Application of taxus chinensis extracellular vesicles in preparation of medicine for preventing and / or treating inflammation, method and medicine composition

Abstract

The invention relates to the field of genetic engineering and life science, in particular to application of taxus chinensis extracellular vesicles in preparation of drugs for preventing and / or treating inflammation, a method and a pharmaceutical composition. It is found for the first time that the taxus chinensis extracellular vesicles protect cells from being damaged by lipopolysaccharide by inhibiting expression of pro-inflammatory cytokines, so that the effect of resisting cell inflammation is achieved, and the taxus chinensis extracellular vesicles can be used as a medicine for preventing and / or treating colitis.

Description

Technical Field

[0001] The present application relates to the fields of genetic engineering and life sciences, and specifically to the use, method, and pharmaceutical composition of Taxus chinensis extracellular vesicles in preparing drugs for preventing and / or treating inflammation. Background Art

[0002] Ulcerative colitis is an intestinal inflammatory disease of the colon or rectal mucosa and submucosa, the etiology of which is not yet clear. Symptoms of ulcerative colitis include diarrhea, rectal bleeding, abdominal pain and weight loss. The incidence of ulcerative colitis in Europe and the United States is about 40-100 / 100,000 / year, and there are no complete epidemiological statistics in China. Ulcerative colitis generally has persistent or recurrent diarrhea, mucus, pus and blood in the stool, accompanied by abdominal pain, tenesmus and systemic symptoms of varying degrees in different parts of the body. The course of the disease is usually more than 4 to 6 weeks (clinically, it often takes more than 2 months from the onset of symptoms to diagnosis), and may be accompanied by extraintestinal manifestations such as joints, skin, eyes, mouth and liver and gallbladder (such as arthritis, oral ulcers, erythema nodosum and iritis). It is difficult to cure the disease, and the recurrence rate is high, affecting millions of people worldwide every year. Therefore, exploring suitable drugs for the prevention and treatment of ulcerative colitis has important scientific value and social significance.

[0003] Conventional treatments for ulcerative colitis include immunosuppressants, aminosalicylic acid, and some biologics designed to reduce inflammation. Although these drugs have certain therapeutic effects, they also have strong toxic side effects on healthy organs, such as allergic reactions, nausea, and liver toxicity, which limits their clinical application.

[0004] In recent years, nanoscale extracellular vesicle therapeutic drugs targeting colitis tissues have received extensive attention, especially plant-derived extracellular vesicles, which have potential applications in the prevention and treatment of ulcerative colitis. Extracellular vesicles with a diameter of about 200 nm are natural nanoscale vesicles released from cells after the fusion of multivesicular bodies in eukaryotic cells with the plasma membrane. Naturally derived extracellular vesicles contain rich biological functional molecules, have good biosafety, and have the potential for large-scale production. Therefore, exploring the preventive and therapeutic functions of plant extracellular vesicles for colon diseases has attracted more and more attention from researchers. Studies have shown that extracellular vesicles derived from grapes and grapefruit have the effect of targeting intestinal cells and can play a role in dextran sulfate sodium-induced colitis in mice. Garlic-derived extracellular vesicles treat colitis by downregulating proinflammatory cytokines and regulating intestinal microbiota. Studies have found that edible extracellular vesicles derived from purslane can alleviate dextran sulfate sodium-induced colitis in mice by promoting the expansion of T cells.

[0005] Taxus is a precious tree species on the verge of extinction in the world and is listed as a first-class protected plant in my country. Its bark contains a terpenoid compound, paclitaxel, which is listed in the National Essential Medicines List 2018 as an anti-tumor drug. Since the content of paclitaxel in its bark is very low, direct extraction, chemical synthesis, and fermentation methods have certain disadvantages. Therefore, it is of great practical significance to develop more bioactive molecules in Taxus. Through the combination of chromatography and mass spectrometry, it was detected that Taxus contains a variety of metabolites with antibacterial, antioxidant and anticancer biological activities, such as dodecanol and fosfomycin, which have antibacterial activity, L-malic acid and tartaric acid can effectively inhibit the oxidation of free radicals, and 2,3-dihydroxybenzoic acid and salicin have significant anti-cancer effects. At present, it is unclear what the effect and mechanism of Taxus on ulcerative colitis are. Summary of the invention

[0006] The purpose of the present invention is to provide the use of Taxus extracellular vesicles in the preparation of a drug for preventing and / or treating ulcerative colitis. Taxus extracellular vesicles can inhibit the progression of ulcerative colitis at both the cellular level and the tissue level, thereby effectively treating colitis.

