thereby weakening the activity of the polypeptide, but not limited thereto. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but not limited thereto.

[0063] Furthermore, 5) modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, replacement with a nucleotide sequence encoding another start codon having a lower polypeptide expression rate instead of the endogenous start codon, but is not limited thereto.

[0064] 6) Introduction of antisense oligonucleotides (e.g., antisense RNA) that complementarily bind to gene transcripts encoding polypeptides can be found in, for example, the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1 (1) 1986].

[0065] 7) A sequence complementary to the Shine-Dalgarno sequence of the gene encoding the polypeptide is added upstream of the Shine-Dalgarno sequence to form a secondary structure that prevents ribosomes from attaching, which may make the mRNA unable to be translated or reduce its translation rate.

[0066] 8) Adding a promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (reverse transcription engineering, RTE) may make the antisense nucleotide complementary to the gene transcript encoding the polypeptide, thereby weakening the activity.

[0067] Specifically, the microorganism having the ability to produce O-acetyl homoserine of the present disclosure may be a microorganism in which the activity of a GNAT family N-acetyltransferase protein is inactivated, but is not limited thereto.

[0068] Specifically, in order to inactivate the activity of the GNAT family N-acetyltransferase protein, a method for deleting part or all of the genes encoding the protein can be used. Specifically, this can be carried out by replacing the polynucleotides encoding the endogenous target protein in the chromosome with polynucleotides or marker genes that lack some nucleotide sequences via a vector for chromosome insertion in a microorganism. As an example of a method for deleting part or all of the polynucleotides, a method for deleting polynucleotides by homologous recombination can be used, but is not limited thereto. As another example, the method for deleting part or all of the genes can be carried out by inducing mutations with light or chemicals such as ultraviolet rays, and then selecting a bacterial strain that lacks the target gene from the mutant obtained.

[0069] Gene deletion methods include methods using gene recombination techniques. For example, this can be achieved by injecting a polynucleotide sequence or vector containing a polynucleotide sequence homologous to the target gene into a microorganism to cause homologous recombination. In addition, the polynucleotide sequence or vector to be injected can include a dominant selection marker, but is not limited thereto.

[0070] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or longer that is a polymer of nucleotides, in which nucleotide monomers are linked into a long chain by covalent bonds; more specifically, it refers to a polynucleotide fragment encoding a variant.

[0071] In the present disclosure, the GNAT family N-acetyltransferase may be encoded by a gene including a polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto. More specifically, the GNAT family N-acetyltransferase may be encoded by a gene having and / or including a polynucleotide sequence of SEQ ID NO: 2, or by a gene consisting essentially of or consisting of the polynucleotide sequence, but is not limited thereto. The nucleotide sequence of SEQ ID NO: 2 may be obtained from a known database, examples of which may include NCBI GenBank, etc., but are not limited thereto.

[0072] In the present disclosure, a gene comprising the nucleotide sequence of SEQ ID NO: 2 may be used interchangeably with a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2, a gene or polynucleotide having the nucleotide sequence of SEQ ID NO: 2, or a gene or polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.

[0073] Various modifications may be made to the coding regions of the polynucleotides of the present disclosure without changing the amino acid sequence of the variants of the present disclosure, taking into account the degeneracy of codons or the codon preferences in the organism in which the variants of the present disclosure are intended to be expressed. Specifically, as a polynucleotide of the present disclosure, any polynucleotide sequence may be included in the scope of the present disclosure, as long as it can encode a protein including an amino acid sequence having at least 80% homology to SEQ ID NO: 1, and it may have or include the nucleotide sequence of SEQ ID NO: 2, or have or include a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 2, or may consist of or essentially consist of the nucleotide sequence of SEQ ID NO: 2, or consist of or essentially consist of a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 2, but is not limited thereto.

[0074] In addition, the polynucleotides of the present disclosure may include probes prepared from known gene sequences, for example, any sequence may be included, as long as it is a sequence that can hybridize with all or part of the complementary sequence of the polynucleotide sequence of the present disclosure under stringent conditions, then it is not limited. "Stringent conditions" refer to conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). Examples include conditions in which polynucleotides with higher homology or identity, i.e., polynucleotides with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, hybridize with each other, whereas polynucleotides with lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically 2 to 3 times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS, which are general washing conditions for Southern hybridization.

[0075] Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between bases are allowed depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, for DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present disclosure may also include substantially similar nucleic acid sequences and isolated nucleic acid fragments that are complementary to the entire sequence.

[0076] Specifically, the hybridization conditions including the hybridization step with a Tm value of 55° C. and the above conditions can be used to detect polynucleotides having homology or identity with the polynucleotides disclosed herein. In addition, the Tm value can be 60° C., 63° C. or 65° C., but is not limited thereto, and those skilled in the art can make appropriate adjustments according to the purpose.

[0077] The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementation, and these variables are well known in the art (eg, J. Sambrook et al., supra).

[0078] Specifically, the microorganism having O-acetyl homoserine-producing ability of the present disclosure may be a microorganism in which the activity of the GNAT family N-acetyltransferase protein is inactivated, but is not limited thereto.

[0079] Specifically, the microorganism having the ability to produce O-acetyl homoserine disclosed in the present invention may be a microorganism in which the polynucleotide encoding the GNAT family N-acetyltransferase is deleted, but is not limited thereto. More specifically, the microorganism having the ability to produce O-acetyl homoserine disclosed in the present invention may be a microorganism in which the nucleotide sequence of SEQ ID NO: 2 is deleted, but is not limited thereto.

[0080] For the purpose of the present disclosure, the microorganism comprises an expression vector for inactivating the GNAT family N-acetyltransferase protein in the host cell, thereby inactivating the activity of the GNAT family N-acetyltransferase protein, but is not limited thereto.

[0081] The vector of the present disclosure may comprise a DNA construct comprising a nucleotide sequence of a polynucleotide encoding a desired polypeptide, which is operably linked to a suitable expression regulatory region (or expression control sequence) so that the desired polypeptide can be expressed in a suitable host. The expression regulatory region may comprise a promoter capable of initiating transcription, any operon sequence controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling transcription and translation termination. The vector may be transformed into a suitable host cell and then replicated or functioned independently of the host genome, or may be integrated into the genome itself.

