Nucleic acid molecules, transcriptional elements, expression vectors, hosts and uses thereof

By constructing the EF-Tu promoter expression vector pYJB3-EFTu, the problem of low transformation efficiency of Bacillus megaterium was solved, achieving high-efficiency transformation and promoting its development in the remediation of PAE-contaminated soil and agricultural applications.

CN119331870BActive Publication Date: 2026-05-19JINAN UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411599588.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2026-05-19
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

The lack of highly active endogenous promoters in existing technologies leads to low transformation efficiency of Bacillus megaterium, making it difficult to achieve efficient transformation and limiting its potential for remediation of PAE-contaminated soils and agricultural applications.

Method used

The expression vector pYJB3-EFTu was constructed using the EF-Tu promoter. Its efficient promoter capability was utilized to achieve efficient transformation of Bacillus megaterium YJB3, thereby improving transformation efficiency through genetic engineering techniques.

Benefits of technology

This study achieved highly efficient transformation of Bacillus megaterium with a short timeframe, allowing for the screening of positive transformed strains in just 4 days. This improved transformation efficiency and enhanced its potential for applications in environmental remediation and agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119331870B_ABST
    Figure CN119331870B_ABST
Patent Text Reader

Abstract

The present application relates to the field of microorganism, especially to nucleic acid molecule, transcription element, expression vector, host and application thereof.The present application provides nucleic acid molecule, it has: the nucleotide sequence as shown in SEQ ID NO:1.The present application is through the genome of bacillus megaterium YJB3 and related bioinformatics analysis, find that the protein coded by transcription elongation factor Tu is a ribosome binding protein, plays the role of promoting aminoacyl-tRNA dependent GTP and ribosome A site binding in the process of protein biosynthesis.The present application is through the combination of molecular biology, genetics and biochemical analysis, further identify and find that EF-Tu promoter has high efficient starting capacity, and has no negative influence on the growth of bacillus megaterium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more particularly to nucleic acid molecules, transcription elements, expression vectors, hosts, and their applications. Background Technology

[0002] In agricultural production, the application of pesticides, fertilizers, and agricultural films to farmland, combined with industrial waste emissions, leads to the release of large amounts of PAEs (polyelastomers), causing increasingly severe farmland soil pollution. These pollutants are not only absorbed and accumulated by crops but also seriously threaten the quality and safety of agricultural products. PAEs are a class of endocrine disruptors with potential carcinogenic, teratogenic, and mutagenic effects. Long-term consumption of agricultural products rich in PAEs can lead to long-term low-dose exposure, seriously threatening human health. Bioremediation is one of the most direct solutions for PAE pollution in farmland soil. Compared with traditional physical and chemical remediation methods (such as topsoil replacement, chemical leaching, air stripping, and thermal treatment), bioremediation technology has the advantages of low cost, environmental friendliness, and high safety and efficiency. Bioremediation technologies mainly include microbial remediation, phytoremediation, and their combined remediation. Functional microorganisms capable of efficiently degrading PAEs can be screened from the external environment of plants or isolated from within plants.

[0003] Bacillus megaterium YJB3, screened from wild rice roots, shows promising potential as a bioremediation agent and can play a crucial role in the remediation of PAE-contaminated soils. This strain not only exhibits rapid growth and environmental adaptability, making it an ideal microbial resource, but also effectively degrades PAE organic pollutants in soil through its biodegradation capabilities, thereby reducing environmental harm and promoting the treatment and remediation of contaminated soils. Furthermore, as an important growth-promoting bacterium, Bacillus megaterium possesses the ability to synthesize and secrete secondary metabolites, which can significantly contribute to soil element activation, saline-alkali land improvement, and enhancement of plant disease resistance. Moreover, it is harmless to humans and animals, demonstrating significant value for engineering microbial development.

[0004] In summary, *Bacillus megaterium* is simple to culture and grows rapidly, making it an excellent bio-fertilizer and microbial agent, as well as an ideal host for related enzymes and important compounds. Genetic engineering is crucial to fully realize its potential in environmental remediation and agricultural applications. However, the lack of highly active endogenous promoters to drive transgenic expression is one of the main bottlenecks in achieving efficient transformation of *Bacillus megaterium* using traditional methods. This invention aims to improve the genetic transformation efficiency of *Bacillus megaterium* while ensuring no damage to the *Bacillus megaterium* itself.