[0007] The present invention solves the technical problem by adopting the following technical solutions:

[0008] In a first aspect, the present invention provides use of Taxus chinensis extracellular vesicles in the preparation of a medicament for preventing and / or treating inflammation.

[0009] In some embodiments of the present invention, Taxus chinensis extracellular vesicles are used in the preparation of a drug for preventing and / or treating intestinal inflammation.

[0010] In some embodiments of the present invention, the Taxus chinensis extracellular vesicles are used in the preparation of a drug for preventing and / or treating colon inflammation.

[0011] In some embodiments of the present invention, the Taxus chinensis extracellular vesicles are used in the preparation of a drug for preventing and / or treating ulcerative colitis.

[0012] The present invention relates to the use of yew extracellular vesicles in the preparation of drugs for preventing and treating ulcerative colitis. The present invention belongs to the field of biomedicine technology, and discloses the use of yew extracellular vesicles in the preparation of drugs for preventing and / or treating ulcerative colitis. The present invention first discovered that yew extracellular vesicles protect cells from the destruction of bacterial lipopolysaccharide by inhibiting the expression of proinflammatory cytokines, thereby achieving the effect of resisting cell inflammation, and can be used as a drug for preventing and / or treating colon inflammation. The present invention found that for a mouse colitis model induced by sodium dextran sulfate, yew extracellular vesicle intervention can significantly increase the weight and colon length of mice, alleviate the degree of blood in the stool of mice, and thus reduce the disease activity index of mice. At the same time, yew extracellular vesicle intervention can significantly improve colon tissue pathological changes and reduce the expression of serum proinflammatory cytokines. The present invention provides a drug containing yew extracellular vesicles or related biomaterials. Compared with traditional therapeutic drugs, the drug has good biosafety and therapeutic effect, can be absorbed orally, and can also be used as a drug delivery system to load targeted drugs, thereby improving the efficiency of ulcerative colitis treatment.

[0013] In some embodiments of the present invention, the Taxus chinensis extracellular vesicles are used in the preparation of a drug for treating ulcerative colitis.

[0014] Ulcerative colitis includes acute colitis and chronic colitis, and the ulcerative colitis treatment drug has at least one of the following functions:

[0015] (1) Inhibit the disease activity of ulcerative colitis;

[0016] (2) Improve pathological damage to intestinal tissues in ulcerative colitis;

[0017] (3) Inhibit intestinal inflammatory response in ulcerative colitis.

[0018] The second aspect of the present invention provides a method for preparing extracellular vesicles of Taxus chinensis, comprising the following steps:

[0019] Step 1: clean the fresh yew branches and leaves with PBS buffer, grind them into a homogenate, filter through a gauze to remove the yew residue, and obtain filtrate A;

[0020] Step 2: centrifuge the filtrate A at low speed, medium speed and high speed in sequence under low temperature to obtain supernatant B;

[0021] Step 3, filtering the supernatant B through a filter membrane and centrifuging again to obtain a precipitate C;

[0022] Step 4: resuspend the precipitate C with a sterilized PBS solution to obtain the extracellular vesicles of Taxus chinensis.

[0023] In some embodiments of the present invention, the Taxus chinensis extracellular vesicles are double-membrane structures under a transmission electron microscope, mostly in the shape of round cakes, and the particle size of the Taxus chinensis extracellular vesicles is about 200 nm.

[0024] In some embodiments of the present invention, the low temperature condition in step 2 is 0-10°C; the centrifugal force of the low-speed centrifugation is 800-1500rpm, and the centrifugation time is 15-30min; the centrifugal force of the medium-speed centrifugation is 2500-4000rpm, and the centrifugation time is 25-40min; the centrifugal force of the high-speed centrifugation is 9000-12000rpm, and the centrifugation time is 40-60min.

[0025] In some embodiments of the present invention, the low temperature condition in step 2 is 0-10°C; the centrifugal force of the low-speed centrifugation is 900-1200rpm, and the centrifugation time is 18-25min; the centrifugal force of the medium-speed centrifugation is 2800-3500rpm, and the centrifugation time is 28-35min; the centrifugal force of the high-speed centrifugation is 9500-11000rpm, and the centrifugation time is 45-55min.

