CRISPR gene editing method of lactobacillus salivarius

Abstract

The invention discloses a CRISPR gene editing method of lactobacillus salivarius. The invention provides a method for performing gene editing on a target gene, which comprises the following steps: introducing plasmids for expressing sgRNA into lactobacillus salivarius containing II-type CRISPR-Cas9 system nucleic acid, and culturing to obtain a gene editing strain of the target gene so as to realize gene editing of the target gene. The invention finds that an II-type CRISPR-Cas9 system exists in lactobacillus salivarius LSJ-2 and has activity, on the basis of the II-type CRISPR-Cas9 system, a CRISPR-Cas9 gene editing system of lactobacillus salivarius is developed, endogenous genes are edited through the method, and single gene deletion is accurately completed.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a CRISPR gene editing method for Lactobacillus salivarius. Background Art

[0002] The CRISPR-Cas system is a special defense mechanism in prokaryotes and an adaptive immunity to exogenous invasive DNA / RNA. It is widely used due to its specificity, high efficiency, precision and editability. Among them, the type II-A CRISPR-Cas system is one of the most widely used gene editing tools because it contains only one effector protein, Cas9, and guides the Cas9 nuclease to cut the target DNA sequence upstream of PAM through artificially designed sgRNA, resulting in blunt double-strand breaks, which can be recombined through natural DNA repair mechanisms, non-homologous end joining or homology-directed repair. Since the homology-directed repair method provides a homologous repair template with the desired sequence, it is more suitable for precise genome modification than error-prone non-homologous end joining. Exogenous CRISPR-Cas9 gene editing systems have been widely used. For example, the CRISPR-Cas9 systems from Streptococcus pneumoniae and Streptococcus pyogenes have been used for genetic operations including bacteria, yeast, plants and animals, and genome editing is achieved by introducing Cas9 and sgRNA respectively through two plasmids. Compared with the exogenous CRISPR-Cas system, the construction method of the endogenous CRISPR-Cas system is simpler. It only requires the design of a plasmid containing sgRNA and homologous repair template. It does not require exogenous Cas effectors that may be toxic to cells, which is more advantageous than the exogenous editing system.

[0003] Lactobacillus salivarius has probiotic effects such as immune regulation and cholesterol lowering, but there is currently a lack of research on the functions of specific genes or proteins in Lactobacillus salivarius through gene editing. Building an efficient gene editing tool can deeply analyze the material basis for the probiotic functions of Lactobacillus salivarius. Summary of the invention

[0004] The technical problem solved by the present invention is how to use endogenous type II CRISPR-Cas9 system nucleic acid to study gene functions in Lactobacillus salivarius, so as to deeply analyze the probiotic functions of Lactobacillus salivarius.

[0005] In order to solve this technical problem, the first aspect of the present invention provides a method for gene editing of a target gene, comprising the following steps: introducing a plasmid expressing sgRNA into Lactobacillus salivarius containing a type II CRISPR-Cas9 system nucleic acid, culturing, obtaining a target gene gene editing strain, and achieving target gene gene editing;

[0006] The type II CRISPR-Cas9 system nucleic acid includes four Cas protein encoding genes;

[0007] The four Cas protein encoding genes are respectively the cas9 protein encoding gene shown in positions 1036-5052 of sequence 1, the cas1 protein encoding gene shown in positions 5249-6151 of sequence 1, the cas2 protein encoding gene shown in positions 6231-6434 of sequence 1 and the csn2 protein encoding gene shown in positions 6434-7105 of sequence 1.

[0008] In the method described above, the type II CRISPR-Cas9 system nucleic acid also includes a fragment consisting of a repetitive sequence and a spacer sequence;

[0009] The nucleotide sequence of the fragment composed of the repeating sequence and the spacer sequence is position 7137-10472 of sequence 1.

[0010] In the method described above, the Lactobacillus salivarius is Lactobacillus salivarius LSJ-2;

[0011] The nucleotide sequence of the type II CRISPR-Cas9 system nucleic acid is sequence 1.

