Systems targeting engineered receptors of PSMA and CA9

Abstract

Provided herein are chimeric initiation receptors that bind to PSMA and chimeric antigen receptors that bind to CA9. Also provided are systems that bind to a chimeric initiator receptor of PSMA and a chimeric antigen receptor of CA9, cells expressing such systems, and methods of their use.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 342,947, filed May 17, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted through Patent Center and is hereby incorporated by reference in its entirety. The ASCII copy was created in XX / XX / 20XX, is named XXXXXUS_sequencelisting.txt, and is X,XXX,XXX bytes in size. Background Art

[0005] Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches have been tried to treat cancer, including drugs and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give the T cells new abilities to target specific proteins. These receptors are chimeric because they combine antigen binding with T cell activation functions into a single receptor.

[0006] Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells so that they can be targeted and destroyed more effectively.

[0007] After engineering T cells with CAR, the resulting CAR-T cells are introduced into the patient to attack tumor cells. CAR-T cells can be derived from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). Once CAR-T cells are injected into the patient, they come into contact with the targeted antigen on the cells. CAR-T cells bind to the antigen and become activated. After antigen binding, CAR T cells can proliferate exponentially, initiating the production of tumor cytokines and the killing of target tumor cells.

[0008] However, there are still some problems and limitations with CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of target antigens, leading to off-target toxicity. Therefore, additional therapies are needed to reduce off-target toxicity. Summary of the invention

[0009] In one aspect, provided herein is a triggering receptor comprising an extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector, wherein the extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, CDR-H2 comprises the sequence shown in SEQ ID NO: 2, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, CDR-L2 comprises the sequence shown in SEQ ID NO: 5, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6.

[0010] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:7.

[0011] In some embodiments, VL comprises the sequence shown in SEQ ID NO:8.

[0012] In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO:9.

[0013] In one aspect, provided herein is a chimeric antigen receptor (CAR), comprising an extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14, and CDR-L3 comprises the sequence shown in SEQ ID NO: 15.

[0014] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:16.

[0015] In some embodiments, VL comprises the sequence shown in SEQ ID NO:17.

[0016] In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO:18.

[0017] In one aspect, provided herein is a system comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a triggering receptor, the triggering receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the first extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6; and the second chimeric polypeptide comprises a chimeric antigen receptor (CAR).

[0018] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:7.

[0019] In some embodiments, the VL chain sequence comprises the sequence shown in SEQ ID NO:8.

[0020] In some embodiments, the first extracellular antigen binding domain comprises the sequence shown in SEQ ID NO:9.

[0021] In some embodiments, the CAR comprises a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9).

[0022] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14, and CDR-L3 comprises the sequence shown in SEQ ID NO: 15.

[0023] In some embodiments, VH comprises the sequence shown in SEQ ID NO:16.

[0024] In some embodiments, VL comprises the sequence shown in SEQ ID NO:17.

[0025] In some embodiments, the second extracellular domain comprises the sequence shown in SEQ ID NO:18.

[0026] In one aspect, provided herein is a system comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a triggering receptor, and the second chimeric polypeptide comprises a chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the extracellular antigen binding domain comprises a single domain antibody, the single domain antibody comprising a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: NO:14, and CDR-L3 comprises the sequence shown in SEQ ID NO:15.

[0027] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:16.

[0028] In some embodiments, VL comprises the sequence shown in SEQ ID NO:17.

[0029] In some embodiments, the second extracellular domain comprises the sequence shown in SEQ ID NO:18.

[0030] In some embodiments, the activating receptor comprises a first extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA).

[0031] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO:1, CDR-H2 comprises the sequence shown in SEQ ID NO:2, CDR-H3 comprises the sequence shown in SEQ ID NO:3, CDR-L1 comprises the sequence shown in SEQ ID NO:4, CDR-L2 comprises the sequence shown in SEQ ID NO:5, and CDR-L3 comprises the sequence shown in SEQ ID NO:6.

[0032] In some embodiments, VH comprises the sequence shown in SEQ ID NO:7.

[0033] In some embodiments, VL comprises the sequence shown in SEQ ID NO:8.

[0034] In some embodiments, the second extracellular domain comprises the sequence shown in SEQ ID NO:9.

[0035] In one aspect, provided herein is a system comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a triggering receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA); and the second chimeric polypeptide comprises a CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9).

[0036] In some embodiments, the first chimeric polypeptide comprises a triggering receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the first extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2, and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2, and CDR-L3, wherein: CDR-H1 comprises the sequence set forth in SEQ ID NO:1, CDR-H2 comprises the sequence set forth in SEQ ID NO:2, CDR-H3 comprises the sequence set forth in SEQ ID NO:3, CDR-L1 comprises the sequence set forth in SEQ ID NO:4, CDR-L2 comprises the sequence set forth in SEQ ID NO:5, and CDR-L3 comprises the sequence set forth in SEQ ID NO:6.

[0037] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:7.

[0038] In some embodiments, VL comprises the sequence shown in SEQ ID NO:8.

[0039] In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO:9.

[0040] In some embodiments, the initiating receptor comprises, from N-terminus to C-terminus: a first extracellular antigen binding domain; a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector, wherein binding of the first extracellular antigen binding domain to PSMA results in cleavage at the one or more ligand-inducible proteolytic cleavage sites.

[0041] In some embodiments, the triggering receptor further comprises a first hinge domain positioned between the first extracellular antigen binding domain and the first transmembrane domain.

[0042] In some embodiments, the first hinge domain comprises CD8α or a truncated CD8α hinge domain.

[0043] In some embodiments, the first hinge comprises the sequence shown as SEQ ID NO:19.

[0044] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.

[0045] In some embodiments, the first transmembrane domain comprises the sequence shown as SEQ ID NO:20.

[0046] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0047] In some embodiments, the intracellular domain comprises the sequence shown in SEQ ID NO:24.

[0048] In some embodiments, the initiator receptor further comprises a termination transfer sequence or a juxtamembrane domain between the first transmembrane domain and the intracellular domain.

[0049] In some embodiments, the stop transfer sequence or the juxtamembrane domain comprises the sequence shown in SEQ ID NO:21.

[0050] In some embodiments, the trigger receptor comprises the sequence shown in SEQ ID NO:25.

[0051] In some embodiments, the CAR comprises, from N-terminus to C-terminus, a second extracellular antigen binding domain; a second transmembrane domain; an intracellular co-stimulatory domain; and an intracellular activation domain.

[0052] In some embodiments, the second extracellular antigen-binding domain specifically binds to carbonic anhydrase IX (CA9), wherein the second extracellular antigen-binding domain comprises a single domain antibody, the single domain antibody variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14, and CDR-L3 comprises the sequence shown in SEQ ID NO: 15.

[0053] In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO:16.

[0054] In some embodiments, VL comprises the sequence shown in SEQ ID NO:17.

[0055] In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO:18.

[0056] In some embodiments, the CAR comprises a second hinge domain.

[0057] In some embodiments, the second hinge domain comprises CD8α or a truncated CD8α hinge domain.

[0058] In some embodiments, the second transmembrane domain comprises a CD8 alpha transmembrane domain.

[0059] In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain.

[0060] In some embodiments, the intracellular activation domain comprises a CD3 zeta domain.

[0061] In some embodiments, the CAR comprises the sequence shown in SEQ ID NO:31.

[0062] In some embodiments, if the target cell expresses PSMA and CA9, the activating receptor and the CAR are capable of binding to the same target cell.

[0063] In some embodiments, the target cell is a human cell.

[0064] In some embodiments, the target cell is a cancer cell.

[0065] In some embodiments, the cancer cell is a solid cancer cell or a liquid cancer cell.

[0066] In some embodiments, the cancer cell is renal cell carcinoma.

[0067] In one aspect, provided herein is one or more recombinant nucleic acids, comprising at least one nucleic acid fragment, wherein the at least one nucleic acid fragment comprises a nucleotide sequence encoding a trigger receptor disclosed herein, a CAR disclosed herein and / or a system disclosed herein.

[0068] In one aspect, the present invention provides one or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a trigger receptor, the trigger receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA); a second chimeric polypeptide comprising a CAR, the CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9); and at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence shown in SEQ ID NO: 39, a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO: 40, and a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence shown in SEQ ID NO: 41.

[0069] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO:1, CDR-H2 comprises the sequence shown in SEQ ID NO:2, CDR-H3 comprises the sequence shown in SEQ ID NO:3, CDR-L1 comprises the sequence shown in SEQ ID NO:4, CDR-L2 comprises the sequence shown in SEQ ID NO:5, and CDR-L3 comprises the sequence shown in SEQ ID NO:6.

[0070] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14; and CDR-L3 comprises the sequence shown in SEQ ID NO: 15.

[0071] In one aspect, the present invention provides one or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a trigger receptor, the trigger receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, CDR-H2 comprises the sequence shown in SEQ ID NO: 2, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, CDR-L2 comprises the sequence shown in SEQ ID NO: 5, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6. NO:6; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence, which is complementary to nucleotides 1126 to 1364 of an mRNA encoding a human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence, which is complementary to nucleotides 518 to 559 of an mRNA encoding a human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence, which is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0072] In one aspect, the present invention provides one or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a activating receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14, and CDR-L3 comprises the sequence shown in SEQ ID NO: NO:15; and at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence, which is complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence, which is complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence, which is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-related high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0073] In some embodiments, the first extracellular antigen-binding domain VH chain sequence comprises the sequence shown in SEQ ID NO:7.

[0074] In some embodiments, the first extracellular antigen-binding domain VL chain sequence comprises the sequence shown in SEQ ID NO:8.

[0075] In some embodiments, the first extracellular antigen binding domain comprises the sequence shown in SEQ ID NO:9.

[0076] In some embodiments, the second extracellular antigen-binding domain VH chain sequence comprises the sequence shown in SEQ ID NO:16.

[0077] In some embodiments, the second extracellular antigen binding domain VL chain sequence comprises the sequence shown in SEQ ID NO:17.

[0078] In some embodiments, the second extracellular antigen binding domain comprises the sequence shown in SEQ ID NO:18.

[0079] In some embodiments, the first nucleic acid sequence is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39.

[0080] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:40.

[0081] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 1294 to 2141 of the mRNA encoding human TOX comprising the sequence shown in SEQ ID NO:41.

[0082] In some embodiments, the at least one nucleic acid sequence comprises the following: (1) a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39; and (2) a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:40.

[0083] In some embodiments, the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0084] In some embodiments, the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0085] In some embodiments, the at least one nucleic acid sequence is a shRNA.

[0086] In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs:42-71.

[0087] In some embodiments, the first nucleic acid comprises the sequence shown in SEQ ID NO:49.

[0088] In some embodiments, the first nucleic acid reduces expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the nucleic acid.

[0089] In some embodiments, the second nucleic acid comprises a sequence selected from the group consisting of sequences shown as SEQ ID NOs:72-97.

[0090] In some embodiments, the second nucleic acid comprises the sequence shown in SEQ ID NO:82.

[0091] In some embodiments, the second nucleic acid reduces expression of PTPN2 in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the nucleic acid.

