A molecular marker primer for LMX1B gene related to egg weight trait and its application

Abstract

The invention relates to a LMX1B gene molecular marker primer related to egg weight trait and an application thereof, belonging to the field of biotechnology. The LMX1B gene molecular marker of the invention is located at the 10705046th base of chromosome 17 of the chicken reference genome GRCg7b version, the base mutation is T or G, and the genotype is G / G, G / T and T / T. The egg weight of G / G genotype chickens is higher than that of G / T and T / T genotype individuals, and the egg weight of G / T genotype chickens is higher than that of T / T genotype individuals. The invention utilizes forward and reverse primer pairs to amplify a fragment containing the above-mentioned molecular marker site, and performs Sanger sequencing on the amplified product, so as to quickly and accurately identify the genotype of the individual; the molecular marker can be used as a genetic marker for chicken breeding, and chickens with appropriate egg weight can be selected; the egg weight trait can be detected efficiently and accurately, and the uniformity of egg weight of a flock of chickens can be improved, which is of great value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a LMX1B gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight has a strong correlation with egg production, chick birth weight, hatchability of breeding eggs, and eggshell quality. Studies have shown that egg weight is negatively correlated with egg production, and too high egg weight will affect the egg production of breeding hens. Egg weight will also affect the birth weight of chicks, and the egg weight of breeding eggs is strongly positively correlated with the birth weight of chicks. Too high or too low egg weight will significantly affect the fertilization rate and hatchability of breeding eggs. Egg weight will also affect the quality of eggshells, and it has a certain negative correlation with eggshell thickness. Breeding the number of eggs and the uniformity of egg weight is conducive to improving the fertilization rate and hatchability of breeding eggs, improving the number and quality of eggs laid during the egg-laying cycle, and is conducive to the hatching and sale of chicks. However, egg weight will increase with the increase of egg-laying age. Breeding after the egg weight of breeding eggs is stable will not only take a long time, but also cause huge waste of feeding costs. Therefore, using molecular markers to accurately identify genotypes associated with egg weight traits after the start of laying and applying them to early breeding selection can speed up the breeding cycle, reduce time and feeding costs, and improve resource utilization.

[0003] The LMX1B gene is related to neuronal development and bone development. Studies have shown that LMX1B plays an important regulatory role in limb regeneration and embryonic bone development, is related to chicken growth and development, and may also be involved in calcium deposition and mineralization during eggshell formation, which indicates that the LMX1B gene may be closely related to egg weight, which needs further study. Summary of the invention

[0004] The purpose of the present invention is to address the defects of the prior art, propose a LMX1B gene molecular marker primer related to the egg weight trait and its application, and quickly detect and screen the egg weight of chickens at different stages.

[0005] The present invention measures the egg weight of hens, uses whole genome resequencing technology to perform SNP genotyping, and screens the LMX1B gene molecular marker that is significantly correlated with the chicken's initial egg weight trait through whole genome association analysis, providing new gene and molecular marker resources for the breeding of chickens' initial egg weight trait.

[0006] The present invention solves the technical problem through the following technical scheme: firstly, a molecular marker primer of the LMX1B gene related to the egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 10705046th base on chromosome 17 of the chicken reference genome GRCg7b version, and the base is mutated to T or G. The sequence is shown in the 235th base as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0007] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to the egg weight trait of chickens. The detection method comprises the following steps:

[0008] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 305 bp in length and contains the 10705046th base of chicken chromosome 17;

[0009] Step 2: Sanger sequencing of the PCR product;

[0010] The third step is to determine the genotype of the SNP molecular marker at base 10705046 of chicken chromosome 17 based on the sequencing results of the second step.

[0011] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0012] Upstream primer: 5'-ATAATATCCCTGTCTGAGCCACGG-3' (SEQ ID NO: 1)

[0013] Downstream primer: 5'-GACAGGCTGCTAAAGATCATCACC-3' (SEQ ID NO: 2)

[0014] The final concentration of the reaction system is 25 μl.

[0015] Chicken DNA to be tested 50 ng,

[0016] 2 x Accurate Taq Master Mix 12.5 μl,

[0017] Upstream primer 1 μl,

[0018] Downstream primer 1 μl,

[0019] Add sterile water to 25 μl.