[0012] In the method described above,

[0013] The sgRNA includes a sgRNA encoding gene and a homologous repair template;

[0014] The sgRNA includes crRNA (spacer sequence) targeting the target gene and Cas9 binding fragment tracrRNA;

[0015] The crRNA targeting the target gene is a fragment 20-30 bp upstream of the PAM sequence in the target gene;

[0016] The Cas9 binding fragment tracrRNA is positions 1-100 of sequence 1.

[0017] In the method described above, the PAM sequence is any one of the following:

[0018] PAM1 with the nucleotide sequence of 5′-TGGTATAG-3′;

[0019] or PAM2 having a nucleotide sequence of 5′-GGGTATTA-3′;

[0020] or PAM3 having a nucleotide sequence of 5'-TGGCAATA-3'.

[0021] In the method described above, the homologous repair template includes a 800-1000 bp fragment upstream of the target gene and a 800-1000 bp fragment downstream of the target gene.

[0022] In the above, the plasmid expressing sgRNA may be a plasmid obtained by cloning a fragment consisting of the coding sequence of the sgRNA, a constitutive strong promoter and the homologous repair template into a lactic acid bacteria expression vector.

[0023] The lactic acid bacteria expression vector may be plasmid pMG36e.

[0024] The constitutive strong promoter may be PpgmA.

[0025] The homologous repair template consists of a 800-1000bp fragment of the target gene upstream of the genome and a 800-1000bp fragment of the target gene downstream of the genome.

[0026] In the embodiments of the present invention, the following examples are given: the target gene is a bile salt hydrolase encoding gene, and the Lactobacillus salivarius is Lactobacillus salivarius LSJ-2;

[0027] The nucleotide sequence of the fragment consisting of the coding sequence of the sgRNA, the constitutive strong promoter and the homologous repair template is sequence 3, and the plasmid expressing the sgRNA is the gene editing plasmid pMG36e-Δbsh.

[0028] The target gene gene editing of the embodiment of the present invention is target gene knockout, and the target gene gene editing strain obtained is Δbsh. The only difference between the gene editing strain and Lactobacillus salivarius LSJ-2 is that the bsh gene (sequence 2) is missing. Bsh is a bile salt hydrolase, which has the ability to hydrolyze bound bile acids, catalyze taurine-bound bile acids, and remove a molecule of taurine to generate unbound bile acids. It is known that bile acids may promote the development of colorectal cancer or cause diarrhea. Therefore, knocking out the bsh gene can reduce bile acid production and thus reduce the risk of colorectal cancer.

[0029] In a second aspect, the present invention provides application of the method described in the first aspect in studying or identifying the function of a target gene in Lactobacillus salivarius.

[0030] The target gene may be an unknown gene or a gene with a known function inferred from theory or sequence.

[0031] Alternatively, the present invention also provides a target gene editing strain prepared by the method described in the first aspect.

[0032] In a third aspect, the present invention provides the type II CRISPR-Cas9 system nucleic acid described in the first aspect.

[0033] In a fourth aspect, the present invention provides the use of the type II CRISPR-Cas9 system nucleic acid described in the first aspect in preparing a type II CRISPR-Cas9 system.

[0034] Alternatively, the present invention provides the use of the type II CRISPR-Cas9 system nucleic acid described in the first aspect and the plasmid expressing sgRNA in the first aspect in preparing a type II CRISPR-Cas9 system.

[0035] Alternatively, the present invention provides a type II CRISPR-Cas9 system, comprising the type II CRISPR-Cas9 system nucleic acid described in the first aspect and the plasmid expressing the sgRNA in the first aspect.

[0036] In a fifth aspect, the present invention provides the use of the type II CRISPR-Cas9 system described in the fourth aspect in studying or identifying the function of a target gene in Lactobacillus salivarius.

[0037] In the present invention, Lactobacillus salivarius is specifically Lactobacillus salivarius LSJ-2.