[0092] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of sequences shown as SEQ ID NOs: 98-125.

[0093] In some embodiments, the third nucleic acid comprises the sequence shown in SEQ ID NO:99 or 104.

[0094] In some embodiments, the third nucleic acid reduces expression of TOX in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the third nucleic acid.

[0095] In some embodiments, the at least one nucleic acid sequence is a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 157-164.

[0096] In some embodiments, the at least one nucleic acid sequence is encoded in at least one intronic region of the recombinant nucleic acid.

[0097] In one aspect, provided herein is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA, and a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9.

[0098] In some embodiments, a recombinant nucleic acid comprises two or more nucleic acid fragments.

[0099] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

[0100] In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to a nucleotide sequence encoding a promoter receptor.

[0101] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor.

[0102] In some embodiments, the constitutive promoter is EF1α.

[0103] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: a constitutive promoter; a nucleotide sequence encoding a promoter receptor; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0104] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a constitutive promoter; and a nucleotide sequence encoding a promoter receptor.

[0105] In some embodiments, the recombinant nucleic acid comprises in the 5' to 3' direction: a first constitutive promoter; a nucleotide sequence encoding a promoter receptor; a second constitutive promoter; a nucleotide sequence encoding at least one nucleic acid complementary to human FAS, human PTPN2 or human TOX; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0106] In some embodiments, the recombinant nucleic acid comprises in the 5' to 3' direction: a first constitutive promoter; a nucleotide sequence encoding a promoter receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid complementary to human FAS; a nucleotide sequence encoding a second nucleic acid or a third nucleic acid complementary to human PTPN2 or TOX; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor.

[0107] In some embodiments, the recombinant nucleic acid comprises in the 5' to 3' direction: an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a second constitutive promoter; a nucleotide sequence encoding a first nucleic acid complementary to human FAS; a nucleotide sequence encoding a second nucleic acid or a third nucleic acid complementary to human PTPN2 or TOX; a first constitutive promoter; and a nucleotide sequence encoding a promoter receptor.

[0108] In some embodiments, the nucleotide sequence encoding the activating receptor comprises the sequence shown in SEQ ID NO:26.

[0109] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence shown in SEQ ID NO:32.

[0110] In some embodiments, the nucleotide sequences encoding the priming receptor and the chimeric antigen receptor comprise the sequence shown in SEQ ID NO:36.

[0111] In some embodiments, the nucleic acid further comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm that are complementary to the insertion site in the host cell chromosome.

[0112] In some embodiments, the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-immolative 2A peptide (P2A).

[0113] In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0114] In some embodiments, P2A is 3' to the nucleotide sequence encoding the priming receptor.

[0115] In some embodiments, the recombinant nucleic acid further comprises a Woodchuck Hepatitis Virus Post-Translational Regulatory Element (WPRE).

[0116] In some embodiments, the WPRE is 3' to the nucleotide sequence encoding the chimeric antigen receptor and 5' to the nucleotide sequence encoding the priming receptor, or wherein the WPRE is 3' to the nucleotide sequence encoding the priming receptor and 5' to the nucleotide sequence encoding the chimeric antigen receptor.

[0117] In some embodiments, the recombinant nucleic acid further comprises an SV40 polyA element.

[0118] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector.

[0119] In some embodiments, the expression vector is a non-viral vector.

[0120] In one aspect, provided herein is an expression vector comprising a recombinant nucleic acid disclosed herein.

[0121] In some embodiments, the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking the insertion site in the genome of the primary cell.

[0122] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0123] In one aspect, provided herein is an immune cell comprising: a system disclosed herein; at least one recombinant nucleic acid disclosed herein; and / or a vector disclosed herein.

[0124] In some embodiments, the immune cells are primary human immune cells.

[0125] In some embodiments, the immune cells are allogeneic immune cells.

[0126] In some embodiments, the immune cells are autologous immune cells.

[0127] In some embodiments, the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

[0128] In some embodiments, the primary immune cells are primary T cells.

[0129] In some embodiments, the primary immune cells are primary human T cells.

[0130] In some embodiments, the primary immune cells are virus-free.

[0131] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid comprising: a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9, the recombinant nucleic acid being inserted into a target region of the genome of the primary immune cell, and wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0132] In one aspect, provided herein are live, virus-free primary cells comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises: a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9, and wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking the insertion site in the genome of the primary cell.

[0133] In some embodiments, the invention further comprises at least one nucleic acid sequence having a length of at least 15 nucleotides, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence which is complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence which is complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence which is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0134] In one aspect, provided herein is a cell population comprising a plurality of immune cells disclosed herein.

[0135] In one aspect, provided herein is a pharmaceutical composition comprising an immune cell disclosed herein or a population disclosed herein, and a pharmaceutically acceptable excipient.

[0136] In one aspect, provided herein is a pharmaceutical composition comprising a recombinant nucleic acid disclosed herein or a vector disclosed herein, and a pharmaceutically acceptable excipient.

[0137] In one aspect, provided herein is a method for editing an immune cell, the method comprising: providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises a recombinant nucleic acid disclosed herein, and wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking an insertion site in the immune cell genome; introducing the RNP-recombinant nucleic acid complex into the immune cell in a non-viral manner, wherein the guide RNA specifically hybridizes to a target region of the primary immune cell genome, and wherein the nuclease domain cleaves the target region to generate an insertion site in the immune cell genome; and editing the immune cell by inserting the recombinant nucleic acid disclosed herein into the insertion site in the immune cell genome.

[0138] In some embodiments, introducing by a non-viral means comprises electroporation.

[0139] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0140] In some embodiments, the target region of the genome of the cell is a T cell receptor alpha constant (TRAC) locus or a genomic safe harbor (GSH) locus.

[0141] In some embodiments, the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.

[0142] In some embodiments, the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.

[0143] In some embodiments, the immune cells are primary human immune cells.

[0144] In some embodiments, the immune cells are autologous immune cells.

[0145] In some embodiments, the immune cells are allogeneic immune cells.

[0146] In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

[0147] In some embodiments, the immune cells are primary T cells.

[0148] In some embodiments, the immune cells are primary human T cells.

[0149] In some embodiments, the immune cells are virus-free.

[0150] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the recombinant nucleic acid in vitro.

[0151] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell disclosed herein or a pharmaceutical composition disclosed herein.

[0152] In some embodiments, the disease is cancer.

[0153] In some embodiments, the cancer is a solid cancer or a liquid cancer.

[0154] In some embodiments, the cancer is renal cell carcinoma.

[0155] In some embodiments, administering the immune cells enhances the immune response of the subject.

[0156] In some embodiments, the enhanced immune response is an adaptive immune response.

[0157] In some embodiments, the enhanced immune response is an innate immune response.

[0158] In some embodiments, the enhanced immune response is increased expression of at least one cytokine or chemokine.

[0159] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ.

[0160] In some embodiments, the method comprises administering immunotherapy to the subject simultaneously with or after the immune cells.

[0161] In one aspect, provided herein is a method of inhibiting a target cell in a subject, the method comprising administering to the subject an immune cell disclosed herein, wherein the immune cell inhibits the target cell.

[0162] In some embodiments, the target cells express PSMA and CA9.

[0163] In some embodiments, the target cell is a cancer cell.

[0164] In one aspect, provided herein is a method of inducing expression of a chimeric antigen receptor and a triggering receptor in an immune cell, the method comprising: obtaining an immune cell comprising a system disclosed herein, a recombinant nucleic acid disclosed herein, and / or a vector disclosed herein; and contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the triggering receptor to PSMA on the target cell induces activation of the triggering receptor and expression of the chimeric antigen receptor.

[0165] In one aspect, provided herein is a method of modulating the activity of an immune cell, the method comprising: obtaining an immune cell comprising a system disclosed herein, a recombinant nucleic acid disclosed herein, and / or a vector disclosed herein; and contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the activating receptor to PSMA on the target cell induces activation of the activating receptor and expression of a chimeric antigen receptor, and wherein binding of the chimeric antigen receptor to CA9 on the target cell modulates the activity of the immune cell.

[0166] In some embodiments, modulation of immune cell activity comprises enhancing an immune response.

[0167] In some embodiments, the enhanced immune response is an adaptive immune response.

[0168] In some embodiments, the enhanced immune response is an innate immune response.

[0169] In some embodiments, the immune cell activity is increased expression of at least one cytokine or chemokine.

[0170] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. BRIEF DESCRIPTION OF THE DRAWINGS

[0171] These and other features, aspects and advantages of the present invention will be better understood with reference to the following description and accompanying drawings, in which:

[0172] Figure 1A A diagram of the CA9 and PSMA logic gate (LG) circuits is provided. Figure 1B Shown is the expression of the PSMA primed receptor (PrimeR) in primary human T cells.

[0173] Figure 2 Engineered T cells are shown to induce CAR expression after co-culture with PSMA-expressing target cells.

[0174] Figure 3A The engineered T cells were shown to secrete IFNg after co-culture with target cells expressing both PSMA and CA9, but not after co-culture with cells expressing only CA9; Figure 3B The engineered T cells were shown to secrete IL-2 after co-culture with target cells expressing both PSMA and CA9, but not after co-culture with cells expressing only CA9.

[0175] Figure 4 Shown is the expression of PSMA and CA9 on target cell lines K562 and 786-O expressing PSMA (K562), CA9 (K562), or both (786-O PSMA / CA9). In addition to the isotype control, the MSLN antibody was used as a negative control. DETAILED DESCRIPTION

[0176] definition

[0177] Unless otherwise defined, the terms used in the claims and specification are defined as set out below.

[0178] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a DNA segment arranged along a chromosome, which encodes a specific protein or protein segment. A gene generally includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optional introns, and a 3' untranslated region. A gene may also include a terminator, an enhancer, and / or a silencer.

[0179] As used herein, the term "locus" refers to the specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0180] The term "safe harbor locus" refers to a locus into which a gene or genetic element can be incorporated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, a safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgenic as defined herein can be inserted. In some embodiments, insertion occurs with displacement of the sequence located at the integration site. In some embodiments, insertion occurs without displacement of the sequence located at the integration site. Examples of envisioned integration sites are provided in Table D.

[0181] As used herein, the term "insert" refers to a nucleotide sequence integrated (inserted) into a target locus or safe harbor site. An insert can be used to refer to a gene or genetic element that is incorporated into a target locus or safe harbor site using, for example, homology directed repair (HDR) CRISPR / Cas9 genome editing or other methods known to those of ordinary skill in the art for inserting nucleotide sequences into genomic regions.

[0182] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This is accomplished, for example, by using restriction enzymes and ligases, whereby a target DNA sequence that typically encodes a target gene can be incorporated into another nucleic acid molecule by digesting the two molecules with appropriate restriction enzymes to produce a compatible overlap, and then joining the molecules together using a ligase. Those skilled in the art are very familiar with such manipulations, examples of which can be found in Sambrook et al. (Sambrook, Fritsch and Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which are hereby incorporated by reference in their entirety, including any drawings, figures and tables.