[0082] The vector used in the present disclosure is not particularly limited, but any vector known in the art can be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as phage vectors or cosmid vectors; pDZ system, pBR system, pUC system, pBluescript II system, pGEM system, pTZ system, pCL system, pSK system, pSKH system, pET system, etc. can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0083] For example, the polynucleotide encoding the desired polypeptide can be inserted into the chromosome by the vector for intracellular chromosome insertion. The polynucleotide can be inserted into the chromosome by any method known in the art, such as homologous recombination, but is not limited thereto. The carrier can also include a selection marker for confirming chromosome insertion. The selection marker is used to select cells transformed with the carrier, i.e., for confirming the insertion of the desired nucleic acid molecule, and can use a marker that grants a selectable phenotype (such as drug resistance, auxotrophy, cytotoxic agent resistance or surface polypeptide expression). In the environment of processing with a selection agent, only the cells expressing the selection marker survive or show other phenotypic traits, and therefore the cells transformed can be selected.

[0084] As used herein, the term "transformation" refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. As long as the converted polynucleotide can be expressed in the host cell, it can be positioned, regardless of the position by being inserted into the chromosome of the host cell or being located outside the chromosome. In addition, the polynucleotide comprises DNA and / or RNA encoding the desired polypeptide. The polynucleotide can be introduced in any form, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct containing all the elements required for autonomous expression. The expression cassette can generally include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably connected to the polynucleotide. The expression cassette can be in the form of an expression vector capable of self-replication. In addition, the polynucleotide can be introduced into the host cell in its own form and operably connected to the sequence required for expression in the host cell, but is not limited thereto.

[0085] Furthermore, the term "operably linked" means that a polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of a polynucleotide encoding a desired variant of the present disclosure.

[0086] The modification of some or all of the polynucleotides in the microorganisms disclosed herein can be induced by: (a) homologous recombination using a vector for chromosome insertion in the microorganism, or genome editing using an engineered nuclease (e.g., CRISPRCas9), and / or (b) treatment with light (e.g., ultraviolet light and radiation) and / or chemicals, but not limited thereto. Methods for modifying some or all of the genes may include methods by DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene can be introduced into the microorganism to cause homologous recombination, resulting in partial or complete deletion of the gene. The nucleotide sequence or vector to be introduced may contain a dominant selection marker, but is not limited thereto.

[0087] As used herein, the term "enhancement" of polypeptide activity refers to the activity enhancement of polypeptide compared with its endogenous activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression and increase. Here, activation, enhancement, upregulation, overexpression and increase can include two situations of showing activity that was not originally possessed or activity enhancement compared with endogenous activity or activity before modification." Endogenous activity" refers to the activity of the original specific polypeptide of the parent strain or unmodified microorganism before the property change when the genetic variation caused by natural or artificial factors changes. This can be used interchangeably with "activity before modification". Compared with endogenous activity, the fact that the activity of polypeptide is "enhanced", "upregulated", "overexpressed" or "increased" means that, compared with the activity and / or concentration (expression level) of the original specific polypeptide of the parent strain or unmodified microorganism before the property change, the activity of polypeptide has improved.

[0088] Enhancement can be achieved by introducing exogenous polypeptides or enhancing the activity and / or concentration (expression level) of endogenous polypeptides. The enhancement of polypeptide activity can be confirmed by an increase in the activity degree and expression level of the corresponding polypeptide or an increase in the amount of the corresponding polypeptide released product.

[0089] In order to enhance the activity of the polypeptide, various methods well known in the art can be applied, as long as the activity of the desired polypeptide can be enhanced compared to the microorganism before modification, the method is not limited. Specifically, genetic engineering and / or protein engineering well known to those skilled in the art can be used, which are conventional methods of molecular biology, but the method is not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, 1-16, Sambrook et al., Molecular Cloning 2012, etc.). Specifically, the polypeptide of the present disclosure can be:

[0090] 1) Increasing the copy number of the polynucleotide encoding the polypeptide in the cell;

[0091] 2) modifying the gene expression regulatory region on the chromosome encoding the polypeptide (for example, the expression regulatory region is mutated, replaced with a more active sequence, or a more active sequence is inserted);

[0092] 3) modifying the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0093] 4) Modify the amino acid sequence of a polypeptide to enhance the activity of the polypeptide;

[0094] 5) modifying a polynucleotide sequence encoding a polypeptide to enhance the activity of the polypeptide (e.g., modifying a polynucleotide sequence of a polypeptide gene to encode a modified polypeptide to enhance the activity of the polypeptide);

[0095] 6) introducing an exogenous polypeptide expressing the polypeptide activity or an exogenous polynucleotide encoding the polypeptide;

[0096] 7) Codon optimization of polynucleotides encoding polypeptides;

[0097] 8) analyzing the tertiary structure of the polypeptide to select and modify or chemically modify exposed sites; or

[0098] 9) A combination of two or more selected from 1) to 8), but not particularly limited thereto.

[0099] More specifically, 1) increasing the number of copies of a polynucleotide encoding a polypeptide in a cell can be achieved by introducing a vector into a host cell, the vector can replicate and function independently of the host, and the polynucleotide encoding the corresponding polypeptide is operably linked to the vector. Alternatively, this increase can be achieved by introducing one copy or two or more copies of the polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell. The introduction into the chromosome can be carried out by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0100] 2) Replacing the gene expression regulatory region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence showing strong activity may be, for example, a variation in the sequence due to deletion, insertion, non-conservative or conservative substitution or a combination thereof, or replacing it with a sequence showing stronger activity, thereby further enhancing the activity of the expression regulatory region. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling transcription and translation termination, etc. For example, the replacement may be replacing the original promoter with a strong promoter, but is not limited thereto.

[0101] Examples of known strong promoters include CJ1 to CJ7 promoters (U.S. 7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. 10584338B2), O2 promoter (U.S. 10273491B2), tkt promoter, yccA promoter, etc., but are not limited to these.

[0102] 3) Modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, replaced with another start codon having a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0103] 4) and 5) modification of the amino acid sequence or polynucleotide sequence may be due to a deletion, insertion, non-conservative substitution or conservative substitution or a combination thereof of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or a replacement of an amino acid sequence or polynucleotide sequence that is improved to exhibit stronger activity, or a replacement of an amino acid sequence or polynucleotide sequence that is improved to be more active, thereby enhancing the activity of the polypeptide, but is not limited thereto. The replacement may be specifically carried out by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used herein may also include a selection marker for confirming chromosome insertion. The selection marker is as described above.

[0104] 6) The introduction of an exogenous polynucleotide that exhibits polypeptide activity can be to introduce an exogenous polynucleotide into a host cell, and the polypeptide encoded by the exogenous polynucleotide exhibits the same or similar activity as the polypeptide. There is no limitation on its source or sequence, as long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide. The method used in the introduction can be carried out by appropriately selecting a known transformation method by a person skilled in the art. As the introduced polynucleotide is expressed in the host cell, a polypeptide can be produced, and its activity can be enhanced.