[0005] Gene expression levels in bacteria are significantly influenced by the dynamic range of promoters. As core genomic elements of transcriptional regulation, promoters determine the intensity and timing of gene expression. The insertion or deletion of promoters can regulate gene expression, thus providing a foundation for studying bacterial gene function and metabolic regulation. Bacterial promoters possess conserved features, such as -35° and -10° regions, and binding sites for related transcription factors. These elements are crucial for the recruitment of RNA polymerase and transcription initiation.

[0006] Therefore, finding an efficient promoter is crucial for studying the gene function of Bacillus megaterium and exploring its potential for agricultural applications. Summary of the Invention

[0007] In view of this, the present invention provides nucleic acid molecules, transcription elements, expression vectors, hosts, and their applications. Through genomic and related bioinformatics analysis of *Bacillus megaterium* YJB3, the present invention discovered that the protein encoded by the transcription elongation factor Tu (EF-Tu) is a ribosome-binding protein that plays a role in promoting the binding of aminoacyl-tRNA-dependent GTP to the ribosomal A site during protein biosynthesis. The EF-Tu promoter contains several common functional elements, among which the TATA-box is a classic promoter element, usually associated with transcription initiation; the CAAT-box, as a common cis-acting element, plays a role in enhancing gene expression efficiency in promoter and enhancer regions. Further analysis combining molecular biology, genetics, and biochemical methods revealed that the EF-Tu promoter has highly efficient initiation capabilities and has no negative impact on the growth of *Bacillus megaterium*. Therefore, the present invention constructs an expression vector for *Bacillus megaterium* YJB3 using the EF-Tu promoter and names it the "pYJB3-EFTu" vector.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides a nucleic acid molecule having:

[0010] (1) A nucleotide sequence as shown in SEQ ID NO:1; or

[0011] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or

[0012] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0013] In some embodiments of the present invention, the sequence of SEQ ID NO:1 is: ttgattttcactctttattgaagtataactacttatgtacgctgtgaaagtggagctcattccctttcacggcctcataaaaa.

[0014] This invention also provides the application of the above-mentioned nucleic acid molecules as promoters.

[0015] The present invention also provides a transcription element comprising the aforementioned nucleic acid molecule and the target gene.

[0016] In some embodiments of the present invention, the transcription element described above further includes a cis-acting element.

[0017] The present invention also provides an expression vector comprising the above-described nucleic acid molecule or the above-described transcription element.

[0018] The present invention also provides a host for transforming or transfecting the above-mentioned expression vector.

[0019] In some embodiments of the present invention, the chassis strain transformed or transfected in the host includes Bacillus megaterium.

[0020] In some embodiments of the present invention, the host mentioned above includes Bacillus megaterium YJB3.

[0021] The present invention also provides the application of the above-mentioned nucleic acid molecules, transcription elements, expression vectors or hosts in improving the transformation efficiency of Bacillus megaterium.

[0022] This invention provides a nucleic acid molecule having:

[0023] (1) A nucleotide sequence as shown in SEQ ID NO:1; or

[0024] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or

[0025] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0026] The beneficial effects of this invention are:

[0027] (1) Bacillus megaterium has a relatively simple culture method and a fast growth rate, making it not only a good bio-fertilizer and microbial agent, but also an ideal host for related enzymes and important compounds. Genetic engineering technology plays a crucial role in fully exploring the potential of Bacillus megaterium in environmental treatment and industrial applications. However, the lack of highly active endogenous promoters to drive transgenic expression is one of the main obstacles to achieving efficient transformation of traditional Bacillus megaterium.

[0028] (2) Secondly, efficient transformation of Bacillus megaterium is achieved through genetic engineering.

[0029] (3) Most importantly, the time cycle is short. The EF-Tu promoter has high transformation efficiency, and the time from electroporation to transformation is only 4 days. Positive transformation strains can also be screened. See Figure 4 B in the middle. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0031] Figure 1 Analysis of the pYJB3-EFTu starter component;

[0032] Figure 2 This shows the conversion plate of the EF-Tu promoter before optimization;

[0033] Figure 3 Showing the EF-Tu promoter sequence Blast alignment results;

[0034] Figure 4 The image shows a plate of eYFP transformed bacteria; where: A represents wild-type bacteria; B represents eYFP transformed bacteria; C represents yeast; and D represents Escherichia coli.