[0183] "CRISPR / Cas" system refers to a class of bacterial systems widely used to defend against foreign nucleic acids. CRISPR / Cas systems are widely present in eubacteria and archaebacterial organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. The wild-type type II CRISPR / Cas system utilizes a complex of RNA-mediated nuclease Cas9 and guidance and activating RNA to recognize and cleave foreign nucleic acids. Guide RNAs with the activity of both guide RNA and activating RNA are also known in the art. In some cases, this dual-activity guide RNA is referred to as a small guide RNA (sgRNA).

[0184] Cas9 homologs exist in a variety of true bacteria, including but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydia-Verrucom icrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi et al., RNA Biol. 2013 May 1; 10(5):726-737; Nat. Rev. Microbiol. 2011 Jun; 9(6):467-477; Hou et al., Proc Natl Ac ad Sci USA. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek et al., Science. 2012 Aug 17; 337(6096):816-21. The Cas9 nuclease domain can be optimized to increase activity in host cells or enhance stability.

[0185] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin, or derived therefrom). Exemplary RNA-mediated nucleases include the above-mentioned Cas9 proteins and homologs thereof, and include but are not limited to CPF1 (see, e.g., Zetsche et al., Cell, Vol. 163, No. 3, p759-771, October 22, 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and crRNA (e.g., a guide RNA or a small guide RNA), a complex between a Cas9 protein and a trans-activating crRNA (tracrRNA), a complex between a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0186] As used herein, the phrase "immune cell" includes all cell types that can produce immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells and induced pluripotent stem cells (iPSC). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor cell or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0187] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not yet been transformed or immortalized. Such primary cells can be cultured, subcultured or passed down a limited number of times (e.g., culture 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times). In some cases, primary cells adapt to in vitro culture conditions. In some cases, primary cells are separated from organisms, systems, organs or tissues, optionally sorted and utilized, such as directly used without culture or subculture. In some cases, primary cells are stimulated, activated or differentiated. For example, primary T cells can be activated by contacting (e.g., existing during culture) CD3, CD28 agonists, IL-2, IFN-γ or a combination thereof.

[0188] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and recognize certain foreign antigens in the body. These terms also refer to the main types of white blood cells that have various roles in the immune system, including activation and inactivation of other immune cells. T cells can be any T cells, such as cultured T cells, for example primary T cells, or T cells derived from cultured T cell lines, such as Jurkat, SupT1, etc., or T cells obtained from mammals. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subsets thereof. T cells can be CD3+ cells. T cells can be CD4 + 、CD8 + or CD4 + and CD8 +. T cells can be any type of T cells, CD4+ / CD8+ double positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral (including but not limited to) blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, γδT cells, etc. It can be any T cell at any stage of development. Other types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Other types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically modified T cells, such as T cells modified to express T cell receptors (TCR) or chimeric antigen receptors (CAR). T cells can also be differentiated from stem cells or progenitor cells.

[0189] "CD4+T cells" refers to a T cell subset that expresses CD4 on its surface and is associated with a cellular immune response. CD4+T cells are characterized by secretory properties after stimulation, which may include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55kD glycoprotein that was originally defined as a differentiation antigen on T lymphocytes, but is also present on other cells including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and is considered to be an associated recognition element in the MHC (major histocompatibility complex) class II restricted immune response. On T lymphocytes, the CD4 antigen defines a helper / inducer subset.

[0190] "CD8+ T cells" refers to a subpopulation of T cells that express CD8 on their surface, are restricted by MHC class I, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is a cognate recognition element in the major histocompatibility complex class I restricted interaction.

[0191] As used herein, the phrase "hematopoietic stem cell" refers to a stem cell that can produce blood cells. Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can be isolated from peripheral blood or a portion thereof. Various cell surface markers can be used to identify, sort, or purify hematopoietic stem cells. In some cases, a hematopoietic stem cell is identified as c-kit. + Helin - In some cases, human hematopoietic stem cells are identified as CD34 + 、CD59+ , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, human hematopoietic stem cells are identified as CD34 - 、CD59 + , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, human hematopoietic stem cells are identified as CD133 + 、CD59 + , Thy1 / CD90 + 、CD38 lo / - 、C-kit / CD117 + ,lin - In some cases, mouse hematopoietic stem cells were identified as CD34 lo / - 、SCA-1 + 、Thy1 + / lo 、CD38 + 、C-kit + ,lin - In some cases, the hematopoietic stem cell is CD150 + CD48 - CD244 - .

[0192] As used herein, the phrase "hematopoietic cell" refers to a cell derived from a hematopoietic stem cell. Hematopoietic cells can be obtained or provided by separation from an organism, system, organ or tissue (e.g., blood or a portion thereof). Alternatively, hematopoietic stem cells can be separated and obtained or provided by differentiation of stem cells. Hematopoietic cells include cells that are differentiated into other cell types with limited potential. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common bone marrow progenitor cells, granulocyte-macrophage progenitor cells or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include cells of lymphatic and bone marrow lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes and platelets.

[0193] With respect to the binding of an antibody to a target molecule, the terms "binding", "specifically binding", "specifically binding to", "specifically binding to", "specific for", "selectively binding to", and "selectively for" a specific antigen (e.g., a polypeptide target) or an epitope on a specific antigen refer to a binding that is measurably different from a non-specific or non-selective interaction (e.g., with a non-target molecule). For example, an antibody that "selectively binds" or "specifically binds" an antigen is an antigen binding portion that binds the antigen with high affinity and does not significantly bind to other unrelated antigens. For example, specific binding can be measured by measuring binding to a target molecule and comparing it to binding to a non-target molecule. Specific binding can also be measured by competition with a control molecule that simulates an epitope recognized on a target molecule. In this case, if the binding of the antibody to the target molecule is competitively inhibited by the control molecule, specific binding is indicated. In some embodiments, the extracellular antigen binding domain specifically binds to a prostate-specific membrane antigen. In some embodiments, the extracellular domain comprises an antigen binding portion that binds to a prostate-specific membrane antigen.

[0194] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X for its partner Y can be expressed by the dissociation equilibrium constant (K D ). The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including but not limited to surface plasmon resonance (SPR) technology (e.g., ) or biolayer interferometry (e.g. ).

[0195] The term "hypervariable region" or "HVR" as used herein refers to each of the regions of an antibody variable domain that are highly variable in sequence and / or form structurally defined loops ("hypervariable loops"). Typically, a natural four-chain antibody comprises six HVRs; three in VH (H1, H2, H3) and three in VL (L1, L2, L3). HVRs typically comprise amino acid residues from hypervariable loops and / or from complementary determining regions (CDRs) that have the highest sequence variability and / or are involved in antigen recognition. In addition to CDR1 in VH, CDRs typically comprise amino acid residues that form hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity determining regions" (CDRs), and these terms are used interchangeably herein with respect to portions of the variable regions that form antigen binding regions. This particular region has been described by Kabat et al., USDept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and by Chothia et al., J Mol Biol 196: 901-917 (1987), wherein the definitions include overlaps or subgroups of amino acid residues when compared relative to each other. However, the application of any definition to refer to the CDR of an antibody or its variants is intended to be within the scope of the term as defined and used herein. The exact number of residues covering a particular CDR will vary depending on the sequence and size of the CDR. In view of the variable region amino acid sequence of an antibody, those skilled in the art can determine in a conventional manner which residues constitute a particular CDR.

[0196] The amino acid sequence boundaries of a CDR can be determined by one of skill in the art using any of a number of known numbering schemes, including those by Kabat et al. (supra) ("Kabat" numbering scheme); Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 ("Chothia" numbering scheme); Martin (Enhanced Chothia or AbM); Abhinandan and Martin, Mol. Immunol. 2008 Aug;45(14):3832-9; MacCallum et al., 1996, J. Mol. Biol. 262:732-745 ("Contact" numbering scheme); Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 ("IMGT" numbering scheme); and those described by Honegge and Plückthun, J. Mol. Biol., 2001, 309:657-70 ("AHo" numbering scheme); each of which is incorporated herein by reference in its entirety.

[0197] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3 as identified by the Kabat, Chothia, AbM, Contact and IMGT schemes. For CDR-H1, residue numbers using both the Kabat numbering scheme and the Chothia numbering scheme are provided.

[0198] CDRs can be assigned, for example, using antibody numbering software such as Abnum available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, which is incorporated herein by reference in its entirety. Descriptions of various antibody numbering schemes can be found at bioinf.org.uk / abs / info.html.

[0199] Table A. Residues in the CDRs according to the indicated numbering scheme.

[0200]

[0201] *When numbered using the Kabat numbering convention, the C-terminus of CDR-H1 varies between H32 and H34, depending on the length of the CDR.

[0202] When referring to residues in the antibody heavy chain constant region, the "EU numbering scheme" is generally used (e.g. as reported in Kabat et al. (supra)). Unless otherwise stated, the EU numbering scheme is used to refer to residues in the antibody heavy chain constant region described herein.

[0203] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In a specific described embodiment, in a single-chain Fab molecule, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain. As described in more detail herein, a scFv has the variable domain of the light chain (VL) connected from its C-terminus to the N-terminus of the variable domain of the heavy chain (VH) by a polypeptide chain. Alternatively, a scFv comprises a polypeptide chain in which the C-terminus of VH is connected to the N-terminus of VL by a polypeptide chain.

[0204] "Fab fragments" (also called antigen binding fragments) contain the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain and the variable domains VL and VH on the light chain and heavy chain, respectively. The variable domains contain the complementarity determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0205] "F(ab')2" fragments contain two Fab' fragments joined by a disulfide bond near the hinge region. F(ab')2 fragments can be produced, for example, by recombinant methods or by pepsin digestion of intact antibodies. F(ab') fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0206] An "Fv" fragment comprises a non-covalently linked dimer of one heavy-chain and one light-chain variable domain.

[0207] "Single-chain Fv" or "scFv" includes the VH domain and VL domain of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide also includes a polypeptide linker between the VH domain and the VL domain that enables the scFv to form a structure required for antigen binding. For a review of scFv, see Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore, ed., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO93 / 16185; U.S. Pat. No. 5,571,894; and U.S. Pat. No. 5,587,458.

[0208] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen in the absence of another variable domain. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414: 521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26: 230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also referred to as sdAbs or nanobodies. SdAbs are very stable and are easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, DeHaard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol Biotechnol. 77 (1): 13-22).

[0209] As used herein, the term "construct" refers to a complex of molecules, including macromolecules or polynucleotides.

[0210] As used herein, the term "integration" refers to the stable insertion of one or more nucleotides of a construct into the cell genome, that is, the process of covalently linking to a nucleic acid sequence in the cell chromosome DNA. It may also refer to a nucleotide deletion at the integration site. In the case of a deletion at the insertion site, "integration" may also include replacing the missing endogenous sequence or nucleotide with one or more inserted nucleotides.