[0105] 7) Codon optimization of a polynucleotide encoding a polypeptide can be codon optimization of an endogenous polynucleotide to enhance transcription or translation in a host cell, or codon optimization of an exogenous polynucleotide to optimize transcription and translation in a host cell.

[0106] 8) Analyzing the tertiary structure of a polypeptide to select and modify or chemically modify an exposed site can be, for example, by comparing the sequence information of the polypeptide to be analyzed with a database storing known protein sequence information, determining a template protein candidate according to the degree of sequence similarity, confirming the structure based on this, and modifying or chemically modifying the exposed site to be modified or chemically modified.

[0107] Based on the activity or concentration of the polypeptide expressed in the wild type or microbial strain before modification, this enhancement of polypeptide activity can be an increase in the activity or concentration / expression level of the corresponding polypeptide, or an increase in the amount of the product produced by the corresponding polypeptide, but is not limited thereto.

[0108] In the microorganism having O-acetyl homoserine-producing ability of the present disclosure, the activity of L-methionine / branched-chain amino acid exporter YjeH protein may be further enhanced, but is not limited thereto.

[0109] As used herein, the term "L-methionine / branched-chain amino acid exporter YjeH" is an amino acid efflux (AAE) member of the amino acid-polyamine-organic cation (APC) transporter family, and is a protein that mediates the export of O-acetyl homoserine and / or homoserine to the extracellular space. YjeH is expected to contain 12 transmembrane alpha helices, 10 of which form an inverted repeat fold, which is a characteristic of the APC superfamily. The protein and gene sequences of the L-methionine / branched-chain amino acid exporter YjeH can be obtained from known databases, examples of which may include NCBI GenBank, etc., but are not limited thereto. In addition, it can be derived from Escherichia coli (E. coli), for example, but is not limited thereto. In the present disclosure, the L-methionine / branched-chain amino acid exporter YjeH protein can be used interchangeably with inner membrane proteins, O-acetyl homoserine exporters, proteins having O-acetyl homoserine export capability, proteins having O-acetyl homoserine export activity, YjeH proteins, or YjeH.

[0110] Specifically, the microorganism with O-acetyl homoserine production ability disclosed herein may also include a variant of L-methionine / branched-chain amino acid export protein YjeH, but is not limited thereto. More specifically, the microorganism with O-acetyl homoserine production ability disclosed herein may have enhanced activity of L-methionine / branched-chain amino acid export protein YjeH protein by further introducing a variant of L-methionine / branched-chain amino acid export protein YjeH, but is not limited thereto.

[0111] More specifically, the variant of the L-methionine / branched-chain amino acid exporter YjeH can enhance the O-acetyl homoserine production capacity by increasing the amount of O-acetyl homoserine exported by the microorganism, and may have and / or may include the amino acid sequence shown in SEQ ID NO: 10, or may be essentially composed of the amino acid sequence or may be composed of the amino acid sequence.

[0112] In addition, variants of L-methionine / branched-chain amino acid exporter YjeH may include the amino acid sequence shown in SEQ ID NO: 10 and amino acid sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with SEQ ID NO: 10. It is also obvious that any of the amino acid sequences having deletions, modifications, substitutions, conservative substitutions or additions in part of the sequence may also be included in the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and has the same or corresponding biological activity as the variants of L-methionine / branched-chain amino acid exporter YjeH of the present disclosure.

[0113] For example, the microorganism having O-acetyl homoserine-producing ability of the present disclosure may be a microorganism having further enhanced O-acetyl homoserine-producing ability by further including, specifically, further introducing a protein consisting of the amino acid sequence of SEQ ID NO: 10, or a protein consisting of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with SEQ ID NO: 10.

[0114] Specifically, "introduction of protein" means showing the activity of a specific protein by expressing a gene in a microorganism, which gene was not originally possessed by the microorganism, or showing an increased or enhanced activity compared to the endogenous activity of the corresponding protein or the activity before modification. For example, a polynucleotide encoding a specific protein can be introduced into the chromosome of a microorganism, or a vector containing a polynucleotide encoding a specific protein can be introduced into a microorganism to show its activity.

[0115] For the purpose of the present disclosure, a microorganism comprising a variant of the L-methionine / branched-chain amino acid export protein YjeH may refer to a microorganism that enhances the O-acetyl homoserine export capacity by introducing a variant of the L-methionine / branched-chain amino acid export protein YjeH into a microorganism with a natural weak O-acetyl homoserine export capacity. Specifically, the microorganism is characterized in that, compared with a wild-type or unmodified microorganism, a variant of the L-methionine / branched-chain amino acid export protein YjeH is introduced to increase the extracellular release of O-acetyl homoserine, thereby increasing the yield of O-acetyl homoserine. This is because, by introducing a variant of the L-methionine / branched-chain amino acid export protein YjeH, the release of O-acetyl homoserine from the microorganism is increased, thereby increasing the yield of O-acetyl homoserine, while the wild-type or unmodified microorganism does not release O-acetyl homoserine, or although O-acetyl homoserine is released, only trace amounts of O-acetyl homoserine are produced.

[0116] Korean Patent No. 10-2182497 discloses examples of transmembrane protein YjeH and / or variants thereof applicable to the present disclosure, and the disclosure of this patent is incorporated herein by reference in its entirety.

[0117] In the microorganism having O-acetylhomoserine-producing ability of the present disclosure, the activity of homoserine acetyltransferase (MetX) may be further enhanced, but is not limited thereto.

[0118] As used herein, the term "MetX" refers to homoserine acetyltransferase. Specifically, most microorganisms present in nature utilize O-succinylhomoserine or O-acetylhomoserine as intermediates in methionine biosynthesis. Typically, MetA produces O-succinylhomoserine, and homoserine O-acetyltransferase produces O-acetylhomoserine. Unlike MetA, MetX is not subject to feedback inhibition and has high enzyme stability. The protein and gene sequences of MetX can be obtained from known databases, examples of which may include NCBI GenBank, etc., but are not limited thereto. As used herein, the term "homoserine acetyltransferase" can be used interchangeably with "MetX" and "homoserine O-acetyltransferase".

[0119] Specifically, in the microorganism having the ability to produce O-acetyl homoserine of the present disclosure, the expression of the metX gene encoding O-acetyl homoserine transferase may be further amplified, but is not limited thereto.