[0026] In some embodiments of the present invention, the centrifugal force of the centrifugation in step three is 100,000 to 120,000 rpm, and the centrifugation time is 80 to 100 min.

[0027] In some embodiments of the present invention, the yew branches and leaves include leaves and / or stems.

[0028] The third aspect of the present invention provides a pharmaceutical composition, comprising:

[0029] The above-mentioned Taxus chinensis extracellular vesicles; and

[0030] One or more pharmaceutically acceptable carriers and / or excipients.

[0031] In some embodiments of the present invention, the dosage form of the pharmaceutical composition includes at least one of tablets, capsules, pills, powders, granules, suspensions, oral solutions, injections or rectal preparations.

[0032] The present invention includes the following beneficial effects:

[0033] Through the above technical scheme, the present invention provides the use of yew extracellular vesicles in the preparation of drugs for preventing and / or treating ulcerative colitis. The yew extracellular vesicles can inhibit the progression of inflammation at both the cellular level and the tissue level, thereby inhibiting the development of ulcerative colitis.

[0034] The present invention discovers for the first time that the yew extracellular vesicles protect cells from the destruction of bacterial lipopolysaccharide by inhibiting the expression of pro-inflammatory cytokines, thereby achieving the effect of resisting cellular inflammation, and can be used as a drug for preventing and / or treating colon inflammation.

[0035] The present invention found that for the mouse colitis model induced by sodium dextran sulfate, intervention with yew extracellular vesicles can significantly reduce the disease activity index of mice, increase the weight and colon length of mice, and at the same time, intervention with yew extracellular vesicles can significantly improve colon tissue pathological changes and reduce the expression of serum proinflammatory cytokines.

[0036] The present invention provides a drug containing yew extracellular vesicles or related biomaterials. Compared with traditional therapeutic drugs, the drug has good biosafety and therapeutic effect, can be absorbed orally, and can also be used as a drug delivery system to load targeted drugs, thereby improving the efficiency of inflammatory bowel disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is an electron micrograph of the extracellular vesicles (LNVs) isolated from the leaves of Taxus chinensis provided in Example 1 of the present invention.

[0038] Figure 2 This is an electron micrograph of the extracellular vesicles (SNVs) isolated from the stems and branches of Taxus chinensis provided in Example 1 of the present invention.

[0039] Figure 3 This is a statistical diagram of the nanoparticle size of extracellular vesicles (LNVs) isolated from the leaves of Taxus chinensis provided in Example 1 of the present invention.

[0040] Figure 4 This is a statistical diagram of the nanoparticle sizes of extracellular vesicles (SNVs) isolated from the stems and branches of Taxus chinensis provided in Example 1 of the present invention.

[0041] Figure 5 This is the overall distribution diagram of extracellular vesicles in mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0042] Figure 6 This is the distribution diagram of extracellular vesicles in the digestive tract of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0043] Figure 7 This is the distribution diagram of extracellular vesicles in the colon of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0044] Figure 8This is a statistical graph of the relative fluorescence intensity of extracellular vesicles accumulated in the colon of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0045] Fig. 9 This is the toxicity analysis of the yew extracellular vesicles provided in Example 3 of the present invention on human macrophages (THP-1), wherein A is the toxicity analysis of different concentrations of LNVs on THP-1 cells; B is the toxicity analysis of different concentrations of SNVs on THP-1 cells.

[0046] Fig.10 This is an analysis of the effect of Taxus chinensis extracellular vesicles on THP-1 cell activity provided in Example 3 of the present invention, wherein A is an analysis of the effect of different concentrations of LNVs on THP-1 cell activity; B is an analysis of the effect of different concentrations of SNVs on THP-1 cell activity.

[0047] Fig.11 Schematic diagram of the colitis modeling and Taxus chinensis extracellular vesicles treatment process for each group of mice provided in Example 4 of the present invention.

[0048] Fig.12 The changes in mouse body weight during the mouse colitis modeling and Taxus chinensis extracellular vesicle treatment provided in Example 4 of the present invention.

[0049] Fig.13 This is the change in the disease activity index (DAI) of mice during the mouse colitis modeling and Taxus extracellular vesicle treatment provided in Example 4 of the present invention.