[0035] Figure 5 Molecular identification of EYFP wild-type bacteria;

[0036] Figure 6 Molecular identification of EYFP transformant bacteria. Detailed Implementation

[0037] This invention discloses nucleic acid molecules, transcription elements, expression vectors, hosts, and their applications.

[0038] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0039] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0040] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0041] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0042] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0043] This invention, through genomic and bioinformatics analysis of Bacillus megaterium YJB3, discovered that the protein encoded by transcription elongation factor Tu (EF-Tu) is a ribosome-binding protein that promotes the binding of aminoacyl-tRNA-dependent GTP to the ribosomal A site during protein biosynthesis. The EF-Tu promoter contains several common functional elements, including the classic TATA-box, which is typically associated with transcription initiation; and the CAAT-box, a common cis-regulatory element, which enhances gene expression efficiency in promoter and enhancer regions. Further analysis using molecular biology, genetics, and biochemical methods confirmed that the EF-Tu promoter possesses highly efficient initiation capabilities and has no negative impact on the growth of Bacillus megaterium. Therefore, this study used the EF-Tu promoter to construct an expression vector for Bacillus megaterium YJB3, which was named "pYJB3-EFTu".

[0044] The Bacillus megaterium YJB3 mentioned in this invention is an endophytic bacterium screened by our research group from Canna indica L. grown in an artificial wetland. Its preservation information is as follows: depositary institution: China Center for Type Culture Collection (CCTCC), deposit date: June 28, 2017, deposit address: Wuhan University, Wuhan, China, accession number: CCTCCNO:M 2017389.

[0045] In Examples 1 to 3 of this invention, all raw materials and reagents used can be purchased from the market.

[0046] The present invention will be further illustrated below with reference to the embodiments:

[0047] Example 1

[0048] Based on our self-developed promoter prediction software (wePromoter), combined with genomic data, we identified the elongation factor Tu (EF-Tu) promoter and constructed a highly efficient genetic transformation system for Bacillus megaterium. First, we constructed an EF-Tu overexpression vector for Bacillus megaterium, such as... Figure 1 As shown, the elongation factor Tu (EF-Tu) promoter includes the TATA-box, a classic promoter element that is usually associated with transcription initiation. The TATA-box, as a widely distributed cis-acting element, plays an important role in promoter and enhancer regions, enhancing gene expression efficiency.

[0049] Furthermore, proper selection and optimization of promoters can improve gene transcription efficiency, thereby achieving high expression of the target gene. No colonies were observed in the transformation plates using the unoptimized EF-Tu promoter. Figure 2 Therefore, we perform codon optimization on the EF-Tu promoter sequence. Figure 3 The results of Blast alignment of the EF-Tu promoter sequence.

[0050] Example 2

[0051] Electroporation of the pYJB3-EFTu vector yielded a large number of transformed strains (e.g., ...) within 4 days. Figure 4 (As shown in B). No colonies were observed in wild-type Bacillus megaterium (WT), yeast, or Escherichia coli. This indicates that we have obtained a positive clone.

[0052] Example 3

[0053] To verify transcription levels, we extracted RNA from wild-type and transformed strains and performed reverse transcription to obtain cDNA. Subsequently, PCR amplification was performed using eYFP-F and eYFP-R primers. The results showed a 750 bp eYFP band in the transformed strain, while this band was not detected in the wild-type strain. This indicates that the pYJB3-EFTu promoter successfully drove the expression of the target gene eYFP. (e.g.) Figure 5 and Figure 6 (As shown).

[0054] The above results confirm that the pYJB3-EFTu vector constructed using the EF-Tu promoter was efficiently expressed in Bacillus megater YJB3, verifying the application value of this promoter.

[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A promoter, characterized in that, Its nucleotide sequence is as shown in SEQ ID NO:

1.

2. The application of the promoter as described in claim 1 in improving the transformation efficiency of Bacillus megaterium YJB3.

3. A transcription element, characterized in that, Includes the promoter and target gene as described in claim 1 or above.

4. The transcription element as claimed in claim 3, characterized in that, It also includes cis-acting elements.

5. An expression vector, characterized in that, This includes the promoter as described in claim 1 or the transcription element as described in claim 3 or 4.

6. The host, characterized in that, It includes the expression vector as described in claim 5; the host is Bacillus megaterium YJB3.

7. The application of the transcription element as described in claim 3 or 4, the expression vector as described in claim 5, or the host as described in claim 6 in improving the transformation efficiency of Bacillus megaterium YJB3.