[0120] The nucleotide sequence of the metX gene can be obtained from the known database NCBI GenBank. As a polynucleotide encoding MetX, any polynucleotide sequence can be included in the scope of the present disclosure, as long as it is a polynucleotide sequence capable of encoding a protein including an amino acid sequence having at least 80% homology with MetX, may have or may include the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with the sequence of SEQ ID NO: 26, or may consist of or substantially consist of the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with the sequence of SEQ ID NO: 26, but is not limited thereto.

[0121] Korean Patent No. 10-2182497 discloses an example of the metX gene applicable to the present disclosure, and the disclosure of this patent is incorporated herein by reference in its entirety.

[0122] In the microorganism having O-acetyl homoserine-producing ability of the present disclosure, the activity of aspartate kinase may be further enhanced, but is not limited thereto.

[0123] Specifically, in order to increase the biosynthesis of O-acetyl homoserine, compared with unmodified microorganisms, aspartate kinase activity can be further enhanced, in particular, mutation (L377K) (Korean Patent Publication No. 10-2019-0003019) can be introduced to relieve the feedback inhibition of L-lysine and L-threonine of the gene (lysC) encoding aspartate kinase, but not limited thereto. The nucleotide sequence of lysC can be obtained from known databases, and any nucleotide sequence encoding a protein with aspartate kinase activity can be included without limitation, and an example thereof can have the nucleotide sequence of SEQ ID NO:21.

[0124] In the microorganism having the ability to produce O-acetyl homoserine of the present disclosure, the activity of cystathionine γ synthase may be further attenuated, but is not limited thereto.

[0125] Specifically, attenuation may be inactivation, but is not limited thereto.

[0126] Specifically, compared with an unmodified microorganism, the activity of cystathionine gamma synthase can be reduced or inactivated, and in particular, the gene encoding cystathionine synthase (metB) can be deleted, but is not limited thereto. As used herein, the term "cystathionine gamma synthase" can be used interchangeably with "cystathionine synthase". The nucleotide sequence of metB can be obtained from a known database, and can include without limitation any nucleotide sequence encoding a protein having cystathionine synthase activity, an example of which can have the nucleotide sequence of SEQ ID NO: 11.

[0127] In the microorganism having O-acetyl homoserine-producing ability of the present disclosure, the activity of O-acetyl homoserine (thiol)-lyase may be further attenuated, but is not limited thereto.

[0128] Specifically, the attenuation may be inactivation, but is not limited thereto.

[0129] Specifically, compared with an unmodified microorganism, the activity of O-acetyl homoserine thiol lyase can be reduced or inactivated, and in particular, the gene encoding O-acetyl homoserine thiol lyase (metY) can be deleted, but is not limited thereto. The nucleotide sequence of metY can be obtained from a known database, and can include without limitation any nucleotide sequence encoding a protein having O-acetyl homoserine thiol lyase activity, an example of which can have the nucleotide sequence of SEQ ID NO: 16.

[0130] Another aspect of the present disclosure provides a method for producing O-acetyl homoserine, the method comprising the step of culturing a microorganism in a culture medium.

[0131] The microorganism and O-acetyl homoserine are as described above.

[0132] In the method disclosed herein, the culture of the microorganisms can adopt any culture conditions and culture methods known in the art. According to the selected strain, those skilled in the art can easily adjust and use the culture procedure.

[0133] As used herein, the term "culture" refers to growing the microorganisms of the present disclosure under appropriately adjusted environmental conditions. The culture procedures of the present disclosure can be carried out according to suitable culture media or culture conditions known in the art. Those skilled in the art can easily adjust and use such culture processes according to the selected strains. Specifically, the culture can be batch type, continuous type and fed-batch type, but is not limited thereto.

[0134] As used herein, "culture medium" refers to a mixture containing nutrients required for culturing the microorganisms of the present disclosure as the main components, wherein the culture medium provides nutrients including water, growth factors, etc. necessary for survival and growth. Specifically, for the culture medium and other culture conditions for culturing the microorganisms of the present disclosure, any culture medium commonly used for culturing microorganisms can be used without particular limitation. However, the microorganisms of the present disclosure can be cultured in a general culture medium containing a suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid and / or vitamin under aerobic conditions, while controlling temperature, pH, etc.

[0135] In the present disclosure, the carbon source may include carbohydrates such as glucose, sucrose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, bagasse, and corn syrup may be used, and specifically, carbohydrates such as glucose and aseptically pretreated molasses (i.e., molasses converted into reducing sugars) may be used, and appropriate amounts of various other carbon sources may be used without restriction. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0136] As the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc., amino acids such as glutamic acid, methionine, glutamine, etc., and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition product, defatted soybean cake or its degradation product, etc. can be used. These nitrogen sources can be used alone or in combination of two or more, but are not limited thereto.

[0137] The phosphate source may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and their corresponding sodium salts. The inorganic compound may include sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins and / or suitable precursors. These components or precursors may be added to the culture medium in batches or continuously, but are not limited thereto.

[0138] In the process of cultivating the microorganism of the present disclosure, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture medium in an appropriate manner. In addition, a defoamer (such as fatty acid polyethylene glycol ester) can be added to suppress foam formation during cultivation. In addition, oxygen or oxygen-containing gas can be injected into the culture medium to maintain the aerobic state of the culture medium, or gas can not be injected, or nitrogen, hydrogen or carbon dioxide gas can be injected to maintain the anaerobic or non-aerobic state of the culture medium, but is not limited thereto.

[0139] The culture temperature may be 25° C. to 40° C., more specifically, 28° C. to 37° C., but not limited thereto. The culture may be continued until a desired yield of a useful substance is obtained, specifically, 1 hour to 100 hours, but not limited thereto.

[0140] O-acetyl homoserine produced by the culture of the present disclosure may be released into the culture medium, or may be retained in the cells.

[0141] The method for producing O-acetyl homoserine of the present disclosure may further include, for example, before or after the culturing step, the step of preparing the microorganism of the present disclosure, preparing a culture medium for culturing the microorganism, or a combination thereof (regardless of the order, in any order).

[0142] The method for producing O-acetyl homoserine disclosed herein may further include a step of recovering O-acetyl homoserine from a culture medium (a culture medium that has been cultured) or a microorganism produced by the culture. A recovery step may also be included after the culture step.

[0143] Recovery can be: according to the method of culturing microorganisms disclosed herein, such as batch, continuous or fed-batch type culture, the desired O-acetyl homoserine can be collected by using suitable methods known in the art. For example, centrifugation, filtration, treatment with a crystalline protein precipitant (salting out), extraction, ultrasonic treatment, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography and affinity chromatography, etc.), HPLC and combinations of these methods can be used, and the desired O-acetyl homoserine can be recovered from the culture medium or microorganism by using suitable methods known in the art.

