Aging-related genes LRRN3, CACHD1, NT5E and SATB1 and application thereof

Abstract

The invention relates to aging-related genes LRRN3, CACHD1, NT5E and SATB1 and application thereof, in particular to the aging-related genes LRRN3, CACHD1, NT5E and SATB1 which are excavated by analyzing gene expression change accompanying aging through a transcriptomics technology on the basis of a human peripheral mononuclear cell sample and are applied to the aging-related genes LRRN3, CACHD1, NT5E and SATB1 based on Asian people. The method is especially suitable for aging measurement of peripheral mononuclear cell samples of East Asia or Southeast Asia people.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to aging-related genes LRRN3, CACHD1, NT5E and SATB1 and applications thereof. Background Art

[0002] Population aging and aging issues pose huge challenges to human health and medical care worldwide. Aging is a complex process affected by multiple factors such as genetics and the environment, and is considered to be the root cause of many chronic diseases (such as cardiovascular diseases, neurodegenerative diseases, diabetes or chronic obstructive pulmonary disease). Therefore, quantifying the aging rate will help evaluate disease risks and health levels and provide a basis for personalized medicine. How to analyze aging and further intervene in aging has become an important direction to overcome in the current field of aging research.

[0003] At present, the mining of aging measurement indicators at the transcriptional level mainly relies on (single-cell) transcriptomics technology, which is based on biological samples of classic model animals (such as nematodes, fruit flies, mice, non-human primates, etc.), and obtains aging-related genes by comparing the differences in gene expression between young and old individuals. However, this method has problems such as large species differences between model animals and humans, only setting up young and old groups cannot reflect the linear changes of aging, and a single tissue organ is not easy to reflect the overall aging of the body. At the same time, there is currently a lack of aging-related gene analysis based on single-cell transcriptomics data of peripheral monocytes in the Chinese population. Summary of the invention

[0004] The present invention relies on human peripheral monocyte samples and uses single-cell transcriptomics technology to analyze the changes in gene expression associated with aging. It has discovered aging-related genes LRRN3, CACHD1, NT5E, and SATB1 and applied them to aging measurement based on peripheral monocyte samples of the Chinese population.

[0005] In a first aspect, the present invention provides a detection reagent or kit for detecting the expression level of the following genes in an individual biological sample: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof.

[0006] In some embodiments, the detection reagent or kit is used for:

[0007] i. Evaluate or assist in evaluating the rate or degree of aging of an individual;

[0008] ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or

[0009] iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or

[0010] iv. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

[0011] In a second aspect, the present invention provides the use of a substance for detecting the expression level of the following genes in an individual biological sample in the preparation of a detection reagent or kit: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof, wherein the detection reagent or kit is used for:

[0012] i. Evaluate or assist in evaluating the rate or degree of aging of an individual;

[0013] ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or

[0014] iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or

[0015] iv. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

[0016] In a third aspect, the present invention provides the use of a substance that has the ability to regulate (e.g., upregulate) the activity of the following genes in an individual for the preparation of a medicament: LRRN3, CACHD1, NT5E, SATB1, or any combination thereof, wherein the medicament is used to reduce the biological aging rate of the individual, and / or delay the onset of adverse age-related phenotypes, or reduce their severity, and / or prevent aging-related diseases, prevent or treat aging-related diseases.

[0017] In a fourth aspect, the present invention provides an evaluation method, comprising:

[0018] (1) measuring the expression level of the following genes in the individual biological sample: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof to obtain a measurement value;

[0019] (2) Based on the measured values ​​and the individual's age, performing at least one of the following comparisons:

[0020] a. Comparison of gene expression levels:

[0021] 1) The measured value vs. the average expression level of the same gene in healthy people of the same age as the individual; or

[0022] 2) the measured value vs. the expression level of the same gene in the individual at a certain time before or after the measurement; or

[0023] b. Age comparison: the current age of an individual vs. the average age of a healthy population when the average expression level of the same gene in the healthy population is the same as the measured value;

[0024] (3) Based on the comparison results of step (2), the following evaluation is performed:

[0025] i. Evaluate or assist in evaluating the rate or degree of aging of an individual;

[0026] ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or

[0027] iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or

[0028] iiii. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

[0029] In a fifth aspect, the present invention provides a drug screening method comprising:

[0030] (1) Provide biological samples and divide them into test group and control group;

[0031] (2) exposing the test group biological samples to the candidate compound;

[0032] (3) analyzing the expression of the following genes in the biological samples of the test group: LRRN3, CACHD1, NT5E, SATB1, or any combination thereof, and comparing with that of the control group;

[0033] If the expression level of the corresponding gene is increased compared with that of the control group, it is judged that the compound has the potential to inhibit or delay aging.