[0038] The target gene may be an unknown gene or a gene with a known function inferred from theory or sequence.

[0039] The present invention discovered that a type II CRISPR-Cas9 system exists in Lactobacillus salivarius LSJ-2 and is active. Based on this, a CRISPR-Cas9 gene editing system for Lactobacillus salivarius was developed. Endogenous genes were edited by this method, and single gene deletion was accurately completed, thereby realizing the research or identification of gene function. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The structure and PAM sequence of the endogenous type II-A CRISPR-Cas sequence of Lactobacillus salivarius LSJ-2.

[0041] Figure 2 To analyze the activity of the endogenous type II-A CRISPR-Cas system of Lactobacillus salivarius LSJ-2.

[0042] Figure 3 To use the CRISPR-Cas9 system to knock out the bile salt hydrolase gene bsh in Lactobacillus salivarius LSJ-2. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0045] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0046] Lactobacillus salivarius LSJ-2 was deposited on July 27, 2022 at the General Microbiology Center of China Culture Collection Administration (CGMCC), located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC No. 25105, and the classification name is Lactobacillus salivarius.

[0047] Example 1: Lactobacillus salivarius LSJ-2 contains an endogenous CRISPR-Cas9 gene editing system

[0048] 1. Screening of PAM sequences

[0049] Through whole genome analysis, a type II CRISPR-Cas9 system was identified in Lactobacillus salivarius LSJ-2. Its nucleic acid gene sequence is shown in SEQ ID NO: 1 and its structure is shown in Figure 1 As shown in A. The system includes 4 Cas protein encoding genes, 21 groups of 30 base spacer sequences, and 36 base (5'-GTTTCAGAAGGATGTTAAATCAATTAGGTTAAGACC-3') repeating sequences, wherein the Cas protein encoding genes include cas1, cas2, csn2 and the most critical cas9 gene.

[0050] The 5249-6151th position of sequence 1 is the cas1 gene, the 6231-6434th position of sequence 1 is the cas2 gene, the 6434-7105th position of sequence 1 is the csn2 gene, and the nucleotide sequence of the fragment composed of the repeat sequence and the spacer sequence is the 7137-10472th position of sequence 1.

[0051] In order to identify the 2-6 base pair DNA sequence targeted by the Cas9 nuclease in this CRISPR system (PAM, Figure 1 B), all spacers in the CRISPR array were searched, and the PAM frequency was predicted and plotted ( Figure 1 C) By Figure 1 C shows that the conserved sites are located at the 2nd, 3rd and 5th positions.

[0052] Six possible PAM sequences in Lactobacillus salivarius LSJ-2 were screened for subsequent activity verification, including PAM1: 5'-TGGTATAG-3'; PAM2: 5'-GGGTATTA-3'; PAM3: 5'-TGGCAATA-3'; PAM4: 5'-AGGTGAAT-3'; PAM5: 5'-TATTATCT-3' and PAM6: 5'-GAAAACCC-3'.

[0053] 2. The endogenous CRISPR-Cas9 system of Lactobacillus salivarius LSJ-2 is active

[0054] In order to detect the activity of the endogenous CRISPR-Cas9 system of Lactobacillus salivarius LSJ-2 strain, a plasmid interference experiment was performed.

[0055] The different PAMs of 1 and the first spacer in the CRISPR array (sequence 1, position 7173-7202 GAAGTAATTATATAACCCGTCGAAATCGAC) were cloned into the vector pMG36e (Miaoling Biotechnology, P0299) to construct an interference plasmid.

[0056] Different interference plasmids were obtained by directly inserting fragments consisting of different PAM sequences and spacer sequences between the pMG36e promoter and the erythromycin resistance gene using Gibson assembly, and the resulting different plasmids were: pMG36e-spacer-PAM1, pMG36e-spacer-PAM2, pMG36e-spacer-PAM3, pMG36e-spacer-PAM4 and pMG36e-spacer-PAM5.