[0050] Fig.14 This is a diagram of the colon phenotype of mice after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0051] Fig.15 This is a statistical graph of the colon length of mice after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0052] Fig.16 This is a pathological image of mouse colon tissue after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0053] Fig.17 This is a statistical graph of pathological scores of mouse colon tissue after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0054] Fig.18 The effects of the extracellular vesicles of Taxus chinensis provided in Example 4 of the present invention on inflammatory factors in mouse serum, wherein A is the expression of the inflammatory factor IL-1β; B is the expression of the inflammatory factor IL-6; and C is the expression of the inflammatory factor TNF-α.

[0055] Fig.19 This is an analysis of the effect of the yew extracellular vesicles provided in Example 3 of the present invention on the expression of inflammatory factors in THP-1 cells, wherein A is the expression of the inflammatory factor IL-6; B is the expression of the inflammatory factor IL-8; C is the expression of the inflammatory factor IL-10; and D is the expression of the inflammatory factor TNF-α.

[0056] Unless stated to the contrary, the terms used in the specification and claims have the following meanings.

[0057] As used herein, the term "prevention" refers to preventing the occurrence of a disease and / or preventing the recurrence of a disease. DETAILED DESCRIPTION

[0058] The present invention specification describes the specific implementation scheme in detail. Those skilled in the art should recognize that the following implementation scheme is exemplary and cannot be understood as limiting the present invention. For those skilled in the art, without departing from the principle of the present invention, by making several improvements and modifications to the present invention, the technical solutions obtained by these improvements and modifications also fall within the protection scope of the claims of the present invention. The following examples specifically illustrate the beneficial effects of the present invention.

[0059] The present invention is further described in detail by way of examples. The raw materials used in the examples can be obtained through commercial sources.

[0060] Example 1

[0061] Isolation of plant extracellular vesicles with vesicle structure from Taxus chinensis

[0062] 1. Experimental instruments

[0063] The nanoparticle tracking analyzer (Particle Metrix) is produced by Meerbusch, Germany.

[0064] Transmission electron microscope (Japan JEM-1400) was provided by Chengdu Xuhai Rundong Biotechnology Co., Ltd.

[0065] Ultracentrifuge (L-100XP) was produced by Beckman Company, USA.

[0066] 2. Separation method

[0067] Freshly picked yew leaves and stems from the Botanical Garden of Sichuan University of Chinese Medicine were used to separate yew extracellular vesicles (LNVs and SNVs) by differential centrifugation. LNVs are extracellular vesicles (LNVs) isolated from yew leaves, and SNVs are extracellular vesicles isolated from yew stems. The specific steps are as follows: after washing with PBS, the yew fruit was ground into a homogenate in a mortar, centrifuged at 1000rpm for 20min, 3000rpm for 30min, and 10000rpm for 50min, the supernatant was filtered through a 0.2-0.5μm filter membrane and centrifuged at 110000rpm for 90min, and the precipitate was resuspended in PBS to obtain yew extracellular vesicles.

[0068] 3. Experimental results

[0069] ①. Electron microscope observation

[0070] Figure 1 This is an electron micrograph of the extracellular vesicles (LNVs) isolated from the leaves of Taxus chinensis provided in Example 1 of the present invention.

[0071] Figure 2 This is an electron micrograph of the extracellular vesicles (SNVs) isolated from the stems and branches of Taxus chinensis provided in Example 1 of the present invention.

[0072] Electron microscopic observations revealed that the yew extracellular vesicles contained a typical lipid bilayer membrane structure, which was round and about 200 nm in size, consistent with the characteristics of plant extracellular vesicles ( Figure 1 and Figure 2 , LNVs are extracellular vesicles derived from Taxus leaves, and SNVs are extracellular vesicles derived from red Taxus stems and branches).

[0073] ②. Nanoparticle tracking analysis

[0074] Figure 3 This is a statistical diagram of the nanoparticle size of extracellular vesicles (LNVs) isolated from the leaves of Taxus chinensis provided in Example 1 of the present invention.

[0075] Figure 4 This is a statistical diagram of the nanoparticle sizes of extracellular vesicles (SNVs) isolated from the stems and branches of Taxus chinensis provided in Example 1 of the present invention.

[0076] The particle size of extracellular vesicles was measured by nanoparticle tracking analysis technology, and it was found that the average particle size of the extracellular vesicles was 149nm and 148nm, respectively, mainly distributed in the range of 100-300nm, which is consistent with the results of electron microscopy observations.

[0077] This indicates that plant extracellular vesicles with vesicle structure can be isolated from Taxus chinensis by the above method.