[0034] In some embodiments, the medicament is used to reduce the biological aging rate of an individual, and / or delay the onset of adverse age-related phenotypes, or reduce their severity, and / or prevent age-related diseases.

[0035] In any of the above aspects, the individual is a mammal. In some embodiments, the individual is Asian. In some embodiments, the individual is East Asian or Southeast Asian. In some embodiments, the individual is Chinese.

[0036] In any of the above aspects, the biological sample is from a mammal. In some embodiments, the biological sample is from a human. In some embodiments, the biological sample is from an Asian. In some embodiments, the biological sample is from an East Asian or Southeast Asian. In some embodiments, the biological sample is from a Chinese. In some embodiments, the biological sample is a peripheral mononuclear cell sample.

[0037] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the molecular genetics, nucleic acid chemistry, immunology, and bioinformatics laboratory operation steps used herein are conventional steps widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0038] As used herein, the term "aging" has the meaning commonly understood by those skilled in the art, and is a common biological phenomenon in the growth and development of the body. Aging can be considered as a process of body function decline accompanied by aging, which is usually accompanied by a continuous decline in physical health and an increase in the risk of aging-related diseases, functional disorders and death.

[0039] As used herein, the term "aging-related diseases" refers to aging-related diseases whose risk of occurrence increases significantly with aging of the body. In certain embodiments, the aging-related diseases include, but are not limited to, neurodegenerative diseases (such as Alzheimer's disease), diabetes, heart disease, cardiovascular and cerebrovascular diseases, hypertension, hyperlipidemia, osteoporosis, osteoarthritis, chronic kidney disease, cancer, and vision loss. In certain embodiments, the aging-related diseases are cardiovascular diseases, neurodegenerative diseases, diabetes, or chronic obstructive pulmonary disease.

[0040] The genes LRRN3 (leucine-rich repeat neuron 3, Gene ID: 54674), CACHD1 (caching domain-containing 1, Gene ID: 57685), NT5E (ecto-5'-nucleotidase, Gene ID: 4907), and SATB1 (SATB homeobox 1, Gene ID: 6304) described in the present invention are negatively correlated with individual aging.

[0041] The aging-related diseases described in the present invention are selected from cardiovascular diseases (such as hypertension, coronary heart disease, heart failure or stroke), neurodegenerative diseases (such as Alzheimer's disease or Parkinson's disease), diabetes or chronic obstructive pulmonary disease.

[0042] As used herein, the term "gene" refers to a fragment of DNA associated with the production of a polypeptide chain. It may include regions before and after the coding region (leader and non-transcribed tail), as well as intervening sequences (introns) between individual coding segments (exons). The term gene is used interchangeably with nucleic acids, cDNA, mRNA, small non-coding RNA, microRNA (miRNA), Piwi-interacting RNA, and short hairpin RNA (shRNA) encoded by a gene or locus. The terms "nucleic acid" and "polynucleotide" refer to deoxyribonucleic acid (DNA) or ribonucleic acid "RNA" and polymers thereof in single-stranded or double-stranded form. Unless otherwise specified, the term includes nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specified, a specific nucleic acid sequence also implicitly includes conservatively modified variants thereof (such as degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as sequences explicitly indicated. Specifically, the replacement of degenerate codons can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is replaced by mixed bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). "Genome" refers to the sum of all genetic material of an organism, including DNA or RNA. The various genes mentioned herein are known in the art and have the meanings generally understood in the art.

[0043] Advantageous Effects of the Invention

[0044] 1) Obtaining data on aging-related gene expression changes based on the healthy Chinese population: Filling the gaps in the aging transcriptional level data of the healthy Chinese population, providing a database of aging-related gene changes, and providing a basis for assessing the degree of aging and biological age of humans based on the transcriptional level;

[0045] 2) Obtain age-related differentially expressed genes for measuring the degree of aging: Systematically analyze to obtain age-related gene sets, and use peripheral mononuclear cell samples from the Chinese population to perform linear assessments of the degree of aging in multiple age groups. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Shows changes in upregulated genes with age.