[0144] In addition, the method for producing O-acetyl homoserine disclosed herein may further include a purification step. Purification may be performed using a suitable method known in the art. In an exemplary embodiment, when the method for producing O-acetyl homoserine disclosed herein includes a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously without regard to the order, or may be performed simultaneously or integrated into one step, but is not limited thereto.

[0145] From the O-acetyl homoserine thus recovered, methionine can be produced by a two-step process (Korean Patent No. 10-0905381).

[0146] Another aspect of the present disclosure provides a method for producing L-methionine, the method comprising the steps of culturing a microorganism in a culture medium, producing O-acetyl homoserine from the cultured microorganism or the culture medium, and converting O-acetyl homoserine into L-methionine.

[0147] The microorganism, O-acetyl homoserine and L-methionine are as described above.

[0148] The two-step method includes a process of producing L-methionine and an organic acid by an enzymatic reaction using an enzyme having O-acetyl homoserine sulfhydrylase activity or a strain including the enzyme, using O-acetyl homoserine and methyl mercaptan produced by an L-methionine precursor-producing strain as substrates.

[0149] More specifically, the present disclosure provides a method for producing L-methionine using O-acetyl homoserine accumulated by the method as a substrate and using an enzymatic reaction of O-acetyl homoserine sulfhydrylase or the like.

[0150] In the two-step method, when O-acetyl homoserine is used as an L-methionine precursor, O-acetyl homoserine sulfhydrylase is derived from a microbial strain of the genus Leptospira, the genus Chromobacterium, or the genus Hyphomonas sp., more specifically, Leptospira meyeri, Pseudomonas aurogenosa, Hyphomonas Neptunium, and Chromobacterium Violaceum can be used.

[0151] The reaction is as follows:

[0152] CH3SH+O-acetylhomoserine<=>acetate+methionine

[0153] Korean Patent No. 10-0905381 discloses such an additional methionine production method, the disclosure of which is incorporated herein by reference in its entirety.

[0154] Another aspect of the present disclosure provides a composition for producing O-acetyl homoserine, the composition comprising the microorganism.

[0155] The microorganism and O-acetyl homoserine are as described above.

[0156] The composition of the present disclosure may further include any suitable excipients commonly used in compositions for producing O-acetyl homoserine, examples of which may include preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, isotonic agents, etc., but are not limited thereto.

[0157] Another aspect of the present disclosure provides use of the microorganism for producing O-acetyl homoserine or L-methionine.

[0158] [Mode for carrying out the invention]

[0159] The present disclosure will be described in more detail below by way of exemplary embodiments. However, the following exemplary embodiments are only for illustrating preferred embodiments of the present disclosure, and therefore are not intended to limit the scope of the present disclosure thereto. At the same time, those skilled in the art or similar technical fields to which the present disclosure belongs can fully understand and easily implement technical matters not described in this specification.

[0160] Example 1. Preparation of endogenous gene (NCgl0959) deletion strain and evaluation of O-acetyl homoserine and homoserine production capacity

[0161] Example 1-1. Preparation of a deletion vector for NCgl0959 deletion

[0162] In order to determine the effectiveness of the endogenous gene NCgl0959 in Corynebacterium glutamicum ATCC13032, a deletion vector was constructed in which the gene NCgl0959 (SEQ ID NO: 2) was deleted.

[0163] In detail, to construct the NCgl0959 deletion vector, a primer pair (SEQ ID NOS: 3 and 4) was designed to amplify the 5' upstream region, and a primer pair (SEQ ID NOS: 5 and 6) was designed to amplify the 3' downstream region, with the NCgl0959 gene of SEQ ID NO: 2 as the center. The primer sequences are shown in Table 1 below.

[0164] [Table 1]

[0165] SEQ ID NO. Sequence Name Sequence SEQ ID NO:3 0959_del upper F TGAATTCGAGCTCGGTACCCATCCACAGACGGTCATCGTG SEQ ID NO:4 0959_del upper R TTTGGTGgatatcCATGCACGCAATTGTCCTGG SEQ ID NO:5 0959_del lower F GTGCATGgatatcCACCAAATGGCAAGGATGCC SEQ ID NO:6 0959_del lower R GTCGACTCTAGAGGATCCCCGCAGAGATCGTTGATTCAAT

[0166] The chromosome of ATCC13032 wild type (WT) was used as a template, and PCR was performed with primers SEQ ID NO:3 and SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. The PCR conditions were 95°C denaturation for 5 minutes, followed by 30 cycles of 95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 72°C polymerization for 30 seconds, followed by 72°C polymerization for 7 minutes. As a result, a 1476bp 5' upstream region DNA fragment and a 1456bp 3' downstream region DNA fragment were obtained, centered on the NCgl0959 gene deletion site.

[0167] PCR was performed using the two amplified DNA fragments as templates and primers SEQ ID NO: 3 and SEQ ID NO: 6. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 2912 bp DNA fragment containing the NCgl0959 gene deletion site was amplified.

[0168] The pDCM2 vector (SEQ ID NO: 7, Korean Patent Publication No. 10-2020-0136813) was treated with SmaI, and the PCR product obtained above (2912 bp DNA fragment) and the pDCM2 vector treated with SmaI restriction enzyme were cloned using the Infusion HD cloning kit ( HD cloning kit, Clontech) for fusion cloning. The cloned vector was transformed into Escherichia coli DH5α, and the transformed Escherichia coli was inoculated into LB solid medium containing 25 mg / l kanamycin. After screening the colonies transformed with the plasmid from the LB solid medium, the plasmid was obtained using a plasmid extraction method (U.S. Patent No. US 5981235 A), and finally the pDCM2-ΔNCgl0959 recombinant vector was constructed, in which the NCgl0959 deletion box was cloned.

[0169] The constructed pDCM2-ΔNCgl0959 was transformed into the ATCC13032 strain using the electric pulse method, and through the secondary crossover process, ATCC13032ΔNCgl0959 was obtained, in which the NCgl0959 gene was deleted on the chromosome. The inactivation of the NCgl0959 gene was finally confirmed by PCR using primers SEQ ID NOS: 8 and 9, and then by comparison with ATCC13032 (in which the NCgl0959 gene was not inactivated).

[0170] [Table 2]

[0171] SEQ ID NO. Sequence Name Sequence SEQ ID NO:8 0959_del F GTGAAAAAACACTGGCAAAACAAGC SEQ ID NO:9 0959_del R ATAAGAGGCACTCCCACAGATCACA

[0172] Example 1-2. Evaluation of O-acetylhomoserine production capacity in wild-type strains

[0173] To compare the O-acetylhomoserine (O-AH) production capacities of ATCC13032ΔNCgl0959 prepared in Example 1-1 and the wild-type strain ATCC13032, O-acetylhomoserine in the culture medium was analyzed by culturing in the following manner.