[0078] Example 2

[0079] Investigating the targeting ability of Taxus chinensis extracellular vesicles to the mouse colon

[0080] 1. Animals and consumables

[0081] The experimental animals were C57BL / 6 mice, 4 weeks old, weighing 18-21 g, male, provided by Chengdu Dashuo Experimental Animal Co., Ltd.

[0082] Dextran sulfate sodium (DSS, 9011-18-1) used in the experiment was purchased from MP Biochemical Company, USA.

[0083] The reagent DiR (CAS22070) was purchased from AAT Bioquest, USA.

[0084] Serum cytokine interleukin (IL)-1β, IL-6 and tumor necrosis factor (TNF)-α detection kits were purchased from Shenzhen Xinbosheng Biotechnology Co., Ltd.

[0085] The IVIS system is produced by PerkinElmer in the United States.

[0086] 2. Experimental Grouping

[0087] The experimental animals were equally divided into three groups, namely, control group (Control), LNVs group and SNVs group.

[0088] 3. Experimental Procedure

[0089] In order to verify whether the extracellular vesicles of Taxus chinensis can be taken up by the colon, 1 mg / mL of Taxus chinensis extracellular vesicles were labeled with 1 μM / L fluorescent dye DiR (red), and mice were orally gavaged with 1 mg / Kg of Taxus chinensis extracellular vesicles (LNVs or SNVs). After the mice were allowed to move normally for 2 hours, the uptake was observed using the IVIS system.

[0090] 4. Experimental Results

[0091] Absorption of Taxus chinensis extracellular vesicles in the intestine of mice after oral administration Figure 5-8 shown.

[0092] Figure 5 This is the overall distribution diagram of extracellular vesicles in mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0093] Figure 6 This is the distribution diagram of extracellular vesicles in the digestive tract of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0094] Figure 7This is the distribution diagram of extracellular vesicles in the colon of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0095] Figure 8 This is a statistical graph of the relative fluorescence intensity of extracellular vesicles accumulated in the colon of mice 2 hours after oral administration of LNVs and SNVs to experimental animals in Example 2 of the present invention.

[0096] The results showed that compared with the control group, 2 hours after oral administration of extracellular vesicles, a large amount of red fluorescence, namely DiR-labeled extracellular vesicles, was observed in the gastrointestinal tract of mice, especially in the colon, indicating that both types of Taxus chinensis extracellular vesicles (LNVs and SNVs) isolated by us can be targeted to the colon, laying the foundation for their anti-inflammatory function.

[0097] Studies have shown that targeted absorption of plant extracellular vesicles by the colon is the basis of their function.

[0098] Example 3

[0099] Investigating the effects of Taxus chinensis extracellular vesicles on human macrophages

[0100] 1. Experimental instruments and consumables

[0101] The macrophages used in the experiment were purchased from Wuhan Pronocell Life Science Co., Ltd.

[0102] Lipopolysaccharide (LPS, L2630) was purchased from Sigma, USA.

[0103] CCK8 cell proliferation detection kit (C0037) was purchased from Shanghai Biotech Biotechnology Co., Ltd.

[0104] Total RNA extraction kit (MiPure Cell / Tissue miRNA Kit, RC201), reverse transcription kit ( III RT SuperMix for qPCR, R323-01) and gene expression quantitative PCR kit (ChamQ Universal SYBR qPCR Master Mix, Q711-02 / 03) were purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0105] 2. Experimental process

[0106] Macrophages cultured to the logarithmic growth phase were inoculated in 96-well plates (40,000 cells per well), and different concentrations of Taxus extracellular vesicles (LNVs or SNVs) were added. After co-culture for 48 hours, the absorbance of each well was detected by the CCK8 kit for cytotoxicity analysis; for the anti-inflammatory efficacy experiment, macrophages were co-cultured with different concentrations of Taxus extracellular vesicles (LNVs or SNVs) in 96-well plates for 24 hours, 1 μg / mL LPS was added and cultured again for 24 hours, and the absorbance of each well was detected by the CCK8 kit for anti-inflammatory effect analysis; for the expression analysis of cellular inflammatory factors, macrophages were inoculated in 6-well plates (500,000 cells per well), co-cultured with 10 μg / mL Taxus extracellular vesicles (LNVs or SNVs) for 24 hours, 1 μg / mL LPS was added and cultured again for 24 hours, and then the cells were collected, total RNA was extracted and reverse transcribed, and gene expression was detected using a quantitative PCR kit.