[0047] Figure 2 Shows changes in downregulated genes with ageing.

[0048] Figure 3 Regression line graph showing the quantitative PCR validation results of age-related genes.

[0049] Figure 4 Age-related genes (and Figure 3 Corresponding) Age correlation and significance analysis results.

[0050] Figure 5 The expression changes of LRRN3 gene related to ageing are shown, y=-0.1297x+9.4924.

[0051] Figure 6 The expression changes of the age-related gene CACHD1 are shown, y=-0.0924x+6.4996.

[0052] Figure 7 The expression changes of age-related gene NT5E are shown, y=-0.0988x+9.7205.

[0053] Figure 8 The expression changes of the age-related gene SATB1 are shown, y=-0.032x+3.6064. DETAILED DESCRIPTION

[0054] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0055] 1. Volunteer recruitment and sample collection

[0056] The "Preliminary Screening Questionnaire" was published through the WeChat Mini Program to collect basic information of potential volunteers who are interested in joining this study based on the inclusion criteria, and to screen volunteers who meet the inclusion criteria; the inclusion criteria are as follows:

[0057] 1.1 Enrollment criteria

[0058] a) Aged 18 or above, with no major bad habits;

[0059] b) The applicant is in good health and has not undergone any major surgery within the past six months. Routine conditions related to the normal aging process are permitted, including:

[0060] i. Hypertension, well controlled (taking no more than 3 medications);

[0061] ii. Osteoporosis, osteopenia and / or osteoarthritis;

[0062] iii. Benign prostatic hypertrophy;

[0063] iv. Cataract, glaucoma, macular degeneration;

[0064] v.Dyslipidemia;

[0065] vi. Hypothyroidism;

[0066] vii. Prediabetes or abnormal fasting blood sugar (fasting blood sugar 100-126 mg / dL).

[0067] c) The subjects can communicate well with the researchers and cooperate with all tasks during the study;

[0068] i. Subjects must voluntarily sign a written informed consent.

[0069] 1.2 Exclusion criteria

[0070] a) Age does not meet the inclusion criteria;

[0071] b) Participants are currently undergoing other clinical trials or are receiving any research drugs or devices for treatment within 30 days prior to enrollment;

[0072] c) The investigator reports a history or current diagnosis of significant chronic medical conditions, including:

[0073] i. Any cancer (except polycythemia vera, basal cell or squamous cell skin cancer);

[0074] ii. Coronary artery disease / myocardial infarction / clinically significant congestive heart failure;

[0075] iii. Stroke / transient ischemic attack;

[0076] iv. Deep vein thrombosis / pulmonary embolism;

[0077] v. Serum creatinine>1.5mg / dl (male);

[0078] vi. poorly controlled hypertension (significant hypertension (systolic blood pressure > 160 mmHg, or diastolic blood pressure > 100 mmHg) despite treatment);

[0079] vii. History of active liver disease or metabolic acidosis;

[0080] viii. Chronic kidney disease / hemodialysis treatment, history of severe renal damage and / or eGFR≤45ml / min / 1.73m2;

[0081] ix. Severe autoimmune / inflammatory diseases, such as rheumatoid arthritis, lupus, Crohn's disease, etc.;

[0082] x. Neurological diseases such as dementia, such as Alzheimer's / Parkinson's, etc.;

[0083] xi. Diabetes (hemoglobin A1C>6.5% or fasting blood glucose>126 mg / dL or taking diabetes medication or insulin treatment);

[0084] xii. Recent (within 3 months) cardiovascular disease events (myocardial infarction, coronary artery intervention, coronary artery bypass grafting);

[0085] xiii. Infectious diseases such as HIV, hepatitis, tuberculosis, etc.

[0086] d) Currently taking the following medications regularly:

[0087] i. Chemotherapy drugs (such as tamoxifen, doxorubicin, mitoxantrone, bleomycin);

[0088] ii. Antiplatelet drugs (e.g. clopidogrel / Plavix, dipyridamole / Angeleno, ticlopidine / Ticlopidine, excluding aspirin);

[0089] iii. Cholinesterase inhibitors for Alzheimer's disease (donepezil / alicept).