[0174] One platinum loop of the strain was inoculated into a 250 ml corner-baffled flask containing 25 ml of the following medium and cultured with shaking at 200 rpm at 33 °C for 20 hours. The concentration of O-acetylhomoserine was analyzed by HPLC, and the analyzed concentrations are shown in Table 3.

[0175] <O-acetylhomoserine production medium (pH 7.2)>

[0176] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 ml) CSL (Sigma), 0.5 g MgSO4·7H2O, 20 g CaCO3 (based on 1 L of distilled water)

[0177] [Table 3]

[0178] (Results of the flask)

[0179] Strain O-AH (g / L) ATCC13032 0.27 ATCC13032ΔNCgl0959 0.30

[0180] As a result, as shown in Table 3 above, when ATCC13032 was cultured, 0.27 g / L of O-acetylhomoserine accumulated, and ATCC13032ΔNCgl0959 with the endogenous gene NCgl0959 deleted accumulated 0.30 g / L of O-acetylhomoserine, indicating a production capacity of 120% relative to the control ATCC 13032.

[0181] Example 2. Preparation of an NCgl0959-deleted strain with enhanced O-acetylhomoserine production capacity and evaluation of O-acetylhomoserine and homoserine production capacities - 1

[0182] Example 2-1. Preparation of the strain

[0183] The pDCM2-ΔNCgl0959 vector constructed in Example 1-1 was transformed into the KCCM12634P strain (KR 10-2182497, ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L)) with enhanced O-acetylhomoserine production ability by an electro-pulse method, and through a second exchange process, KCCM12634PΔNCgl0959 was obtained, in which the NCgl0959 gene was deleted from the chromosome. The inactivation of the NCgl0959 gene was finally confirmed by PCR using primers SEQ ID NOS: 8 and 9 and then by comparison with ATCC13032 (in which the NCgl0959 gene was not inactivated).

[0184] Example 2-2. Evaluation of O-acetylhomoserine production ability

[0185] To compare the O-acetylhomoserine (O-AH) production abilities of the KCCM12634P strain prepared in Example 2-1 and the KCCM12634PΔNCgl0959 strain, the O-acetylhomoserine in the culture medium was analyzed by culturing in the following manner.

[0186] One platinum loop of the strain was inoculated into a 250 ml baffled Erlenmeyer flask containing 25 ml of the following medium and cultured with shaking at 200 rpm at 33 °C for 20 hours. The concentration of O-acetylhomoserine was analyzed by HPLC, and the analyzed concentrations are shown in Table 4.

[0187] <O-acetylhomoserine production medium (pH 7.2)>

[0188] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 ml) CSL (Sigma), 0.5 g MgSO4·7H2O, 20 g CaCO3 (based on 1 L of distilled water)

[0189] [Table 4]

[0190] (Results of the flask)

[0191] Strain O-AH (g / L) KCCM12634P 1.05 KCCM12634PΔNCgl0959 1.31

[0192] As a result, as shown in Table 4 above, when NCgl0959 was deleted in the KCCM12634P strain, the O-acetylhomoserine was 1.31 g / L, indicating a production ability of about 130% relative to KCCM12634P. Therefore, the above results confirmed that the effect of enhanced O-acetylhomoserine production ability due to the deletion of NCgl0959 was greater in the strain with enhanced O-acetylhomoserine production ability.

[0193] Therefore, the results of Examples 1-2 and 2-2 confirmed that the deletion and inactivation of the NCgl0959 gene (the endogenous gene of ATCC13032 disclosed in the present invention) can improve the production capacity of the desired amino acids.

[0194] Example 3. Preparation of NCgl0959 deletion strain with enhanced O-acetyl homoserine production capacity and evaluation of O-acetyl homoserine and homoserine production capacity-2

[0195] Example 3-1. Preparation of strains-1

[0196] Use the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as template, obtain the metB gene of cystathionine gamma synthase in the degradation pathway of coding O-acetyl homoserine by PCR.Obtain the nucleotide sequence information (NCBI No.Ncgl2360, SEQ ID NO:11) of metB gene from National Institutes of Health (NIH) GenBank, synthesize the primer (SEQ ID NO:12 and 13) that contains metB gene N-terminal region and joint region and the primer (SEQ ID NO:14 and 15) that contains C-terminal region and joint region on this basis.Primer sequences are listed in the following table 5.

[0197] [Table 5]

[0198]

[0199]

[0200] PCR was performed using chromosomal DNA of ATCC13032 as a template and primers SEQ ID NOS: 12 and 13, SEQ ID NOS: 14 and 15. The polymerase used was PfuUltra TM High-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were 30 cycles of denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, a 558 bp amplified gene containing the N-terminal region and linker region of the metB gene and a 527 bp amplified gene containing the C-terminal region and linker region of the metB gene were obtained, respectively.

[0201] The two amplified genes obtained above were used as templates for PCR, and the PCR conditions were 96°C denaturation for 60 seconds, 50°C annealing for 60 seconds, and 72°C polymerization for 1 minute for 10 cycles, and then SEQ ID NOS: 12 and 15 were added, and the polymerization reaction was further repeated for 20 cycles. As a result, a 1064 bp inactivation box containing the N-terminus-linker-C-terminus of the metB gene was obtained.

[0202] The pDCM2 vector (SEQ ID NO: 7, Korean Patent Publication No. 10-2020-0136813) was treated with SmaI, and the PCR product (1064 bp) obtained above and the pDCM2 vector treated with SmaI restriction enzyme were cloned using the Infusion HD cloning kit ( HD cloning kit, Clontech) for fusion cloning. The cloned vector was transformed into Escherichia coli DH5α, and the transformed Escherichia coli was inoculated into LB solid medium containing 25 mg / l kanamycin. After screening the colonies transformed with plasmids from the LB solid medium, plasmids were obtained using a plasmid extraction method (U.S. Patent No. US 5981235 A), and finally a pDCM2-ΔmetB recombinant vector in which the metB gene deletion box was cloned was constructed.

[0203] The pDCM2-ΔmetB constructed was transformed into the KCCM12634P bacterial strain using the electric pulse method, and through the second exchange process, KCCM12634PΔmetB was obtained, in which the metB gene was deleted on the chromosome. The inactivated metB gene was then finally confirmed by comparing with ATCC13032 (wherein the metB gene was not inactivated) using the PCR of primer SEQ ID NOS:12 and 15.