[0107] 3. Experimental results

[0108] To elucidate whether ZbELNs have a regulatory effect on macrophages after being taken up by THP-1, we analyzed the effect of Taxus chinensis extracellular vesicles on THP-1 proliferation.

[0109] 1. Security Analysis

[0110] Fig. 9 This is the toxicity analysis of the yew extracellular vesicles provided in Example 3 of the present invention on human macrophages (THP-1), wherein A is the toxicity analysis of different concentrations of LNVs on THP-1 cells; B is the toxicity analysis of different concentrations of SNVs on THP-1 cells.

[0111] like Fig. 9 As shown, different concentrations of extracellular vesicles had no significant effect on the proliferation and toxicity of macrophages (LNV-1 or SNV-1 represents 1 μg / mL, LNV-5 or SNV-5 represents 5 μg / mL, LNV-10 or SNV-10 represents 10 μg / mL, and LNV-20 or SNV-20 represents 20 μg / mL). This indicates that the extracellular vesicles isolated from Taxus chinensis have good biosafety for human cells.

[0112] 2. Analysis of anti-inflammatory efficacy

[0113] THP-1 cells were pretreated with different concentrations of Taxus chinensis extracellular vesicles (LNVs or SNVs) for 24 h and then treated with 1 μg / mL LPS for 24 h to induce macrophage inflammation and reduce cell viability.

[0114] ①. Analysis of the effect on THP-1 cell activity

[0115] Fig.10 This is an analysis of the effect of Taxus chinensis extracellular vesicles on THP-1 cell activity provided in Example 3 of the present invention, wherein A is an analysis of the effect of different concentrations of LNVs on THP-1 cell activity; B is an analysis of the effect of different concentrations of SNVs on THP-1 cell activity.

[0116] The experiment found that compared with the PBS-treated control group, the viability of THP-1 cells pre-treated with extracellular vesicles was restored to a certain extent, and the cell viability increased with the increase of drug pretreatment concentration (P<0.01). This shows that the yew extracellular vesicles can partially offset the trend of LPS-induced cell viability reduction. According to the results of the concentration gradient experiment, we subsequently used a concentration of 10 μg / mL of extracellular vesicles as the effective drug concentration for cell experiments ( Fig.10 ).

[0117] ②. Analysis of cellular inflammatory factor expression

[0118] We analyzed the gene expression of cellular inflammatory factors IL-1β, IL-6, IL-8, IL-10, TNF-α and COX-2. The primers related to gene expression detection are shown in Table 1.

[0119] Table 1 Primer sequences related to gene expression detection in Example 3

[0120] SEQ ID No name Primer sequences 1 LP-IL-6 AGCCACTCACCTCTTCAGAAC 2 RP-IL-6 GCCTCTTTGCTGCTTTCACAC 3 LP-IL-8 CTGATTTCTGCAGCTCTGTGT 4 RP-IL-8 GGGTGGAAAGGTTTGGAGTATG 5 LP-IL-10 GTGATGCCCCAAGCTGAGA 6 RP-IL-10 CACGGCCTTGCTCTTGTTTT 7 LP-TNF-α CTGCTGCACTTTGGAGTGAT 8 RP-TNF-α AGATGATCTGACTGCCTGGG 9 LP-GAPDH AAGGTCATCCATGACAACTTTGGC 10 LP-GAPDH ACAGTCTTCTGGGTGGCAGTGAT

[0121] Fig.19 This is an analysis of the effect of the yew extracellular vesicles provided in Example 3 of the present invention on the expression of inflammatory factors in THP-1 cells, wherein A is the expression of the inflammatory factor IL-6; B is the expression of the inflammatory factor IL-8; C is the expression of the inflammatory factor IL-10; and D is the expression of the inflammatory factor TNF-α.

[0122] The results showed that Taxus chinensis extracellular vesicles could significantly reduce the expression of these cytokines (P<0.05, P<0.01), indicating that Taxus chinensis extracellular vesicles could alleviate the inflammatory response of macrophages.

[0123] Example 4

[0124] Investigating the therapeutic effect of Taxus chinensis extracellular vesicles on colitis in mice

[0125] 1. Experimental Procedure

[0126] 1. Experimental Grouping

[0127] Twenty-five C57BL / 6J mice were randomly divided into a normal control group, a DSS model group (PBS group), and a Taxus chinensis extracellular vesicle treatment group (LNVs and SNVs groups), with 5 mice in each group.