[0090] e) Continuous alcohol or drug abuse;

[0091] f) Unable to provide informed consent;

[0092] g) The researcher believes that the physical factors of the participants may have an adverse effect on the research process or results.

[0093] 1.3 Termination criteria

[0094] a) Failure to follow the diet, work and rest schedule and physical examination requirements in accordance with the research content;

[0095] b) Experiencing abnormal physical conditions such as colds or fever during the study;

[0096] c) Accidental injury or physical discomfort during the research process;

[0097] d) Comply with the subject’s subjective wishes to terminate the program.

[0098] All volunteers who meet the inclusion criteria and are confirmed to be included in the group signed an informed consent form and joined the volunteer WeChat group for management and information communication. Within one month before the start of the project, volunteers need to maintain a normal schedule, eat a proper diet, avoid strenuous exercise, and refrain from excessive smoking or drinking. The day before the project, volunteers received a unified standardized diet (menu see Table 1) at the implementation hospital and were no longer allowed to take other foods.

[0099] Table 1 Unified standardized diet menu

[0100]

[0101] On the day of sample collection and physical examination, volunteers are required to wear clothes and shoes that are convenient for movement, are not allowed to wear makeup, and must bring identification documents (such as ID cards, etc.) to the hospital for physical examination and plasma sample collection.

[0102] 2. Sample Processing

[0103] Plasma collection is collected using EDTA collection tubes. EDTA anticoagulated peripheral blood and PBS are diluted in a 15mL centrifuge tube at a ratio of 1:1, inverted 4 to 5 times, and mixed thoroughly. Take another 15mL centrifuge tube, add 1 / 3 volume of lymphocyte separation solution, and carefully add the diluted peripheral blood vertically and slowly along the tube wall to the lymphocyte separation solution to keep the liquid surface clear. Horizontal centrifugation, 400g, 30min, 4℃, the centrifuge lifting speed needs to be adjusted to the lowest, the lifting speed is 1, the lower speed is 0, and the total centrifugation time is about 1h. After centrifugation, it is divided into three layers, the upper layer is plasma and PBS, the middle layer is lymphocyte separation solution, and the lower layer is mainly red blood cells and granulocytes. There is a white cloud-like narrow band at the interface between the upper and middle layers, which is PBMC. First, use a 1mL pipette to discard most of the upper yellow liquid, and the remaining 2mL to PBMC is carefully transferred to a 15mL centrifuge tube with a 1mL or 200μL pipette. Add 10 mL of PBS, mix gently, centrifuge (1500 rpm, 15 min), and remove the supernatant. Resuspend in 6 mL of PBS, take 1 mL into individual cryopreservation tubes, centrifuge at 400 g, 15 min, 4°C, and remove the supernatant. Resuspend in 1 mL of Trizol, mix gently by pipetting, and store at -80°C.

[0104] 3. Peripheral monocyte transcriptome sequencing

[0105] 3.1 PBMC samples treated with Trizol were thawed on ice and 0.2 ml of chloroform was added per ml of sample. After shaking, the samples were placed at room temperature for 3-5 minutes, centrifuged at 4°C for 15 minutes (10000 g), the colorless aqueous phase was transferred to a clean centrifuge tube, 0.5 ml of isopropanol was added and placed at room temperature for 10 minutes. Subsequently, the samples were centrifuged at 4°C for 10 minutes (10000 g), the supernatant was discarded and 1 ml of pre-cooled 75% alcohol was added, the samples were resuspended and centrifuged at 4°C (8000 g) for 5 minutes, the supernatant was discarded, the samples were dried at room temperature, 20 μl of DEPC water was used to dissolve the samples and they were stored at -80°C for later use.

[0106] 3.2 After dissolving the RNA sample in the above step, dilute according to the concentration and aspirate 1-3 μg RNA sample for use in VAHTSUniversal V6 RNA-seq Library Prep Kit (Illumina, NR604-01 / 02) to construct an RNA-seq sequencing library.

[0107] 3.3 Use the Illumina Hisses X-Ten sequencing platform to perform double-end sequencing on the obtained RNA-seq library to obtain a sequencing file with a read length of 150 bp.