[0204] Example 3-2. Preparation of strain-2

[0205] Using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the metY gene encoding the O-acetyl homoserine (thiol)-lyase in the O-acetyl homoserine degradation pathway was obtained by PCR. The nucleotide sequence information (NCBI No.Ncgl0625, SEQ ID NO:16) of the metY gene was obtained from the National Institutes of Health (NIH) GenBank, and primers (SEQ ID NO:17 and 18) containing the metY gene N-terminal region and the joint region and primers (SEQ ID NO:19 and 20) containing the C-terminal region and the joint region were synthesized on this basis. The primer sequences are shown in Table 6 below.

[0206] [Table 6]

[0207] SEQ ID NO. Sequence Name Sequence SEQ ID NO:17 metY_N_del F CCAAAGACAAGGAGACCA SEQ ID NO:18 metY_N_del R AGTCTATTTAAAGcccgggTTGGAGGTCCTTAAGAGTTTT SEQ ID NO:19 metY_C_del F TAAGGACCTCCAAcccgggCTTTAAATAGACTCACCCCAG SEQ ID NO:20 metY_C_del R ATGCCGAGTGCGTCGAGG

[0208] PCR was performed using chromosomal DNA of ATCC13032 as a template and primers SEQ ID NOS: 17 and 18, SEQ ID NOS: 19 and 20. The polymerase used was PfuUltra TMHigh-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were 30 cycles of denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, a 548bp amplified gene containing the N-terminal region and the linker region of the metY gene and a 550bp amplified gene containing the C-terminal region and the linker region of the metY gene were obtained, respectively. PCR was performed using the two amplified genes obtained above as templates, and the PCR conditions were 10 cycles of denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds, and polymerization at 72°C for 1 minute, and then SEQ ID NOS: 17 and 20 were added, and the polymerization reaction was further repeated for 20 cycles. As a result, a 1077bp inactivation box containing the N-terminus-linker-C-terminus of the metY gene was obtained.

[0209] The pDCM2 vector (SEQ ID NO: 7, Korean Patent Publication No. 10-2020-0136813) was treated with SmaI, and the PCR product (1077 bp) obtained above and the pDCM2 vector treated with SmaI restriction enzyme were cloned using the Infusion HD cloning kit ( HD cloning kit, Clontech) for fusion cloning. The cloned vector was transformed into Escherichia coli DH5α, and the transformed Escherichia coli was inoculated into LB solid medium containing 25 mg / l kanamycin. After screening the colonies transformed with the plasmid from the LB solid medium, the plasmid was obtained using a plasmid extraction method (U.S. Patent No. US 5981235 A), and finally the pDCM2-ΔmetY recombinant vector in which the metY gene deletion box was cloned was constructed.

[0210] The constructed pDCM2-ΔmetY vector was transformed into the strain KCCM12634PΔmetB prepared in Example 3-1 using the electric pulse method, and through the second exchange process, KCCM12634PΔmetBΔmetY was obtained, in which the metY gene was further inactivated on the chromosome. The inactivated metY gene was finally confirmed by PCR using primers SEQ ID NOS: 17 and 20, and then by comparison with ATCC13032 (in which the metY gene was not inactivated).

[0211] Example 3-3. Preparation of strains-3

[0212] In order to introduce mutation (L377K) (Korean Patent Publication No.10-2019-0003019) into the lysC gene (SEQ ID NO:21) encoding the aspartate kinase derived from Corynebacterium glutamicum ATCC13032 for enhancing the expression of lysC gene and removing the feedback inhibition of L-lysine and L-threonine, in order to construct a vector comprising mutant lysC gene, centered on the mutation site, designed primer pairs (SEQ ID NO:22 and 23) for amplifying 5' upstream regions and primer pairs (SEQ ID NO:24 and 25) for amplifying 3' downstream regions. Primer sequences are shown in Table 7 below.

[0213] [Table 7]

[0214]

[0215] PCR was performed using the chromosome of ATCC13032 as a template and primers SEQ ID NO:22 and SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25. PCR conditions were 95°C denaturation for 5 minutes, followed by 30 cycles of 95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 72°C polymerization for 30 seconds, followed by 72°C polymerization for 7 minutes. As a result, a 5' upstream region DNA fragment of 512 bp and a 3' downstream region DNA fragment of 522 bp were obtained with the lysC gene mutation site as the center.

[0216] PCR was performed using the two amplified DNA fragments as templates and using primers SEQ ID NO: 22 and SEQ ID NO: 25. The PCR conditions were 95° C. denaturation for 5 minutes, followed by 30 cycles of 95° C. denaturation for 30 seconds, 55° C. annealing for 30 seconds, and 72° C. polymerization for 60 seconds, followed by 72° C. polymerization for 7 minutes. As a result, a 1011 bp DNA fragment was amplified, which included a mutant lysC (L377K) gene encoding an aspartate kinase variant in which leucine at position 377 was replaced by lysine.

[0217] The pDCM2 vector (SEQ ID NO: 7, Korean Patent Publication No. 10-2020-0136813) was treated with SmaI, and the PCR product (1011 bp) obtained above and the pDCM2 vector treated with SmaI restriction enzyme were cloned using the Infusion HD cloning kit ( HD cloning kit, Clontech) for fusion cloning. The cloned vector was transformed into Escherichia coli DH5α, and the transformed Escherichia coli was inoculated into LB solid medium containing 25mg / l kanamycin. After screening out the bacterium transformed with plasmid from LB solid medium, plasmid extraction method (U.S. Patent No. US 5981235 A) was used to obtain plasmid, and finally constructed pDCM2-lysC (L377K) recombinant vector wherein cloned lysC (L377K) gene replacement cassette.

[0218] The pDCM2-lysC (L377K) carrier constructed was transformed into the KCCM12634PΔmetBΔmetY bacterial strain prepared in Example 3-2 using an electric pulse method, and by the second exchange process, Corynebacterium glutamicum KCCM12634PΔmetBΔmetY lysC (L377K) was obtained, wherein nucleotide mutations were introduced into the lysC gene on the chromosome. By using the PCR of primer SEQ ID NOS:22 and 25, the sequence alignment of the wild-type lysC gene was then finally confirmed to introduce the nucleotide mutation into the gene.

[0219] Example 3-4. Preparation of endogenous gene NCgl0959 deletion strain-1

[0220] In order to maximize the production of O-acetyl homoserine, the pDCM2-ΔNCgl0959 vector constructed in Example 1-1 was transformed into the KCCM12634PΔmetBΔmetY lysC (L377K) strain prepared in Example 3-3 using the electric pulse method, and then through the second exchange process, KCCM12634PΔmetBΔmetY lysC (L377K) ΔNCgl0959 was obtained, in which the NCgl0959 gene was deleted on the chromosome. The inactivation of the NCgl0959 gene was finally confirmed by PCR using primers SEQ ID NOS: 8 and 9, and then by comparison with ATCC13032 (in which the NCgl0959 gene was not inactivated).