[0057] pMG36e-spacer is a plasmid obtained by directly inserting the spacer sequence (SEQ ID NO: 7173-7202 GAAGTAATTATATAACCCGTCGAAATCGAC) between the pMG36e promoter and the erythromycin resistance gene using Gibson assembly.

[0058] Each of the above plasmids was transformed into Lactobacillus salivarius LSJ-2 (CGMCC NO.25105), spread on a solid plate containing the corresponding resistance, and cultured at 30°C for 72 hours to obtain recombinant bacteria LSJ-2pMG36e-spacer-PAM1, LSJ-2pMG36e-spacer-PAM2, LSJ-2pMG36e-spacer-PAM3, LSJ-2pMG36e-spacer-PAM4, LSJ-2pMG36e-spacer-PAM5, LSJ-2pMG36e and LSJ-2pMG36e-spacer.

[0059] The results are as follows Figure 2 As shown, the recombinant bacteria LSJ-2pMG36e ( Figure 2 A) and the recombinant bacteria LSJ-2pMG36e-spacer transformed with the plasmid pMG36e-spacer without PAM inserted only into the spacer ( Figure 2 B) As a control, it can be seen that compared with the control, the LSJ-2pMG36e-spacer-PAM1, LSJ-2pMG36e-spacer-PAM2, and LSJ-2pMG36e-spacer-PAM3 strains did not grow, indicating that PAM1 (5'-TGGTATAG-3', Figure 2 C), PAM2 (5'-AGGTGAAT-3', Figure 2 D) and PAM3 (5'-TGGCAATA-3', Figure 2 E) has a high interference efficiency, which can recognize the PAM sequence in the interference plasmid and cut it, resulting in double-strand breaks, which makes the plasmid unable to replicate in the bacteria, the plasmid is lost, and the erythromycin resistance disappears, so there are no transformants in the resistance plate. PAM4 and PAM5 have low interference efficiency.

[0060] The above results indicate that the endogenous CRISPR-Cas9 system in Lactobacillus salivarius LSJ-2 has high activity and possesses multiple PAM sequences PAM1, PAM2 and PAM3 that efficiently target target genes.

[0061] 2. Application of endogenous CRISPR-Cas9 system in gene editing of target genes

[0062] Bile salt hydrolase is a functional enzyme produced during the growth of microorganisms, which has the ability to hydrolyze conjugated bile acids. It can catalyze taurine-conjugated bile acids and remove a molecule of taurine to generate unconjugated bile acids.

[0063] To test whether the endogenous CRISPR-Cas9 system in Lactobacillus salivarius LSJ-2 can be reprogrammed for gene editing, single-stranded guide RNA (sgRNA) was designed to perform editing of the target gene based on the predicted PAM sequence. Gene editing of the bile salt hydrolase gene (bsh) in Lactobacillus salivarius LSJ-2 was performed for gene deletion.

[0064] 1. Construction of gene editing plasmid pMG36e-Δbsh

[0065] According to the bsh gene of Lactobacillus salivarius LSJ-2 (the gene sequence is shown in Sequence 2), its sgRNA target is sequence 2, position 179-208 (5'-CCAAAACCAGTACCGTCTACCTTTAAATCC-3'), and the PAM for bsh gene editing was determined to be PAM1 (5'-TGGTAT-3', if the 8nt PAM sequence cannot be used, the 3' base can be appropriately deleted until the sgRNA can be located in the target gene).

[0066] The target was screened based on the fragment upstream of PAM1 in the bsh gene of Lactobacillus salivarius LSJ-2, and the coding sequence of sgRNA targeting bsh was designed, 5′-GGATTTAAAGGTAGACGGTACTGGTTTTGGCAAAGTGGCATCCAAAGTTAAGAAAGTTAATGCCAAATAT AGAATTAACTATTTTGGTAGGTAGCTATGCTGTTAAGAAATATTTGAATCTAAAAAGTAG-3′.