[0128] 2. Treatment options

[0129] The treatment group was given LNVs and SNVs two kinds of Taxus cuspidatum extracellular vesicles by gavage intervention (once a day, 1 mg / Kg each time), and the model group was given an equal volume of PBS solution. After the 17th day, all mice were anesthetized and killed, and serum and colon tissue were collected to detect the expression levels of proinflammatory cytokines IL-1β, IL-6 and TNF-α in serum, and colon tissue pathology (H&E) analysis was performed. SPSS25 software was used for statistical analysis of the data, and non-parametric tests were used for quantitative data. The data were expressed as s. One-way ANOVA combined with LSD multiple comparison analysis was used for multiple comparison analysis between groups, and P < 0.05 was considered statistically significant.

[0130] Fig.11 Schematic diagram of the colitis modeling and Taxus chinensis extracellular vesicles treatment process for each group of mice provided in Example 4 of the present invention.

[0131] 2. Experimental results

[0132] 1. Effect of Taxus chinensis extracellular vesicles on body weight of mice

[0133] After the model was established, the body weight of mice was measured once a day. Fig.12 The changes in mouse body weight during the mouse colitis modeling and Taxus chinensis extracellular vesicle treatment provided in Example 4 of the present invention.

[0134] The results showed that 4 days after modeling, the body weight of the DSS-treated model group gradually decreased. Starting from the 7th day, the body weight of the model group mice was significantly lower than that of the control group (P<0.01). At the same time, the body weight of the mice treated with yew extracellular vesicles was gradually restored. Starting from the 8th day, the weight gain of the mice in the treatment group was significantly greater than that in the untreated group (P<0.05, P<0.01). This shows that the intervention of yew extracellular vesicles significantly increased the body weight of colitis mice, thereby alleviating the pathological symptoms of the mice.

[0135] 2. Effect of Taxus EVs on Disease Activity Index (DAI) in Mice

[0136] The main function of the colon is to absorb water and electrolytes, and to form, store, and excrete feces. If the colon is inflamed and dysfunctional, the mice will lose weight, have more fecal water, produce loose stools, and have damaged colonic barriers, leading to intestinal edema, bleeding, and bloody stools. Combining the above three factors, we used the DAI score to reflect the severity of colitis in mice, evaluate the condition, and investigate the therapeutic effects of intervention drugs (Table 2).

[0137] Table 2 Determination method of disease activity index (DAI) in mice

[0138]

[0139]

[0140] Fig.13 This is the change in the disease activity index (DAI) of mice during the mouse colitis modeling and Taxus extracellular vesicle treatment provided in Example 4 of the present invention.

[0141] In this example, compared with the control group, the mice in the model group lost weight significantly, had more severe loose stools and bloody stools, and the DAI was significantly increased (P<0.01). Compared with the model group, the loose stools and bloody stools in the Taxus chinensis extracellular vesicle treatment group were alleviated to a certain extent, and the DAI was significantly reduced (P<0.05, P<0.01).

[0142] 3. Effects of Taxus chinensis extracellular vesicles on mouse colon

[0143] Fig.14 This is a diagram of the colon phenotype of mice after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0144] Fig.15 This is a statistical graph of the colon length of mice after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0145] Effect of Taxus extracellular vesicles on colon phenotype: When mice develop colitis, in addition to weight loss, loose stools and bloody stools, they also suffer from symptoms of shortened colons. The colon of the model group was dark brown due to colon damage and congestion, and the length was significantly shorter than that of the control group (P<0.01). In the Taxus extracellular vesicle treatment group, the colon congestion of mice was significantly alleviated, and the colon length was restored to a certain extent (P<0.01). This shows that Taxus extracellular vesicles can effectively treat DSS-induced colon damage.

[0146] 4. Effects of Taxus chinensis extracellular vesicles on colon histology in mice

[0147] To assess the severity of histological damage in colitis, a small piece of colon (0.5 cm) was excised, placed in a tissue cassette, and immersed in a 10% formalin solution. Subsequently, 5 μm paraffin-embedded sections were prepared and stained with hematoxylin- I Red staining (H&E) stained sections were used to observe the pathological changes of colon tissue. The colon histochemical scoring method is shown in Table 3.