[0221] Example 3-5. Preparation of endogenous gene NCgl0959 deletion strain-2

[0222] In order to amplify the gene encoding homoserine acetyltransferase (metX), the nucleotide sequence information of the MetX gene was obtained from the GenBank of the National Institutes of Health (NIH) of the United States (NCBI No. NCgl0624, SEQ ID NO: 26). On this basis, by inserting BamHI restriction enzyme sites at both ends, a primer pair (SEQ ID NO: 27 and 28) for amplification from the promoter region (about 300 bp upstream of the start codon) to the terminator region (about 100 bp downstream of the stop codon) was designed. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 1546 bp DNA fragment of the metX gene coding region was obtained. The pECCG117 (KR 10-0057684) vector and the metX DNA fragment were treated with the restriction enzyme BamHI and connected using DNA ligase. Then, cloning was performed to obtain a plasmid named pECCG117-metX WT. The primer sequences are shown in Table 8 below.

[0223] [Table 8]

[0224] SEQ ID NO. Sequence Name Sequence SEQ ID NO:27 metX F GGATCCCCTCGTTGTTCACCCAGCAACC SEQ ID NO:28 metX R GGATCCCAAAGTCACAACTACTTATGTTAG

[0225] The constructed pECCG117-metX WT vector was introduced into the KCCM12634PΔmetBΔmetY lysC (L377K) strain prepared in 3-3 and the KCCM12634PΔmetBΔmetY lysC (L377K) ΔNCgl0959 strain prepared in Example 3-4 by the electric pulse method, and then each was inoculated into LB solid medium containing 25 mg / l kanamycin to obtain the transformants KCCM12634PΔmetBΔmetY lysC (L377K) / pECCG117-metX WT and KCCM12634PΔmetBΔmetY lysC (L377K) ΔNCgl0959 / pECCG117-metX WT.

[0226] Example 3-6. Evaluation of O-acetyl homoserine production capacity

[0227] In order to compare the O-acetyl homoserine-producing abilities of the strains prepared in Examples 3-3 to 3-5, they were cultured in the following manner, and O-acetyl homoserine in the culture medium was analyzed.

[0228] Each strain was inoculated with a platinum loop into a 250 ml baffled Erlenmeyer flask containing 25 ml of the following medium and cultured with shaking at 200 rpm at 33 °C for 20 hours. The concentration of O-acetylhomoserine was analyzed by HPLC, and the analyzed concentrations are shown in Table 9.

[0229] <O-acetylhomoserine production medium (pH 7.2)>

[0230] 30 g glucose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g (10 ml) CSL (Sigma), 0.5 g MgSO4·7H2O, 400 mg methionine, 20 g CaCO3 (per 1 L of distilled water)

[0231] [Table 9]

[0232] Strain O-AH (g / L) KCCM12634PΔmetBΔmetY lysC(L377K) 1.30 KCCM12634PΔmetBΔmetY lysC(L377K)ΔNCgl0959 1.69 KCCM12634PΔmetBΔmetY lysC(L377K) / pECCG117-metX WT 2.10 KCCM12634PΔmetBΔmetY lysC(L377K)ΔNCgl0959 / pECCG117-metX WT 2.73

[0233] As a result, as shown in Table 9, when the control strain KCCM12634PΔmetBΔmetY lysC (L377K) was cultured, 1.3 g / L of O-acetylhomoserine was accumulated, and when KCCM12634PΔmetBΔmetY lysC (L377K)ΔNCgl0959 was cultured, 1.69 g / L of O-acetylhomoserine was accumulated, indicating a production capacity of approximately 130% relative to the control group. In addition, when the KCCM12634PΔmetBΔmetY lysC (L377K) / pECCG117-metX WT strain was cultured, 2.10 g / L of O-acetylhomoserine was accumulated, and when the KCCM12634PΔmetBΔmetY lysC (L377K)ΔNCgl0959 / pECCG117-metX WT strain was cultured, 2.73 g / L of O-acetylhomoserine was accumulated, indicating a production capacity of approximately 130% relative to the KCCM12634PΔmetBΔmetY lysC (L377K) / pECCG117-metX WT strain.

[0234] Therefore, it was confirmed that when the endogenous gene NCgl0959 was deleted and inactivated in a strain with enhanced O-acetyl-L-homoserine production capacity, the production capacity of the desired amino acid could be further improved.

[0235] Based on the above description, it will be appreciated by those skilled in the art that the present disclosure can be implemented in different specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the above-mentioned embodiments are not restrictive, but illustrative in all respects. The scope of the present disclosure is limited by the appended claims rather than by the description before them, so all changes and modifications falling within the boundaries and scope of the claims, or the equivalent replacements of these boundaries and scopes, are covered by the claims.

Claims

1. A Corynebacterium microorganism having an ability to produce O-acetylhomoserine, wherein the activity of a GNAT family N-acetyltransferase protein is attenuated. 2 . The Corynebacterium microorganism according to claim 1 , wherein the Corynebacterium microorganism is Corynebacterium glutamicum . 3 . The Corynebacterium microorganism according to claim 1 , wherein the GNAT family N-acetyltransferase is a protein consisting of the amino acid sequence of SEQ ID NO:

1. The Corynebacterium microorganism according to claim 1 , wherein the attenuation is inactivation. The Corynebacterium microorganism according to claim 1 , wherein the nucleotide sequence of SEQ ID NO: 2 is deleted.

6. The Corynebacterium microorganism according to claim 1, wherein the activity of the L-methionine / branched-chain amino acid exporter YjeH protein is further enhanced. 7 . The Corynebacterium microorganism according to claim 6 , wherein the amino acid sequence of SEQ ID NO: 10 is introduced.

8. A method for producing O-acetyl homoserine, comprising the step of culturing a microorganism of the genus Corynebacterium having an O-acetyl homoserine-producing ability in a culture medium in which the activity of a GNAT family N-acetyltransferase protein is attenuated.

9. A method for producing L-methionine, comprising the steps of: Cultivating a Corynebacterium microorganism having an ability to produce O-acetylhomoserine in a culture medium in which the activity of a GNAT family N-acetyltransferase protein is attenuated; Producing O-acetyl homoserine from a cultured microorganism or culture medium; and Converts O-acetyl homoserine to L-methionine.

Images