[0020] The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 60 seconds, a total of 30 cycles; 72°C extension for 2 minutes; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 305bp in length, and contains the 10705046th base of chicken chromosome 17.

[0021] In the third step, the judgment standard is that the egg weight of G / G genotype chickens at each stage is higher than that of T / G and T / T genotype individuals, and the egg weight of T / G genotype chickens at each stage is higher than that of T / T genotype individuals.

[0022] The present invention detects the genotype of the egg weight trait of the chicken by using the LMX1B gene molecular marker, and obtains that the egg weight of the G / G genotype chicken is higher than that of the T / G and T / T genotype individuals, and the egg weight of the T / G genotype chicken is higher than that of the T / T genotype individual. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can realize the selection of the egg weight trait of the chicken at each stage. In breeding, according to the breeding goal, by eliminating the T / G and T / T genotype individuals, the G / G genotype individuals can be retained, and the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding to select chickens with heavy egg weight; the egg weight trait can be identified efficiently and quickly, and the uniformity of the egg weight of the chicken flock can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Manhattan plot of longitudinal trait association analysis of egg weight in four periods

[0024] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0025] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0026] Example 1

[0027] In this example, the egg weight at the beginning of laying, at 31 weeks, 37 weeks and 52 weeks of recessive White Rock hens was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The LMX1B gene molecular markers significantly associated with egg weight at multiple periods were screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0028] In this example, the following experiments were performed to identify and apply the LMX1B gene molecular marker related to the egg weight trait.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and egg weight phenotype determination

[0031] A total of 2314 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the process. The egg weight phenotypic data were recorded at the beginning of laying, 31 weeks, 37 weeks and 52 weeks of age.

[0032] (2) Extraction of genomic DNA

[0033] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0034] (3) PCR amplification

[0035] The fragment containing the 10705046th base of chromosome 17 was amplified using the genomic DNA extracted as above as a template.

[0036] Upstream primer: 5'-ATAATATCCCTGTCTGAGCCACGG-3' (SEQ ID NO: 1)

[0037] Downstream primer: 5'-GACAGGCTGCTAAAGATCATCACC-3' (SEQ ID NO: 2)

[0038] The final concentration of the reaction system is 25 μl.

[0039] DNA to be tested 50 ng,

[0040] 2 x Accurate Taq Master Mix 12.5 μl,

[0041] Upstream primer 1 μl,

[0042] Downstream primer 1 μl,

[0043] Add sterile water to 25 μl.

[0044] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 305bp was amplified, containing the SNP molecular marker at the 10705046th base site of chicken chromosome 17. The sequence of the amplified product is as follows:

[0045] SEQ ID NO:3

[0046] ATAATATCCCTGTCTGAGCCACGGTGCGCTTATTGATGGTGCTGCACCTGACGCGCTGACCGCGTCCCCTCGCCCTGCGCTGCTCAGGCCTGCAGGGCACGGCGCCGCATATTGCTGTCACAGAGCGAACTCTGAGCGCTGCAGCAGGGCG CATCTAGCAGGGAAAAAAGGCGCATGATAGTCAAATTTCACTTGCTGAATATTTAATGAAGCCTGCAGTGTTTATTTGGTTATCCTGTCGATTTTTATCGTTCTGTCAATAGCTTCTCATATGTGGCACGGTGATGATCTTTAGCAGCCTGTC

[0047] SEQ ID NO:4

[0048] ATAATATCCCTGTCTGAGCCACGGTGCGCTTATTGATGGTGCTGCACCTGACGCGCTGACCGCGTCCCCTCGCCCTGCGCTGCTCAGGCCTGCAGGGCACGGCGCCGCATATTGCTGTCACAGAGCGAACTCTGAGCGCTGCAGCAGGGCG CATCTAGCAGGGAAAAAAGGCGCATGATAGTCAAATTTCACTTGCTGAATATTTAATGAAGCCTGCAGTGTTTATTTGGTTAGCCTGTCGATTTTTATCGTTCTGTCAATAGCTTCTCATATGTGGCACGGTGATGATCTTTAGCAGCCTGTC