[0211] As used herein, the term "exogenous" refers to a molecule or activity that has been introduced into a host cell and is not native to the cell. For example, the molecule can be introduced by introducing the encoding nucleic acid into the host genetic material, such as by integration into the host chromosome, or as non-chromosomal genetic material such as a plasmid. Therefore, when used in conjunction with the expression of the encoding nucleic acid, the term refers to the introduction of the encoding nucleic acid into the cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in the host cell under natural, unedited conditions. Similarly, when used in conjunction with the expression of the encoding nucleic acid, the term refers to an encoding nucleic acid that is contained within the cell rather than introduced exogenously.

[0212] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequence, eg, wherein the heterologous sequence is not found naturally coupled to the nucleic acid or polypeptide sequence occurring at one or both termini.

[0213] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain native to the flanking sequence, for example, where the homologous sequence is found naturally coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0214] As used herein, "polynucleotide donor construct" refers to a nucleotide sequence (e.g., DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to the polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct may include a prokaryotic sequence, a cDNA from a eukaryotic mRNA, a genomic DNA sequence from a eukaryotic (e.g., mammalian) DNA, and a synthetic DNA sequence. For example, the polynucleotide donor construct may be a miRNA, a shRNA, a natural polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a natural polypeptide having less than 100% sequence identity with a natural polypeptide) or a fragment thereof.

[0215] As used herein, the term "complementary" or "complementarity" refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U) and G and C. The guide RNA described herein can comprise a sequence, such as a DNA targeting sequence that is perfectly complementary or substantially complementary (e.g., with 1-4 mismatches) to a genomic sequence in a cell.

[0216] As used herein, the term "transgenic" refers to a polynucleotide that has been transferred from one organism to another organism naturally or by any of a variety of genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein encoded by a gene - recombinant DNA - that has been cloned in a system that supports gene expression and messenger RNA translation (see expression system). The recombinant protein can be a therapeutic agent, such as a protein that treats a disease or condition disclosed herein. As used, a transgenic can refer to a polynucleotide encoding a polypeptide.

[0217] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein.

[0218] As used herein, the term "operably linked" or "operably connected" refers to the combination of a nucleic acid sequence and a single nucleic acid fragment so that one function is affected by another function. For example, if a promoter is able to affect the expression of a coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter), then the promoter is operably linked to it. The coding sequence can be operably linked to the control sequence in both the sense and antisense directions.

[0219] As used herein, the term "developmental cell state" refers to, for example, a state in which a cell is inactive, actively expressing, differentiated, aged, etc. A developmental cell state may also refer to a cell in a precursor state (eg, a T cell precursor).

[0220] As used, the term "encoding" refers to a nucleic acid sequence encoding a target protein or polypeptide. The nucleic acid sequence can be a DNA molecule or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In other preferred embodiments, the molecule is an RNA molecule. When present as an RNA molecule, it will contain a sequence (e.g., a start codon, ATG) that guides the ribosome of the host cell to start translation and a sequence (e.g., a stop codon) that guides the ribosome to end translation. Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of ordinary skill in the art.

[0221] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject suffers from a disease or illness that can be treated with the engineered cells provided herein or a colony thereof. In some aspects, the disease or illness is cancer.

[0222] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., DNA sequence) that can control the expression of a coding sequence or functional RNA. The promoter sequence is composed of proximal and more distal upstream elements, the latter element being generally referred to as an enhancer. The promoter can be entirely derived from a natural gene, can be composed of different elements from naturally occurring different promoters, and / or can comprise a synthetic DNA segment. As contemplated herein, the promoter can be endogenous for the target cell or exogenous for the target cell. It will be appreciated by those skilled in the art that different promoters can be in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions to induce gene expression. As known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter has activity, for example, constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0223] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0224] As contemplated herein, gene editing may involve gene (or nucleotide sequence) knock-in or knock-out. As used herein, the term "knock-in" refers to adding a DNA sequence or a fragment thereof to a genome. Such DNA sequences to be knocked in may include one or more complete genes, and may include regulatory sequences associated with any part or fragment of a gene or the aforementioned gene. For example, a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, such as replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the elimination of a gene or gene expression. For example, a gene can be knocked out by deleting or adding a nucleotide sequence that causes a reading frame to be destroyed. For another example, a gene can be knocked out by replacing a part of a gene with an unrelated (e.g., non-coding) sequence.

[0225] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which the cut or nicked ends of a DNA strand are joined directly without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination thereof of one or more nucleotides at the repair site.

[0226] As used herein, the term "homologous directed repair" or HDR refers to a cellular process that repairs the cut or gap end of a DNA chain by polymerizing from a homologous template nucleic acid. Therefore, the original sequence is replaced by the sequence of the template. The homologous template nucleic acid can be provided by homologous sequences (sister chromatids, homologous chromosomes, or duplicate regions on the same or different chromosomes) at other locations in the genome. Alternatively, an exogenous template nucleic acid can be introduced to obtain a change in the sequence induced by a specific HDR at the target site. In this way, a specific mutation can be introduced at the cleavage site.

[0227] As used herein, a single-stranded DNA template or a double-stranded DNA template refers to a DNA oligonucleotide that can be used as a template for HDR by a cell. Generally speaking, the single-stranded DNA template or the double-stranded DNA template has at least one region homologous to the target site. In some cases, the single-stranded DNA template or the double-stranded DNA template has two homologous regions located on both sides of the region containing the heterologous sequence to be inserted at the target cleavage site.

[0228] The terms "vector" and "plasmid" are used interchangeably and as used herein refer to a polynucleotide vector that can be used to introduce genetic material into a cell. A vector can be linear or circular. A vector can be integrated into a target genome of a host cell or replicate independently in a host cell. A vector can include, for example, an origin of replication, a multiple cloning site, and / or a selective marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integration vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0229] As used herein, the phrase "introducing" in the context of introducing a nucleic acid or a complex comprising a nucleic acid, such as an RNP-DNA template complex, refers to a translocation of a nucleic acid sequence or RNP-DNA template complex from extracellular to intracellular. In some cases, introducing refers to a translocation of a nucleic acid or complex from extracellular to intranuclear. The various methods of this translocation are contemplated, including but not limited to electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation by cell-penetrating peptides, liposome-mediated translocation, etc.

[0230] As used herein, the term "expression cassette" is a polynucleotide construct produced in a recombinant or synthetic manner that includes a regulatory sequence that is operably linked to a selected polynucleotide to promote expression of the selected polynucleotide in a host cell. For example, the regulatory sequence can promote transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell. The expression cassette can, for example, be integrated into the genome of the host cell or present in an expression vector.

[0231] As used herein, the phrase "a subject in need thereof" refers to a subject exhibiting and / or diagnosed with one or more symptoms or signs of a disease or disorder as described herein.

[0232] "Chemotherapeutic agents" refer to chemical compounds that can be used to treat cancer. Chemotherapeutic agents include "anti-hormonal agents" or "endocrine therapeutic agents" that are used to modulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0233] The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, the composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation in a form that permits the biological activity of the active ingredients contained therein to be effective in treating a subject, and which does not contain other components that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0234] The term "in situ" refers to a process occurring in a living cell that is grown separately from a living organism, for example, grown in tissue culture.

[0235] The term "in vivo" refers to processes that occur in a living organism.

[0236] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside of an organism, preferably with minimal differences from natural conditions.

[0237] As used herein, the term "mammal" includes humans and non-humans, and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0238] In the context of two or more nucleic acids or polypeptide sequences, the term "identity" percentage refers to two or more sequences or subsequences that have a specified percentage of identical nucleotides or amino acid residues when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to the skilled person) or by visual inspection. Depending on the application, the "identity" percentage can be present in a region of the sequence being compared, e.g., in a functional domain, or alternatively in the full length of the two sequences to be compared.

[0239] For sequence comparison, usually a sequence serves as a reference sequence for comparison with a test sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified (if necessary), and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the sequence identity percentages of one or more test sequences relative to the reference sequence based on the specified program parameters.

[0240] For example, optimal alignment of sequences for comparison can be by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981); by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970); by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988); by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.); or by visual inspection (see generally Ausubel et al., below).

[0241] An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0242] The term "sufficient amount" means an amount sufficient to produce a desired effect, such as an amount sufficient to modulate protein aggregation in a cell.

[0243] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of a disease.

[0244] The term "amelioration" refers to any therapeutically beneficial result in the treatment of a disease state (eg, a cancer disease state), a decrease in the severity or progression of the disease state, amelioration, remission, or cure.

[0245] As used herein, the term "effective amount" refers to an amount of a compound (e.g., a composition described herein, a cell described herein) sufficient to achieve a beneficial or desired result. An effective amount can be administered in one or more administrations, applications or dosages, and is not intended to be limited to a specific formulation or route of administration.

[0246] As used herein, the term "treat," "treat," "treat," and "treating" include any action that results in improvement of, or ameliorates, symptoms of, a disorder, disease, condition, and the like, such as alleviating, reducing, modulating, improving, or eliminating.

[0247] The terms "modulate" and "modulation" refer to the decrease or inhibition, or alternatively, the activation or increase of the recited variable.

[0248] The terms "increase" and "activate" refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or more of the recited variable.

[0249] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more reduction in the recited variable.

[0250] It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0251] Logic Gate System

[0252] As used herein, "logic gate", "circuit", "circuit receptor", "system" or "system receptor" refers to a two-part protein expression system comprising a triggering receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, where the triggering receptor is expressed in the cell. When the triggering receptor binds to its target antigen, the intracellular domain of the triggering receptor is cleaved from the transmembrane domain. The intracellular domain is then able to translocate into the nucleus, inducing expression of the chimeric antigen receptor in the nucleus.

[0253] On the one hand, provided herein is a system comprising a priming receptor bound to PSMA and a chimeric antigen receptor bound to CA9, wherein the transcription factor of the intracellular domain of the priming receptor is capable of inducing the expression of CAR. Such systems may alternatively be referred to as "logic gates" or "circuits". In some aspects, the system is encoded by a nucleic acid transgene inserted into an immune cell. The system may be encoded on a single nucleic acid insert or fragment comprising two transgenes, or may be encoded on two nucleic acids encoding the system transgenes separately. The priming receptor and CAR of the system may be placed on a single nucleic acid in any order. For example, the priming receptor may be at the 5' end and the CAR may be at the 3' end, or the CAR may be at the 5' end and the priming receptor may be at the 3' end.

[0254] A constitutive promoter may be operably linked to a nucleotide sequence encoding a start receptor. An inducible promoter may also be operably linked to a nucleotide sequence encoding a CAR. In some embodiments, when the system is encoded on a single nucleic acid insert or fragment comprising two transgenes, the nucleic acid may include in the 5' to 3' direction: a constitutive promoter; a nucleotide sequence encoding a start receptor; an inducible promoter; and a nucleotide sequence encoding a chimeric antigen receptor. Alternatively, the nucleic acid may include in the 5' to 3' direction: an inducible promoter; a nucleotide sequence encoding a chimeric antigen receptor; a constitutive promoter; a nucleotide sequence encoding a start receptor.

[0255] In some embodiments, the system comprising a priming receptor that binds to PSMA and a chimeric antigen receptor that binds to CA9 comprises the sequences set forth in SEQ ID NOs: 25 and 31. In some embodiments, the nucleotide sequences encoding the priming receptor and the chimeric antigen receptor comprise the sequence set forth in SEQ ID NO: 36.