[0148] Table 3 Colon histochemistry scoring method

[0149]

[0150] Fig.16 This is a pathological image of mouse colon tissue after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0151] Fig.17 This is a statistical graph of pathological scores of mouse colon tissue after treatment with Taxus chinensis extracellular vesicles provided in Example 4 of the present invention.

[0152] The results showed that compared with the control group, the colon tissue of the mice in the model group showed muscle thickening and crypt distortion, with a higher density of inflammatory infiltration and a significantly higher histochemical score than the control group (P<0.01); compared with the model group, the pathological damage of the colon tissue of the mice in the Taxus chinensis extracellular vesicle treatment group was significantly alleviated, and the histochemical score was restored to a certain extent (P<0.01). This indicates that Taxus chinensis extracellular vesicles can effectively alleviate the colon tissue damage caused by colitis.

[0153] 5. Effects of Taxus chinensis extracellular vesicles on pro-inflammatory cytokines in mouse serum

[0154] During colitis in mice, neutrophils are often activated in inflamed intestinal sites, a process that may be accompanied by an increase in the levels of typical pro-inflammatory cytokines.

[0155] Fig.18 The effects of the extracellular vesicles of Taxus chinensis provided in Example 4 of the present invention on inflammatory factors in mouse serum, wherein A is the expression of the inflammatory factor IL-1β; B is the expression of the inflammatory factor IL-6; and C is the expression of the inflammatory factor TNF-α.

[0156] Compared with the control group, the expression levels of serum IL-1β, IL-6 and TNF-α in the model group were significantly increased (P<0.01); compared with the model group, the Taxus chinensis extracellular vesicles intervention group could significantly reduce the expression of these cytokines (P<0.01).

[0157] The above experiments indicate that the yew extracellular vesicles have a good therapeutic effect on ulcerative colitis and can be used to prepare drugs for treating or preventing ulcerative colitis.

[0158] The specification of the present invention describes the specific implementation scheme in detail. Those skilled in the art should recognize that the above implementation scheme is exemplary and cannot be understood as limiting the present invention. For those skilled in the art, without departing from the principle of the present invention, by making several improvements and modifications to the present invention, the technical solutions obtained by these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. Application of Taxus chinensis extracellular vesicles in the preparation of drugs for preventing and / or treating inflammation.

2. The use according to claim 1, characterized in that: Application of Taxus chinensis extracellular vesicles in the preparation of drugs for preventing and / or treating intestinal inflammation.

3. The use according to claim 1, characterized in that: Application of Taxus chinensis extracellular vesicles in the preparation of drugs for preventing and / or treating colon inflammation.

4. The use according to claim 1, characterized in that: Application of Taxus chinensis extracellular vesicles in the preparation of drugs for preventing and / or treating ulcerative colitis.

5. The use according to claim 1, characterized in that: Application of Taxus chinensis extracellular vesicles in the preparation of drugs for treating ulcerative colitis.

6. A method for preparing the extracellular vesicles of Taxus chinensis according to any one of claims 1 to 5, characterized in that: The steps include: Step 1: clean the fresh yew branches and leaves with PBS buffer, grind them into a homogenate, filter through a gauze to remove the yew residue, and obtain filtrate A; Step 2: centrifuge the filtrate A at low speed, medium speed and high speed in sequence under low temperature to obtain supernatant B; Step 3, filtering the supernatant B through a filter membrane and centrifuging again to obtain a precipitate C; Step 4: resuspend the precipitate C with a sterilized PBS solution to obtain the extracellular vesicles of Taxus chinensis.

7. The method for preparing extracellular vesicles of Taxus chinensis according to claim 6, characterized in that: In the step 2, the low temperature condition is 0-10°C; the centrifugal force of the low-speed centrifugation is 800-1500rpm, and the centrifugation time is 15-30min; the centrifugal force of the medium-speed centrifugation is 2500-4000rpm, and the centrifugation time is 25-40min; the centrifugal force of the high-speed centrifugation is 9000-12000rpm, and the centrifugation time is 40-60min.

8. The method for preparing Taxus chinensis extracellular vesicles according to claim 6, characterized in that: The centrifugal force of the centrifugation in step 3 is 100,000 to 120,000 rpm, and the centrifugation time is 80 to 100 min.

9. The method for preparing Taxus chinensis extracellular vesicles according to claim 6, characterized in that: The yew branches and leaves include leaves and / or stems.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: The Taxus chinensis extracellular vesicle according to any one of claims 1 to 9; and One or more pharmaceutically acceptable carriers and / or excipients.

Images