[0049] (4) Sanger sequencing and genotyping

[0050] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0051] 2. Correlation Analysis

[0052] The egg weight of recessive White Lock hens with clear egg weight phenotype records was selected for correlation analysis. The ANOVA test function of R4.2 statistical drawing software was used for statistical testing, and the pairwise mean comparison mode was selected to perform statistical testing on the genotype and egg weight traits of the experimental chicken flocks. P<0.05 indicated a significant difference, and the results are shown in Table 1. The average egg weight at the beginning of laying of G / G genotype individuals was 48.00g, which was higher than 47.76g of T / G genotype and 47.11g of T / T genotype individuals (P<0.05); the average egg weight of G / G genotype individuals at 31 weeks of age was 52.59g, which was higher than 52.03g of T / G genotype (P<0.05) and 51.29g of T / T genotype individuals (P<0.05); the average egg weight of G / G genotype individuals at 37 weeks of age was 58.27g, which was higher than 57.45g of T / G genotype (P<0.05) and 56.62g of T / T genotype individuals (P<0.05); The average egg weight of G / G genotype individuals at 52 weeks of age was 62.33g, which was higher than 61.59g (P<0.05) of T / G genotype and 60.54g (P<0.05) of T / T genotype individuals. The results showed that the chicken LMX1B gene molecular marker was significantly correlated with the egg weight trait. According to the actual breeding goals, G / G genotype individuals can be selected to breed chickens with larger egg weight, improve the overall egg weight and uniformity, and improve the breeding efficiency.

[0053] Table 1 Association analysis between LMX1B gene molecular markers and egg weight phenotypes at different stages

[0054]

[0055] Note: For the data in the same period and the same column, the same letters indicate no significant difference, and different letters indicate significant difference (P<0.05).

[0056] Example 2

[0057] Genotype frequencies of different varieties

[0058] 1. Blood Sample Collection

[0059] Blood samples from 14 breeds, including Luodao Red Laying Hens, White Leghorn Laying Hens, Cobb Broilers, Camellia Chickens, Fujian Hetian Chickens, Langshan Chickens, Liyang Chickens, Guangxi Ma Chickens, Xinghua Chickens, Guangxi Black-Bone Chickens, Guangxi Three Yellow Chickens, Beijing Oily Chickens, Bearded Chickens and Tibetan Chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0060] 2. Extraction of Genomic DNA

[0061] Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0062] 3. Genotype detection

[0063] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's T / T genotype, G / T genotype, and G / G genotype.

[0064] 4. Results Analysis

[0065] Luodao Red Layer and White Leghorn Layer are common commercial laying hen breeds with high egg production rate and moderate and uniform egg weight. Cobb broiler is a common commercial broiler breed with large body and poor egg production performance. Camellia chicken, Fujian Hetian chicken, Langshan chicken, Liyang chicken, Guangxi Ma chicken, Xinghua chicken, Guangxi Black-bone chicken, Guangxi Three Yellow chicken, Beijing Oily chicken, Bearded chicken and Tibetan chicken are well-known local chicken breeds in China. In different types of chicken breeds, this SNP locus has been selected to different degrees and there is polymorphism. These results can all confirm that this SNP locus can be used as a molecular marker for egg weight traits in multiple populations. See Table 2.

[0066] Table 2 Distribution of allele frequencies of LMX1B gene molecular markers in different varieties

[0067] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a detection primer for a SNP site of the LMX1B gene associated with egg weight, characterized in that: The detection primers are used to detect the egg weight trait. The nucleotide sequences of the detection primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The SNP site is located at the 10705046th base on chromosome 17 of the chicken reference genome GRCg7b version, and the base mutates to T or G. The SNP site is that the egg weight of G / G genotype chickens at all stages is higher than that of G / T and T / T genotype individuals, and the egg weight of G / T genotype chickens at all stages is higher than that of T / T genotype individuals.

2. The use of the detection primers for the LMX1B gene SNP site associated with the egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification with the detection primers to obtain an amplified product, wherein the amplified product is 305 bp in length and contains the 10705046th base of chromosome 17 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 10705046 on chromosome 17 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the LMX1B gene SNP site associated with the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images