[0256] Activate receptor

[0257] Provided herein are activation receptors comprising an extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA). In some embodiments, the activation receptor comprises an extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA). PSMA is also known as FOLH1 or folate hydrolase 1 (HGNC: 3788; NCBIEntrez Gene: 2346; Ensembl: ENSG00000086205; UniProtKB / Swiss-Prot: Q04609). The amino acid sequence of PSMA is provided as SEQ ID NO: 37.

[0258] In some embodiments, the trigger receptor comprises the sequence set forth in SEQ ID NO: 25. In some embodiments, the trigger receptor comprises the sequence set forth in SEQ ID NO: 26. In some embodiments, the trigger receptor comprises the sequence set forth in SEQ ID NO: 236.

[0259] In certain aspects of the present disclosure, the initiating receptor is a synthetic receptor based on Notch protein. The binding of natural Notch receptors to cognate ligands (such as ligands from the Delta protein family) can lead to intramembrane proteolysis, thereby cleaving the intracellular fragment of Notch protein. The intracellular fragment is a transcriptional regulator that only works after being cleaved from Notch. Cleavage can occur by sequential proteolysis of ADAM metalloproteinases and γ-secretase complexes. The intracellular fragment enters the nucleus and activates cell-cell signaling genes. Compared with natural Notch protein, synthetic Notch initiating receptors replace natural Notch intracellular fragments with fragments that cause genes encoding selected proteins (such as CAR) to be transcribed when the intracellular fragments are released from the initiating receptor.

[0260] Notch receptors have modular domain organization. The extracellular domain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats responsible for ligand binding. In synthetic Notch receptors or initiating receptors, the Notch ligand binding domain is replaced by a ligand binding domain that binds a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeats (LNR) modules, which are unique to Notch receptors and are widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notchl is separated by furin cleavage, so that its N-terminal portion terminates the extracellular subunit, and its C-terminal half constitutes the starting point of the transmembrane subunit. After the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD), which includes transcriptional regulators.

[0261] Various forms of activation receptors can be used for methods, cells and nucleic acids as described herein. It is envisioned that a class of activation receptors for use in methods and cells herein comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Notch receptor including an NRR, a TMD and an ICD. The "Fn Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Robo receptor (such as a mammal Robol, Robo2, Robo3 or Robo4), followed by 1, 2 or 3 fibronectin repeats ("Fn"), a TMD and an ICD. The "Mini Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity with a Notch receptor (lacking an NRR), a TMD and an ICD. The "Minimal Linker Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide lacking substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS) n polypeptide sequence), a TMD and an ICD. The "Hinge Notch" receptor comprises a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher-order multimerization with synthetic receptors and / or existing host receptors), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not exist naturally. In some embodiments, the non-naturally occurring receptors disclosed herein bind to ligands displayed on the surface of target cells, which trigger proteolytic cleavage of the receptor and the release of transcriptional regulators that regulate custom transcriptional programs in the cell. In some embodiments, the initiating receptor does not include the LIN-12-Notch repeat sequence (LNR) and / or the heterologous dimerization domain (HD) of the Notch receptor.

[0262] Trigger receptor extracellular domain

[0263] The activation receptor disclosed herein comprises an extracellular domain that specifically binds to prostate-specific membrane antigen (PSMA). In some embodiments, the extracellular domain comprises a ligand-binding portion of the receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from antibodies, nanobodies, double antibodies, three antibodies or mini antibodies, F(ab')2 fragments, Fab fragments, single-chain variable fragments (scFv) and single-domain antibodies (sdAb) or their functional fragments. In some embodiments, the antigen-binding portion comprises scFv. The antigen-binding portion may include a naturally occurring amino acid sequence or may be engineered, designed or modified to provide desired and / or improved properties, such as increased binding affinity.

[0264] Trigger receptor CDR, VH, VL domains

[0265] Table Bl below provides exemplary antibodies and antigen-binding fragments that bind to PSMA that can be used to initiate receptors and systems of the present disclosure.

[0266]

[0267]

[0268]

[0269] In some aspects, provided herein are activation receptors comprising a VH domain and a VL domain that bind PSMA, the domains comprising three heavy chain complementary determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3) and three light chain complementary determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-H1, CDR-H2, and CDR-H3 are from a heavy chain variable domain (VH) comprising the amino acid sequence set forth in SEQ ID NO: 220, 222, 224, 226, 227, 229, 230, 231, 232, or 234; and wherein CDR-L1, CDR-L2, and CDR-L3 are from a light chain variable domain (VL) comprising the amino acid sequence set forth in SEQ ID NO: 221, 223, 225, 227, 233, or 235. In some aspects, provided herein is a triggering receptor comprising a VH domain that binds to PSMA, the domain comprising three heavy chain complementary determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3), wherein CDR-H1, CDR-H2, and CDR-H3 are from a heavy chain variable domain (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 7, 220, 222, 224, 226, 227, 229, 230, 231, 232, or 234. In some aspects, provided herein is a triggering receptor comprising a VL domain that binds to PSMA, the domain comprising three light chain complementary determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-L1, CDR-L2, and CDR-L3 are from a light chain variable domain (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 7, 8221, 223, 225, 227, 233, or 235.

[0270] In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to AbM. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Kabat. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Chothia. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to IMGT. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Contact.

[0271] In some aspects, the trigger receptor extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, CDR-H2 comprises the sequence shown in SEQ ID NO: 2, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, CDR-L2 comprises the sequence shown in SEQ ID NO: 5, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6. In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO: 7. In some embodiments, VL comprises the sequence shown in SEQ ID NO: 8. In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO: 9.

[0272] In some embodiments, the CDR-H3 of the triggering receptor extracellular antigen binding domain is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H3 of SEQ ID NO: 3, the CDR-H2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H2 of SEQ ID NO: 2, the CDR-H1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-H1 of SEQ ID NO: 1, the CDR-L3 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 6, and the CDR-L2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L3 of SEQ ID NO: 7. The CDR-L2 of NO:5 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical, and the CDR-L1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L1 of SEQ ID NO:4. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO:3 having up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H2 is CDR-H2 of SEQ ID NO:2 having up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H1 is CDR-H1 of SEQ ID NO:1 having up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L3 is CDR-L3 of SEQ ID NO:6 having up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L2 is CDR-L2 of SEQ ID NO:5 having up to 1, 2, 3, or 4 amino acid substitutions; and CDR-L1 is CDR-L1 of SEQ ID NO:4 having up to 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0273] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VH domain as shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VH domain as shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the vh domain as shown in SEQ ID NO: 7. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0274] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VH sequence shown in SEQ ID NO: 7. In some embodiments, the antigen binding domain provided herein comprises a VH sequence provided by SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen binding domains described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0275] In some embodiments, the trigger receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain as shown in SEQ ID NO: 8. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VL domain as shown in SEQ ID NO: 8. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VL domain as shown in SEQ ID NO: 8. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0276] In some embodiments, the extracellular antigen binding domain of the activating receptor provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VL sequence shown in SEQ ID NO: 8. In some embodiments, the antigen binding domain provided herein comprises a VL sequence provided by SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0277] In some embodiments, the activation receptor extracellular antigen binding domain provided herein comprises a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the sequence shown in SEQ ID NO: 9. In some embodiments, the antigen binding domain provided herein comprises SEQ ID NO: 9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. The scFv sequence provided by 9. In some aspects, the amino acid substitution is a conservative amino acid substitution. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0278] Table B2 provides the CDR sequences of the VH and VL of exemplary PSMA antigen binding domains according to the indicated numbering scheme.

[0279]

[0280]

[0281] In some embodiments, the nucleotide sequence encoding the activating receptor comprises the sequence shown in SEQ ID NO:34 or 26.

[0282] Transmembrane domain

[0283] In some embodiments, the triggering receptor comprises a hinge domain. In some embodiments, the hinge domain is a CD8 hinge. In some embodiments, the hinge domain comprises a sequence as shown in SEQ ID NO: 19.

[0284] As described above, the trigger receptor includes a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0285] In some embodiments, the TMD comprises a Notch1 transmembrane domain. In some embodiments, the transmembrane domain comprises the sequence shown in SEQ ID NO:20.

[0286] In general, the TMD suitable for the chimeric receptor disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor including at least one γ-secretase cleavage site. A detailed description of the structure and function of the γ-secretase complex and its substrate proteins (including amyloid precursor protein (APP) and Notch) can be found, for example, in a review recently published by Zhang et al. in Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include TMDs from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A and IFNAR2, wherein the TMD includes at least one γ-secretase cleavage site. Additional TMDs suitable for use in the compositions and methods described herein include, but are not limited to, transmembrane domains from the type 1 transmembrane receptor IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a TMD of a member of the calsyntenin family (such as alcadein α and alcadein γ). In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present invention is a TMD known for Notch receptors. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present invention is a TMD derived from a different Notch receptor. For example, in Mini Notch based on human Notchl, Notchl TMD can be replaced with Notch2 TMD, Notch3 TMD, Notch4 TMD or Notch TMD from non-human animals (such as zebrafish, Drosophila melanogaster, Xenopus or Gallus gallus domesticus).

[0287] In some embodiments, the initiating receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, ADAM10, metalloproteinase cleavage sites of the following MMPs: collagenase 1, 2 and 3 (MMP-1, -8 and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2 and 3 (MMP-3, -10 and -11), matrix lysin (MMP-7) and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences of uPA and tPA include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, such as Glu-Asn-Leu-Tyr-Thr-Gln-Ser, where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, such as Asp-Asp-Asp-Asp-Lys, where cleavage occurs after a lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, such as Leu-Val-Pro-Arg. Other suitable linkers that include a protease cleavage site include sequences that can be cleaved by the following proteases: PreScission TMProtease (comprising a fusion protein of human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin 1, matrix metalloproteinase 13 (collagenase 3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases native to host cells that do not express the receptor (e.g., TEV) can be used as a further regulatory mechanism, where activation of the receptor is reduced until the protease is expressed or otherwise provided. In addition, proteases may be tumor-associated or disease-associated (expressed at levels significantly higher than in normal tissues) and serve as independent regulatory mechanisms. For example, some matrix metalloproteinases are highly expressed in certain cancer types.

[0288] In some embodiments, amino acid substitutions within the TMD include one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitutions includes substitutions to alanine. Additional sequences and substitutions are described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0289] Intracellular domain

[0290] In some embodiments, the initiating receptor comprises one or more intracellular domains from or derived from a transcriptional regulator and / or a DNA binding domain. In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises a sequence as shown in SEQ ID NO: 22, 23 or 24.