[0067] Then, 1 kb fragments on both sides of the bsh gene were connected as homologous repair templates and cloned into the pMG36e vector together with the sgRNA coding sequence and the constitutive strong promoter to obtain the gene editing plasmid pMG36e-Δbsh, inducing its self-targeted cutting and homologous recombination.

[0068] The gene editing plasmid pMG36e-Δbsh is a fragment consisting of the coding gene of the sgRNA that recognizes PMA1, the constitutive strong promoter PpgmA, and the homologous repair template of the target gene bsh directly inserted into the pMG36e vector by Gibson. The resulting plasmid pMG36e-Δbsh ( Figure 3 A).

[0069] The nucleotide sequence of the above fragment is sequence 3, wherein positions 2063-2092 of sequence 3 are the sequence in the sgRNA that recognizes PMA1, positions 2093-2192 are the Cas9 binding fragment, positions 1920-2062 are the constitutive strong promoter PpgmA, and positions 1-1882 are the homologous repair template of the target gene bsh.

[0070] 2. Conversion

[0071] The gene-edited plasmid pMG36e-Δbsh was transformed into Lactobacillus salivarius LSJ-2, and after clones were grown, transformants were randomly selected for PCR detection using primers F: 5′-CTCCTCTATTCTCAGTAAGACAGG-3′ and R: 5′-ATGGTCTTGTTCCTAATGGCCG-3′.

[0072] The results are as follows Figure 3 As shown in B, using Lactobacillus salivarius LSJ-2 as the control (WT), it can be seen that the 810 bp deletion strain was identified and named Δbsh or LSJ-2Δbsh.

[0073] The amplification results of Δbsh were sent for sequencing, and the result diagram is shown in Figure 3 As shown in C, it can be seen that the Δbsh strain lacks the bsh gene compared with the WT.

[0074] After sequencing analysis, the only difference between the genome of the Δbsh strain and the LSJ-2 strain was the missing bsh gene.

[0075] 3. Bile salt hydrolase activity detection

[0076] The bile salt hydrolase activity of wild-type Lactobacillus salivarius LSJ-2 and knockout strain LSJ-2Δbsh was detected.

[0077] The detection method is as follows:

[0078] Prepare 1 mg / mL of bile acid mother solution, culture lactobacillus overnight, transfer 1% the next day, and add 1% to the culture medium (final concentration 100ug / mL), culture anaerobically at 37 degrees for 36 hours, add 2 times the volume of methanol to the culture medium to extract bile acid, filter through 0.22μm filter membrane, and analyze by liquid chromatography-mass spectrometry:

[0079] The conditions of liquid chromatography were as follows: C8 column, column length 100 mm, diameter 2.1 mm, particle size 1.7 μm, flow rate 0.2 mL / min, column temperature 35°C, injection volume 5 μL; liquid chromatography mobile phase A phase was 10 mmol / L NH4HCO3 aqueous solution, phase B was pure acetonitrile, gradient elution was used, initial 25% B, maintained for 0.5 min, then linearly increased to 40% B within 12 minutes. Continued to increase to 90% B within 1 min, maintained for 3 minutes, returned to 25% B in 0.5 minutes, and balanced for 2.5 minutes.

[0080] The conditions for mass spectrometry detection were as follows: ESI source negative ion mode, spray voltage 3 kV, capillary temperature set to 300 ° C. Sheath gas and auxiliary gas were both nitrogen, with flow rates of 45 and 10 (arbitrary units) respectively, and auxiliary gas heating temperature was 350 ° C. The method adopted full scan mode, with resolution set to 120000 and scan range set to m / z73.4 to 1100.