[0108] 4. Age-related gene screening and analysis

[0109] 4.1 Data Preprocessing

[0110] 4.1.1 Use TrimGlalore software (version 0.4.5) to remove the adapter from the original fastq file;

[0111] 4.1.2 Use HISAT2 software to align the processed fastq file to the hg19 human reference genome and obtain the alignment result file in bam format;

[0112] 4.1.3 Use the samtools tool to convert the bam file into a sam file;

[0113] 4.1.4 The alignment results with alignment scores > 20 were used to quantify gene expression using HTSeq software (version 0.11.0);

[0114] The quantitative matrix obtained in 4.1.5 is processed according to the following formula to obtain the TPM values ​​of all genes in each sample:

[0115]

[0116] Here, n is the number of all genes.

[0117] 4.2 Age-related gene screening

[0118] 4.2.1 First, the obtained TPM gene expression matrix was subjected to age correlation analysis, that is, Pearson correlation analysis was performed between each gene value and the individual's age, and BMI was used as a covariate;

[0119] 4.2.2 The results were screened and only those with BH-corrected P values ​​less than 0.05 were selected as age-related genes.

[0120] The analysis found 356 genes that were consistently upregulated with aging and 1372 genes that were consistently downregulated with aging ( Figure 1 , 2).

[0121] 5. Fluorescence quantitative PCR detection

[0122] For the aging-related genes such as LRRN3, CACHD1, NT5E, OXNAD1, and SATB1, which have significant changes and strong biological significance, quantitative PCR was used to evaluate the RNA of peripheral mononuclear cell samples from the population:

[0123] 5.1 Take 1-2 μg RNA and perform reverse transcription using a reverse transcription kit (R323, Vazyme). The obtained product is stored at -80 for later use;

[0124] 5.2 The above product was diluted 200 times with ddH2O, and 2.3 μl was mixed with 2.5 μl of SYBR mix (Novoprotein, E096-01S) and 0.2 μl of primers (0.1 μl each for forward and reverse primers) to prepare a 5 μl system, and detected using a real-time quantitative PCR instrument (Bio-Rad). The primer sequences are shown in Table 2.

[0125] The analysis found that in peripheral mononuclear cell samples based on healthy Chinese people, the four age-related genes LRRN3, CACHD1, NT5E, and SATB1 were significantly downregulated across age groups compared with other genes obtained from the co-validated analysis ( Figure 3-6 ).

[0126] Table 2 Primer sequences used for fluorescence quantitative PCR

[0127] name sequence H-LRRN3-F Positive AAGCCTCTTATCAATCTTCGCAG H-LRRN3-R Reverse CCAGTCCAACCAAGGCGTTA H-CACHD1-F Positive CATGCAGCGGATATTCAACTCC H-CACHD1-R Reverse TGCTTGTTCCGATTGACCACA H-NT5E-F Positive GCCTGGGAGCTTACGATTTTG H-NT5E-R Reverse TAGTGCCCTGGTACTGGTCG H-OXNAD1-F Positive GCTGCTGTTATGATTCCTGGG H-OXNAD1-R Reverse GAGTGTCAATCTCAGTGACGC H-RCAN3-F Positive CTTCACGCGGGAACAGAGTC H-RCAN3-R Reverse GCCTCGTCTGGGCAATTTT H-SATB1-F Positive GATCATTTGAACGAGGCAACTCA H-SATB1-R Reverse TGGACCCTTCGGATCACTCA H-TCF7-F Positive CTGGCTTCTACTCCCTGACCT H-TCF7-R Reverse ACCAGAACCTAGCATCAAGGA H-FCGR3A-F Positive CCTCCTGTCTAGTCGGTTTGG H-FCGR3A-R Reverse TCGAGCACCCTGTACCATTGA H-TBX21-F Positive GGTTGCGGAGACATGCTGA H-TBX21-R Reverse GTAGGCGTAGGCTCCAAGG H-PHLDA3-F Positive CTCTGTCCTGCAGACTGCTC H-PHLDA3-R Reverse GGTGAGTCCAGAGGCCATTC H-GZMB-F Positive CCCTGGGAAAACACTCACACA H-GZMB-R Reverse GCACAACTCAATGGTACTGTCG H-GZMH-F Positive CTGGCTGGGGTTATGTCTCAA H-GZMH-R Reverse GGCTACGTCCTTACACACGAG H-CD70-F Positive GCTTTGGTCCCATTGGTCG H-CD70-R Reverse CGTCCCACCCAAGTGACTC H-beta actin-F Positive CATGTACGTTGCTATCCAGGC H-beta actin-R Reverse CTCCTTAATGTCACGCACGAT H-LYPD2-F Positive CTGCGCTGCTACGTCTGTC H-LYPD2-R Reverse CACATGGTTTCGTTGGTGGT