[0291] Transcriptional regulatory factors activate or inhibit the transcription of homologous promoters. Transcriptional activators usually bind to transcriptional promoters near them and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and spatially hinder the transcriptional initiation of RNA polymerase. Other transcriptional regulatory factors act as activators or repressors according to their binding positions and cell conditions. Therefore, as used herein, "transcriptional activation domain" refers to the domain of a transcriptional factor that interacts with a transcriptional control element and / or a transcriptional regulatory protein (i.e., a transcription factor, RNA polymerase, etc.) to increase and / or activate the transcription of one or more genes. Non-limiting examples of transcriptional activation domains include: herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcriptional activation domain, B cell POU homeodomain protein Oct2, plant Ap2, or any other domain known to those skilled in the art or ordinary technicians. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. The transcriptional activation domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutated or derived form of the original transcriptional activation domain, with the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator may also include a nuclear localization signal.

[0292] In some embodiments, the initiating receptor comprises one or more intracellular "DNA binding domains" (or "DB domains"). Such "DNA binding domains" refer to sequence-specific DNA binding domains that bind to specific DNA sequence elements. Therefore, as used herein, "sequence-specific DNA binding domains" refer to protein domain portions that have the ability to selectively bind to DNA having a specific predetermined sequence. The sequence-specific DNA binding domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutated, or derived form of the original domain that has the desired ability to bind to a desired sequence. In some embodiments, the sequence-specific DNA binding domain is engineered to bind to a desired sequence. Non-limiting examples of proteins with sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5′, AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, and TALES.

[0293] In those embodiments using CRISPR / Cas-like proteins, the CRISPR / Cas-like proteins can be wild-type CRISPR / Cas proteins, modified CRISPR / Cas proteins, or fragments of wild-type or modified CRISPR / Cas proteins. CRISPR / Cas-like proteins can be modified to increase nucleic acid binding affinity and / or specificity, change enzyme activity, and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the system described herein. For example, a CRISPR enzyme used as a DNA binding protein or its domain can mutate relative to the corresponding wild-type enzyme so that the mutated CRISPR or its domain lacks the ability to cleave a nucleic acid sequence containing a DNA binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that substantially lacks all DNA cleavage activity.

[0294] Juxtamembrane domain

[0295] The ECD and TMD, or the TMD and ICD, may be connected to each other with a connecting polypeptide such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor JMD (including NRR), a TMD, and an ICD. A "Fn Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Robo receptor (such as mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats ("Fn"), a TMD, and an ICD. A "Mini Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor JMD (but lacking an NRR (LIN-12-Notch repeat (LNR) module), a TMD, and an ICD. A "Minimal Linker Notch" receptor comprises a heterologous extracellular ligand binding domain, a connecting polypeptide having substantial sequence identity to a Notch receptor (for example, but not limited to, a synthetic (GGS) n The "Hinge Notch" receptor comprises a connecting polypeptide, a TMD and an ICD that lack substantial sequence identity to a polypeptide sequence. The "Hinge Notch" receptor comprises a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization, trimerization or higher multimerization with synthetic receptors and / or existing host receptors), a TMD and an ICD.

[0296] In some embodiments, the start receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the start receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of the LWF motif in the receptor construct is described in U.S. Patent No. 10,858,443, which is hereby incorporated by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity with the JMD of Notchl, Notch2, Notch3 and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity with Notchl, Notch2, Notch3 and / or Notch4 JMD, but does not include the LIN-12-Notch repeats (LNR) and / or heterodimerization domains (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity with Notchl, Notch2, Notch3 and / or Notch4 JMD. In some embodiments, the JMD peptide includes an oligomerization domain that promotes the formation of dimers, trimers, or higher order combinations of the receptor. Such JMD peptides are described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0297] In the Mini Notch receptor, the connecting polypeptide is derived from the Notch JMD sequence after the NRR and HD domains are deleted. The Notch JMD sequence can be a sequence from Notchl, Notch2, Notch3 or Notch4, and can be derived from non-human homologs, such as those from Drosophila, Gallus gallus, Danio spp., etc. The remaining 4 to 50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are changed to change the direction and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide, such as inducing the level of signal transduction in the presence or absence of a ligand.

[0298] In the Minimal Linker Notch receptor, the connecting polypeptide has no substantial sequence identity with the Notch JMD sequence (including Notch JMD sequences from Notchl, Notch2, Notch3 or Notch4, or non-human homologs thereof). 4 to 50 amino acid residues can be used as polypeptide linkers. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are changed to change the direction and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide of the present disclosure. The Minimal Linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or a site for other types of post-translational modifications. In some embodiments, the Minimal Linker does not contain a protease cleavage site or a glycosylation site.

[0299] In some embodiments, the start receptor also includes a hinge. The hinge joint that can be used to start the receptor can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote the formation of oligomers of chimeric polypeptides by intermolecular disulfide bonds. In these cases, in the chimeric receptor disclosed herein, the hinge domain generally includes a flexible polypeptide connection region disposed between ECD and TMD. Therefore, the hinge domain provides flexibility between ECD and TMD, and also provides a site for intermolecular disulfide bonds between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain includes a motif that promotes dimer formation of chimeric polypeptides disclosed herein. In some embodiments, the hinge domain includes a motif that promotes trimer formation of chimeric polypeptides disclosed herein (e.g., a hinge domain derived from OX40). Hinge polypeptide sequences suitable for use in the compositions and methods of the present disclosure may be naturally occurring hinge polypeptide sequences (e.g., those sequences from naturally occurring immunoglobulins) or may be engineered, designed or modified to provide desired and / or improved properties, e.g., regulating transcription. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domains, IgG2 hinge domains, IgG3 hinge domains, and IgG4 hinge domains, or functional variants thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs.

[0300] Hinge polypeptide sequences may also be derived from CD8α hinge domains, CD28 hinge domains, CD152 hinge domains, PD-1 hinge domains, CTLA4 hinge domains, OX40 hinge domains, and functional variants thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0301] Fn Notch connecting polypeptide is derived from Robol JMD, which contains fibronectin repeat sequence (Fn) domain, and there is a short polypeptide sequence between Fn repeat sequence and TMD. Fn Notch connecting polypeptide does not contain Notch negative regulatory region (NRR) or Notch HD domain. Fn connecting polypeptide can contain 1, 2, 3, 4 or 5 Fn repeat sequences. In some embodiments, the chimeric receptor comprises an Fn connecting polypeptide having about 1 to about 5 Fn repeat sequences, about 1 to about 3 Fn repeat sequences or about 2 to about 3 Fn repeat sequences. The short polypeptide sequence between Fn repeat sequence and TMD can be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids of any sequence but does not have more than one proline. In some embodiments, the short polypeptide sequence may be between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine. In some embodiments, the short polypeptide sequence may be between about 5 and about 20 amino acids, wherein the amino acids are selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn linker polypeptide sequence may be altered to change the orientation and / or proximity of the ECD and TMD relative to each other, thereby achieving the desired activity of the chimeric polypeptide of the present disclosure.

[0302] Termination transfer sequence

[0303] In some embodiments, the trigger receptor further comprises a termination transfer sequence (STS) between the transmembrane domain and the intracellular domain. STS comprises a charged lipophobic sequence. Without being bound by any theory, STS is used as a membrane anchor and is believed to prevent the intracellular domain from entering the plasma membrane. The use of the STS domain in the trigger receptor is described in WO2021061872, which is hereby incorporated by reference in its entirety. Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SD C2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3 and Notch4 STS sequences. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. The STS sequence is described in WO2021061872, which is hereby incorporated by reference in its entirety.

[0304] In some embodiments, the stop transfer sequence comprises the sequence shown as SEQ ID NO:21.

[0305] Chimeric Antigen Receptor

[0306] On the other hand, provided herein is a chimeric antigen receptor comprising an extracellular antigen binding domain specifically bound to carbonic anhydrase IX (CA9). The recombinant CAR can be a human CAR comprising a completely human sequence (e.g., a native human sequence). The amino acid sequence of CA9 (HGNC: 1383; NCBI Entrez Gene: 768; Ensembl: ENSG00000107159; UniProtKB / Swiss-Prot: Q16790) is provided as SEQ ID NO: 38.

[0307] In some embodiments, the chimeric antigen receptor includes an extracellular portion comprising an antigen binding domain. The antigen recognition domain of a receptor (such as CAR) can be connected to one or more intracellular signaling components, such as simulating a signaling component activated by an antigen receptor complex (such as a TCR complex) in the case of CAR, and / or signaling by another cell surface receptor. Therefore, in some embodiments, the extracellular binding component (e.g., ligand binding or antigen binding domain) is connected to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused with the extracellular domain. In one embodiment, a transmembrane domain that is naturally associated with one of the domains in a receptor (e.g., CAR) is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid such domains from binding to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0308] In some aspects, the chimeric antigen receptor comprises an extracellular portion comprising an antigen binding domain as described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, a VH or a single domain VH antibody and the intracellular domain contains an ITAM. In some aspects, the intracellular signaling domain comprises the signaling domain of the ζ chain of the CD3ζ (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting the extracellular domain and the intracellular signaling domain. In some embodiments, the extracellular domain comprises the ligand binding portion of the receptor.

[0309] In some embodiments, the extracellular domain includes an antigen binding portion that is bound to one or more target antigens. In some embodiments, the antigen binding portion includes one or more antigen binding determinants of an antibody or its functional antigen binding fragment. In some embodiments, the antigen binding portion is selected from antibodies, nanobodies, double antibodies, three antibodies or mini antibodies, F (ab ') 2 fragments, Fab fragments, single chain variable fragments (scFv) and single domain antibodies (sdAb) or their functional fragments. In some embodiments, the antigen binding portion comprises scFv. The antigen binding portion may include a naturally occurring amino acid sequence or may be engineered, designed or modified to provide desired and / or improved properties, such as increased binding affinity.

[0310] In some aspects, the transmembrane domain contains the transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane can be directly or indirectly connected. In some embodiments, the extracellular domain and the transmembrane are connected by a spacer, such as any spacer described herein. In some embodiments, the chimeric antigen receptor contains the intracellular domain of the T cell costimulatory molecule, such as between the transmembrane domain and the intracellular signaling domain. In some aspects, the T cell costimulatory molecule is CD28 or 41BB. In some embodiments, the chimeric antigen receptor comprises a sequence as shown in SEQ ID NO: 164.

[0311] Chimeric antigen receptor CDR, VH, VL domains

[0312] Table C1 below provides exemplary antibodies and antigen-binding fragments that bind to CA9 that can be used in the chimeric antigen receptors and systems of the present disclosure.

[0313]

[0314]

[0315] Additional CA9 antibodies and antigen-binding fragments are provided in U.S. Patent No. 9,957,330, which is incorporated herein by reference in its entirety.

[0316] In some aspects, provided herein is a chimeric antigen receptor comprising a VH domain that binds CA9, the domain comprising three heavy chain complementary determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3) and three light chain complementary determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-H1, CDR-H2, and CDR-H3 are from a heavy chain variable domain (VH) comprising the amino acid sequence shown in SEQ ID NOs: 16, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, and 218; and wherein CDR-L1, CDR-L2, and CDR-L3 are from a heavy chain variable domain (VH) comprising the amino acid sequence shown in SEQ ID NOs: 16, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, and 218; NO: 17, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217 and 219. In some aspects, provided herein is a chimeric antigen receptor comprising a VH domain that binds CA9, the domain comprising three heavy chain complementarity determining regions (CDRs) (CDR-H1, CDR-H2 and CDR-H3), wherein CDR-H1, CDR-H2 and CDR-H3 are from a heavy chain variable domain (VH) comprising an amino acid sequence as shown in SEQ ID NO: 16, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216 and 218. In some aspects, provided herein is a chimeric antigen receptor comprising a VH domain that binds CA9, wherein the domain comprises three light chain complementarity determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-L1, CDR-L2, and CDR-L3 are from a light chain variable domain (VL) comprising the amino acid sequence shown in SEQ ID NOs: 17, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, and 219.