[0081] Standards: Cholic acid (Brand: MedChemExpress, Product No.: HY-N0324 Cholic acid, CAS No.: 81-25-4). Taurocholic acid (Product No.: HY-B1788, CAS No.: 81-24-3, Brand: MedChemExpress)

[0082] Taurocholic acid: y = 243423x – 946352, R2 = 0.9997

[0083] Bile acid: y = 200464x – 862738, R2 = 0.9998

[0084] The results are as follows Figure 3 As shown in D, the first row is taurocholic acid and bile acid standards, the second row is wild-type LSJ-2, and the third row is the knockout strain LSJ-2Δbsh; it can be seen that the wild-type LSJ-2 can catalyze the hydrolysis of taurocholic acid to produce bile acid, while the knockout strain LSJ-2Δbsh has a weakened ability to hydrolyze bound bile acids.

[0085] The above results indicate that the endogenous CRISPR-Cas9 system of Lactobacillus salivarius LSJ-2 has gene editing activity. By constructing an endogenous editing system, the gene encoding bile salt hydrolase in LSJ-2 was successfully knocked out.

[0086] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for gene editing of a target gene, comprising the following steps: introducing a plasmid expressing sgRNA into Lactobacillus salivarius containing a type II CRISPR-Cas9 system nucleic acid, culturing, obtaining a target gene gene editing strain, and achieving target gene gene editing; The type II CRISPR-Cas9 system nucleic acid includes four Cas protein encoding genes; The four Cas protein encoding genes are respectively the cas9 protein encoding gene shown in positions 1036-5052 of sequence 1, the cas1 protein encoding gene shown in positions 5249-6151 of sequence 1, the cas2 protein encoding gene shown in positions 6231-6434 of sequence 1 and the csn2 protein encoding gene shown in positions 6434-7105 of sequence 1.

2. The method according to claim 1, characterized in that: The type II CRISPR-Cas9 system nucleic acid also includes a fragment consisting of a repeat sequence and a spacer sequence; The nucleotide sequence of the fragment composed of the repeating sequence and the spacer sequence is position 7137-10472 of sequence 1.

3. The method according to claim 1 or 2, characterized in that: The Lactobacillus salivarius is Lactobacillus salivarius LSJ-2; The nucleotide sequence of the type II CRISPR-Cas9 system nucleic acid is sequence 1.

4. The method according to any one of claims 1 to 3, characterized in that: The plasmid expressing sgRNA includes a sgRNA encoding gene and a homologous repair template; The sgRNA includes crRNA targeting the target gene and Cas9 binding fragment tracrRNA; The crRNA targeting the target gene is a fragment 20-30 bp upstream of the PAM sequence in the target gene; The Cas9 binding fragment tracrRNA is positions 1-100 of sequence 1.

5. The method according to claim 4, characterized in that: The PAM sequence is any of the following: PAM1 with the nucleotide sequence of TGGTATAG; or PAM2 having a nucleotide sequence of GGGTATTA; Or PAM3 whose nucleotide sequence is TGGCAATA.

6. The method according to claim 4 or 5, characterized in that: The homologous repair template includes an 800-1000bp fragment upstream of the target gene and an 800-1000bp fragment downstream of the target gene.

7. Use of the method according to any one of claims 1 to 6 in studying or identifying the function of a target gene in Lactobacillus salivarius; Or, a target gene gene-edited strain prepared by the method of any one of claims 1-6.

8. The type II CRISPR-Cas9 system nucleic acid according to any one of claims 1 to 6.

9. Use of the type II CRISPR-Cas9 system nucleic acid according to any one of claims 1 to 6 in the preparation of a type II CRISPR-Cas9 system; Or, use of the type II CRISPR-Cas9 system nucleic acid described in any one of claims 1 to 6 and the plasmid expressing sgRNA described in any one of claims 1 to 6 in the preparation of a type II CRISPR-Cas9 system; Or a type II CRISPR-Cas9 system, comprising the type II CRISPR-Cas9 system nucleic acid described in any one of claims 1 to 6 and the plasmid expressing sgRNA in any one of claims 1 to 6.

10. Use of the type II CRISPR-Cas9 system according to claim 9 in studying or identifying the function of a target gene in Lactobacillus salivarius.

Images