[0128] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and substitutions may be made to those details based on all the teachings disclosed, and these changes are within the scope of protection of the present invention. The full scope of the present invention is given by the attached claims and any equivalents thereof.

Claims

1. A detection reagent or kit for detecting the expression level of the following genes in an individual biological sample: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof.

2. The detection reagent or kit according to claim 1, which is used for: i. Evaluate or assist in evaluating the rate or degree of aging of an individual; ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or iv. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

3. Use of a substance for detecting the expression level of the following genes in an individual biological sample in the preparation of a detection reagent or kit: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof, wherein the detection reagent or kit is used for: i. Evaluate or assist in evaluating the rate or degree of aging of an individual; ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or iv. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

4. Use of a substance that regulates (e.g., upregulates) the activity of the following genes in an individual in the preparation of a drug: LRRN3, CACHD1, NT5E, SATB1, or any combination thereof, wherein the drug is used to reduce the biological aging rate of the individual, and / or delay the onset of adverse age-related phenotypes, or reduce their severity, and / or prevent aging-related diseases, prevent or treat aging-related diseases.

5. An evaluation method comprising: (1) measuring the expression level of the following genes in the individual biological sample: LRRN3, CACHD1, NT5E, SATB1 or any combination thereof to obtain a measurement value; (2) Based on the measured values ​​and the individual's age, performing at least one of the following comparisons: a. Comparison of gene expression levels: 1) The measured value vs. the average expression level of the same gene in healthy people of the same age as the individual; or 2) the measured value vs. the expression level of the same gene in the individual at a certain time before or after the measurement; or b. Age comparison: the current age of an individual vs. the average age of a healthy population when the average expression level of the same gene in the healthy population is the same as the measured value; (3) Based on the comparison results of step (2), the following evaluation is performed: i. Evaluate or assist in evaluating the rate or degree of aging of an individual; ii. Evaluate or assist in evaluating the effectiveness of aging interventions for individuals; and / or iii. Assess or assist in assessing an individual's risk of developing a disease associated with aging; and / or iiii. Evaluate or assist in evaluating the therapeutic effects of aging-related diseases.

6. A drug screening method comprising: (1) Provide biological samples and divide them into test group and control group; (2) exposing the test group biological samples to the candidate compound; (3) analyzing the expression of the following genes in the biological samples of the test group: LRRN3, CACHD1, NT5E, SATB1, or any combination thereof, and comparing with that of the control group; If the expression level of the corresponding gene is increased compared with the control group, it is judged that the compound has the potential to inhibit or delay aging.

7. The method of claim 6, wherein the drug is used to reduce the biological aging rate of an individual, and / or delay the onset of adverse age-related phenotypes, or reduce their severity, and / or prevent age-related diseases.

8. The detection reagent or kit according to claim 1 or 2, the use according to claim 3 or 4, or the method according to any one of claims 5 to 7, wherein the individual is a mammal, preferably a human, more preferably an Asian, such as an East Asian or Southeast Asian, and further such as a Chinese.

9. The detection reagent or kit according to claim 1, the use according to claim 3, or the method according to claim 5 or 6, wherein the biological sample is from a mammal, preferably a human, more preferably an Asian, such as an East Asian or Southeast Asian, and more preferably a Chinese; Preferably, the biological sample is a peripheral mononuclear cell sample.

10. The detection reagent or kit according to claim 1, the use according to claim 3, or the method according to any one of claims 5 to 7, wherein the gene is negatively correlated with individual aging.

11. The detection reagent or kit according to claim 1, the use according to claim 3, or the method according to any one of claims 5 to 7, wherein the aging-related disease is selected from cardiovascular diseases, neurodegenerative diseases, diabetes or chronic obstructive pulmonary disease.

Images