[0317] In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to AbM. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Kabat. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Chothia. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to IMGT. In some embodiments, CDR-H1, CDR-H2 and CDR-H3 and CDR-L1, CDR-L2 and CDR-L3 are defined according to Contact.

[0318] In some aspects, the chimeric antigen receptor extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, wherein the variable heavy (VH) chain sequence comprises three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, and the variable light (VL) chain sequence comprises three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 12, CDR-L2 comprises the sequence shown in SEQ ID NO: 14; and CDR-L3 comprises the sequence shown in SEQ ID NO: 15. In some embodiments, the VH chain sequence comprises the sequence shown in SEQ ID NO: 16. In some embodiments, VL comprises the sequence shown in SEQ ID NO: 17. In some embodiments, the extracellular domain comprises the sequence shown in SEQ ID NO:18.

[0319] In some embodiments, the chimeric antigen receptor extracellular antigen binding domain CDR-H3 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to CDR-H3 of SEQ ID NO: 12, CDR-H2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to CDR-H2 of SEQ ID NO: 11, CDR-H1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to CDR-H1 of SEQ ID NO: 10, CDR-L3 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to CDR-L3 of SEQ ID NO: 15, and CDR-L2 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to CDR-L3 of SEQ ID NO: 15. The CDR-L2 of NO:14 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical, and the CDR-L1 is at least about 50%, 75%, 80%, 85%, 90% or 95% identical to the CDR-L1 of SEQ ID NO:13. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO: 12 having up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H2 is CDR-H2 of SEQ ID NO: 11 having up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H1 is CDR-H1 of SEQ ID NO: 10 having up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L3 is CDR-L3 of SEQ ID NO: 15 having up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L2 is CDR-L2 of SEQ ID NO: 14 having up to 1, 2, 3, or 4 amino acid substitutions; and CDR-L1 is CDR-H2 of SEQ ID NO: 11 having up to 1, 2, 3, 4, 5, or 6 amino acid substitutions. NO:13 CDR-L1.

[0320] In some embodiments, the chimeric antigen receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VH domain as shown in SEQ ID NO: 16. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VH domain as shown in SEQ ID N: 16. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VH domain as shown in SEQ ID NO: 16. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0321] In some embodiments, the chimeric antigen receptor extracellular antigen binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VH sequence shown in SEQ ID NO: 16. In some embodiments, the antigen binding domain provided herein comprises a VH sequence provided by SEQ ID NO: 16 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen binding domains described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0322] In some embodiments, the chimeric antigen receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain as shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises two to three CDRs of the VL domain as shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises three CDRs of the VL domain as shown in SEQ ID NO: 17. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0323] In some embodiments, the chimeric antigen receptor extracellular antigen binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VL sequence shown in SEQ ID NO: 17. In some embodiments, the antigen binding domain provided herein comprises a VL sequence provided by SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0324] In some embodiments, the chimeric antigen extracellular antigen binding domain provided herein comprises a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the sequence shown in SEQ ID NO: 18. In some embodiments, the antigen binding domain provided herein comprises a scFv sequence provided by SEQ ID NO: 18 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are obtained from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not obtained from the sequences provided herein, and can be isolated de novo, for example, according to the methods provided herein for obtaining antibodies or antigen binding domains.

[0325] Table C2 provides exemplary CA9 antigen binding domain CDR sequences for the VH of SEQ ID NO: 16 and the VL of SEQ ID NO: 17 according to the indicated numbering scheme.

[0326]

[0327]

[0328] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence shown in SEQ ID NO: 32 or 35. In some embodiments, the chimeric antigen receptor comprises the sequence shown in SEQ ID NO: 237.

[0329] CAR transmembrane domain

[0330] In some embodiments, the membrane-spanning domain is derived from natural or synthetic sources. In the case of natural sources, in some aspects the domain is derived from any membrane-bound protein or membrane-spanning protein. The membrane-spanning region includes α, β or ζ chains derived from (i.e., at least comprising the following membrane-spanning region) T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD 134, the membrane-spanning region of CD137 and / or CD154. Or, in some embodiments, the membrane-spanning domain is synthetic. In some aspects, the synthetic membrane-spanning domain mainly includes hydrophobic residues, such as leucine and valine. In some aspects, the triplet of phenylalanine, tryptophan and valine will be present at each end of the synthetic membrane-spanning domain. In some embodiments, connection is completed by a joint, a spacer and / or a membrane-spanning domain.

[0331] In some embodiments, the transmembrane domain of the receptor (e.g., CAR) is the transmembrane domain of human CD28 or a variant thereof, such as the 27 amino acid transmembrane domain of human CD28 (Accession No.: P10747.1).

[0332] In some embodiments, the CAR comprises a CD8a TMD. In some embodiments, the CD8a TMD comprises a sequence shown in SEQ ID NO: 28.

[0333] CAR hinge

[0334] In some embodiments, CAR also includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or a variant or modified version thereof, such as a hinge region (e.g., CD8a hinge, IgG4 hinge region), and / or CH1 / CL and / or Fc region. In some embodiments, the constant region or portion belongs to human IgG, such as IgG4 or IgG1. In some aspects, a portion of the constant region is used as a spacer between an antigen recognition component (e.g., scFv) and a transmembrane domain. Compared to the absence of a spacer, the length of the spacer can increase the responsiveness of the cell after antigen binding. In some examples, the length of the spacer is or is about 12 amino acids, or the length does not exceed 12 amino acids. Exemplary spacers include those having at least about 10 to 229 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids (and including any integer between the endpoints of any listed ranges). In some embodiments, the spacer has about 12 or fewer amino acids, about 119 or fewer amino acids, or about 229 or fewer amino acids. Exemplary spacers include a CD8a hinge, a separate IgG4 hinge, an IgG4 hinge connected to a CH2 and CH3 domain, or an IgG4 hinge connected to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or International Patent Application Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8a hinge. In some embodiments, the CD8a hinge comprises a sequence shown in SEQ ID NO: 27.

[0335] Among the intracellular signaling domains are those that mimic or approximate signals through native antigen receptors, through combinations of such receptors with co-stimulatory receptors, and / or through co-stimulatory receptors alone. In some embodiments, there is a short oligo- or polypeptide linker, e.g., a linker of between 2 and 10 amino acids in length, such as a linker containing glycine and serine, e.g., a glycine-serine doublet, and the linker forms a connection between the transmembrane domain of the receptor and the cytoplasmic signaling domain.

[0336] CAR intracellular domain

[0337] In some embodiments, after linking CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one normal effector function or response of an immune cell (e.g., a T cell engineered to express a receptor). For example, in some cases, the receptor induces the function of a T cell, such as cytolytic activity or T helper cell activity, such as secretion of cytokines or other factors. In some embodiments, for example, if a truncated portion of an intracellular signaling domain of an antigen receptor component or a co-stimulatory molecule transduces an effector function signal, it is used to replace a complete immunostimulatory chain. In some embodiments, one or more intracellular signaling domains include a cytoplasmic sequence of a T cell receptor (TCR), and in some aspects also include a cytoplasmic sequence of a co-receptor that synergizes with the receptor in a natural environment to initiate signal transduction after antigen receptor engagement, and / or any derivatives or variants of such molecules, and / or any synthetic sequence with the same functional capabilities.

[0338] In some aspects, the receptor includes a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts in a stimulatory manner may contain a signaling motif, which is called an activation motif or ITAM based on immunoreceptor tyrosine. Examples of ITAMs containing primary cytoplasmic signaling sequences include those derived from TCR or CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CDS, CD22, CD79a, CD79b, and CD66d. In some embodiments, the cytoplasmic signaling molecule in CAR contains a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3ζ.

[0339] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112AA cytoplasmic domain of isoform 3 of human CD3 zeta (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0340] Receptors, such as CAR, may include at least one intracellular signaling component. In some embodiments, the receptor includes an intracellular component of the TCR complex, such as a TCR CD3 chain that mediates T cell activation and cytotoxicity, such as a CD3 ζ chain. Therefore, in some aspects, the extracellular domain is connected to one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, a receptor, such as CAR, also includes a portion of one or more additional molecules (such as Fc receptor γ, CD8, CD4, CD25, or CD16). For example, in some aspects, CAR includes a chimeric molecule between CD3 ζ or Fc receptor γ and CD8, CD4, CD25, or CD16. In some embodiments, CAR includes a CD3 ζ activation domain, and the CD3 ζ activation domain includes a sequence shown in SEQ ID NO: 30.

[0341] In some embodiments, the intracellular domain comprises an intracellular co-stimulatory signaling domain of 41BB or a functional variant or portion thereof, such as a 42 amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1) or a functional variant or portion thereof.

[0342] In some embodiments, the receptor comprises one or more, such as two or more co-stimulatory domains and activation domains, such as primary activation domains, in the cytoplasmic portion. Exemplary receptors include intracellular components of CD3ζ, CD28 and 4-1BB. In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell co-stimulatory molecule. In some aspects, the T cell co-stimulatory molecule is 4-1BB.

[0343] In some embodiments, the receptor includes a signaling domain and / or a transmembrane portion of a co-stimulatory receptor (such as CD28, 4-1BB, OX40, DAP10, and ICOS). In some aspects, the same receptor includes both an activating component and a co-stimulatory component.

[0344] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain connected to a CD3 (e.g., CD3ζ) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) co-stimulatory domain connected to a CD3ζ intracellular domain. In some embodiments, CAR comprises a 4-1BB co-stimulatory domain. In some embodiments, the 4-1BB co-stimulatory domain comprises a sequence shown in SEQ ID NO: 29.

[0345] In some embodiments, the CAR comprises the sequence shown in SEQ ID NO: 31 or 32. In some embodiments, the CAR comprises the sequence shown in SEQ ID NO: 31.

[0346] In some embodiments, CAR or other antigen receptors also include markers, such as cell surface markers, which can be used to confirm the transduction or engineering of cells to express receptors, such as truncated forms of cell surface receptors, such as truncated EGFR (tEGFR). In some aspects, markers include all or part (e.g., truncated forms) of CD34, nerve growth factor receptor (NGFR) or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably connected to a polynucleotide encoding a joint sequence (such as a cleavable joint sequence or a ribosome skipping sequence such as T2A). See WO2014031687. In some embodiments, the constructs encoding CAR and EGFRt separated by T2A ribosomal switches are introduced to express two proteins from the same construct, so that EGFRt can be used as a marker for detecting cells expressing such a construct. In some embodiments, markers and optional joint sequences can be any markers and joint sequences disclosed in the patent publication No. WO2014031687 as published. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence, such as a T2A ribosomal skipping sequence.

[0347] In some embodiments, a marker is a molecule, such as a cell surface protein, that does not naturally occur on a T cell or does not naturally occur on the surface of a T cell, or a portion thereof.

[0348] In some embodiments, the molecule is a non-self molecule, such as a non-self protein, ie, a molecule that is not recognized as "self" by the immune system of the host into which the cell is adoptively transferred.

[0349] In some embodiments, the marker does not provide a therapeutic function and / or does not produce other effects, except for being used as a marker for genetic engineering, for example, for selecting successfully engineered cells. In other embodiments, the marker can be a therapeutic molecule or a molecule that otherwise exerts some desired effect, such as a ligand of a cell encountered in vivo, such as a co-stimulatory or immune checkpoint molecule that enhances and / or suppresses the response of the cell after adoptive transfer and encountering a ligand.

[0350] CAR may comprise one or modified synthetic amino acids to replace one or more naturally occurring amino acids. Exemplary modified amino acids include, but are not limited to, aminocyclohexanecarboxylic acid, norleucine, α-aminodecanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3-hydroxyproline and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, (3-phenylserine (3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, dihydroindole-2-yl)-1-hydroxy ... 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 4-nitrophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 4-nitrophenylalanine, -carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine and α-tert-butylglycine.

[0351] For example, in some embodiments, CAR includes an antibody or fragment thereof, including a single-chain antibody (sdAb, e.g., containing only a VH region), a VH domain, and a scFv as described herein; a spacer, such as a CD8a hinge; a CD8a transmembrane domain; a 4-1BB intracellular signaling domain; and a CD3 ζ signaling domain. In some embodiments, CAR includes an antibody or fragment, including an sdAb and a scFv as described herein; a spacer, such as a CD8a hinge; a CD8a transmembrane domain; a 4-1BB intracellular signaling domain; and a CD3 ζ signaling domain.

[0352] For example, site-specific techniques can be used to introduce transgenics expressing activation receptors and CAR systems into cells (such as T cells). By site-specific integration of transgenics (such as activation receptors and CARs), transgenics can target safe harbor loci or TRACs. Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0353] Engineered cells can be applied to immuno-oncology. For example, the activation receptor and CAR can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells are blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0354] Recombinant nucleic acids and vectors

[0355] On the other hand, provided herein is one or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a trigger receptor, the trigger receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA); a second chimeric polypeptide comprising a CAR, the CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9); and at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence shown in SEQ ID NO: 39, a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO: 40, and a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence shown in SEQ ID NO: 41.

[0356] In another aspect, one or more recombinant nucleic acids are provided herein, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a trigger receptor, the trigger receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 1, CDR-H2 comprises the sequence shown in SEQ ID NO: 2, CDR-H3 comprises the sequence shown in SEQ ID NO: 3, CDR-L1 comprises the sequence shown in SEQ ID NO: 4, CDR-L2 comprises the sequence shown in SEQ ID NO: 5, and CDR-L3 comprises the sequence shown in SEQ ID NO: 6. NO:6; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence, which is complementary to nucleotides 1126 to 1364 of an mRNA encoding a human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence, which is complementary to nucleotides 518 to 559 of an mRNA encoding a human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence, which is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0357] In another aspect, one or more recombinant nucleic acids are provided herein, wherein the one or more recombinant nucleic acids encode: a first chimeric polypeptide comprising a activating receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence and a variable light (VL) chain sequence, the variable heavy (VH) chain sequence comprising three heavy chain CDR sequences CDR-H1, CDR-H2 and CDR-H3, the variable light (VL) chain sequence comprising three light chain CDR sequences CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-H1 comprises the sequence shown in SEQ ID NO: 10, CDR-H2 comprises the sequence shown in SEQ ID NO: 11, CDR-H3 comprises the sequence shown in SEQ ID NO: 12, CDR-L1 comprises the sequence shown in SEQ ID NO: 13, CDR-L2 comprises the sequence shown in SEQ ID NO: 14, and CDR-L3 comprises the sequence shown in SEQ ID NO: NO:15; and at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence, which is complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence, which is complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence, which is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0358] RNA interference molecules

[0359] The Fas cell surface death receptor (FAS) is a member of the TNF receptor superfamily that induces apoptosis. Non-receptor protein tyrosine phosphatase 2 (PTPN2) is a phosphatase that regulates interferon and many other signaling pathways. Thymocyte selection-associated high-mobility group box (TOX) is a transcription factor that regulates the differentiation of exhausted T cells.

[0360] As used herein, "target gene" refers to a nucleic acid sequence in a cell, wherein the expression of the sequence can be specifically and effectively regulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene may be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of individual immune cells. In some embodiments, the target gene is FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is TOX. In some embodiments, more than one target gene is regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the one or more recombinant nucleic acid molecules are shRNA. In some embodiments, the target gene is at least FAS and PTPN2. In some embodiments, the target gene is at least FAS and TOX.

[0361] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39.

[0362] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40.

[0363] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0364] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39; and a second nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 518 to 559 of the mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40.

[0365] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39; and a second nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 1294 to 2141 of the mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0366] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and a second nucleic acid sequence of at least 15 nucleotides in length, which is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:41.

[0367] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 42-71. In some embodiments, the nucleic acid comprises a sequence shown in SEQ ID NO: 45. In some embodiments, the nucleic acid is capable of reducing the expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the nucleic acid.

[0368] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 72-97. In some embodiments, the nucleic acid comprises a sequence shown in SEQ ID NO: 82. In some embodiments, the nucleic acid is capable of reducing the expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the nucleic acid.

[0369] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 98-125. In some embodiments, the nucleic acid comprises a sequence shown in SEQ ID NOs: 99 or 104. In some embodiments, the nucleic acid is capable of reducing the expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells not comprising the nucleic acid.

[0370] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0371] In some embodiments, the at least one nucleic acid sequence is a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 157-164.

[0372] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule. Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotides. In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA) or an antisense oligonucleotide. In some embodiments, the nucleic acid is a shRNA.

[0373] Single-stranded hairpin ribonucleic acid (shRNA) is a short duplex in which the sense strand and the antisense strand are connected by a hairpin loop. They are composed of a stem-loop structure and can be transcribed from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct in a cell. Once expressed, shRNA will be processed into RNAi species. It is considered to be relatively stable to express shRNA from a plasmid, and therefore provides a powerful advantage over, for example, using synthetic siRNA. The shRNA expression unit can be incorporated into a variety of plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. Expression of shRNA from a plasmid can be stably integrated to achieve constitutive expression. shRNA is synthesized in the nucleus, further processed and transported to the cytoplasm, and then incorporated into an RNA-induced silencing complex (RISC) to exert activity. shRNA is converted into an active siRNA molecule (which can bind, isolate, and / or prevent the translation of mRNA transcripts encoded by the target gene).

[0374] The Argonaute protein family is the main component of RISC. Among the Argonaute protein family, only Ago2 contains an endonuclease activity that can cleave from the stem portion of the shRNA molecule and release the passenger strand. The remaining three members of the Argonaute family, Ago1, Ago3, and Ago4, do not have identifiable endonuclease activity, are also assembled into RISC, and are believed to function in a cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0375] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. WO2018232356A1, WO2019084552A1, WO2019226998A1, WO2020014235A1, WO2020123871A1, and WO2020186219A1, each of which is incorporated herein by reference for all purposes.

[0376] Antisense oligonucleotide structures and chemical modifications are described in International PCT Publication No. WO 20 / 132521, which is hereby incorporated by reference.

[0377] dsRNA and shRNA molecules and methods of use and production are described in U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, and U.S. Pat. No. 8,252,526, each of which is hereby incorporated by reference.

[0378] siRNA molecules and methods of use and production are described in US Pat. No. 7,361,752 and US Patent Application No. US20050048647, both of which are hereby incorporated by reference.

[0379] Additional methods and compositions for interfering RNA, such as shRNA, siRNA, dsRNA, and antisense oligonucleotides are well known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, International PCT Publication No. WO00 / 44895, International PCT Publication No. WO01 / 36646, International PCT Publication No. WO99 / 32619, International PCT Publication No. WO00 / 01846, International PCT Publication No. WO01 / 29058, and International PCT Publication No. WO00 / 44914, International PCT Publication No. WO04 / 030634; each of which is hereby incorporated by reference.

[0380] The nucleic acid sequence (or construct) that can be used to encode RNAi molecules (such as shRNA) described herein may include a promoter, which is directly or indirectly operably connected (or linked) to the sequence encoding the RNAi molecule. Such promoters can be selected based on the host cell and the effect sought. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as EF1α or inducible promoters based on RNA polymerase II (pol II). Non-limiting examples of suitable promoters also include tetracycline inducible or repressible promoters, promoters based on RNA polymerase I or III, pol II dependent viral promoters (such as CMV-IE promoters), and pol III U6 and H1 promoters. Phage T7 promoters can also be used (in this case, it should be understood that T7 polymerase must also be present). Nucleic acid sequences do not need to be limited to the use of any single promoter, especially because nucleic acid sequences can include two or more shRNAs (i.e., a combination of effectors), including but not limited to shRNA molecules incorporated. Each incorporated promoter can control one or any combination of shRNA molecule components.

[0381] In certain embodiments, the promoter may be preferentially active in target cells, for example, it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. The condition for introducing such a construct into a host cell is that two or more recombinant nucleic acids contained in a recombinant nucleic acid precursor transcript initially reside in a single primary transcript, so that a separate RNA molecule (e.g., shRNAs each containing its own stem-loop structure) is subsequently excised from such a precursor transcript by an endogenous ribonuclease. The resulting mature recombinant nucleic acid (e.g., shRNA) may then induce degradation and / or translation repression of the target gene mRNA transcript produced in the cell. Alternatively, each precursor stem-loop structure may be produced as a part of a separate transcript, in which case each recombinant nucleic acid sequence will preferably include its own promoter and transcription terminator sequence. In addition, multiple recombinant nucleic acid precursor transcripts may reside in a single primary transcript.

[0382] The stem-loop structure of shRNA recombinant nucleic acid described herein can be about 40 to 100 nucleotides long, or preferably, about 50 to 75 nucleotides long. The length of the stem region can be about 15-45 nucleotides (or longer), or a length of about 20-30 nucleotides. In some embodiments, the length of the stem region is 22 nucleotides. In some embodiments, the length of the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 nucleotides.

[0383] The stem may comprise a fully complementary duplex (excluding any 3' tail), however, there may be bulges or internal loops on either arm of the stem. Such bulges and asymmetric internal loops are preferably few in number (e.g., 1, 2, or 3) and about 3 nucleotides or less in size. The terminal loop portion may comprise about 4 or more nucleotides, but preferably no more than about 25. The loop portion is preferably 6-15 nucleotides in size.

[0384] As described herein, the stem region of the shRNA comprises a follower strand and a guide strand, wherein the guide strand comprises a sequence complementary to a target mRNA transcript encoded by one or more target genes. Preferably, the GC content and matching degree of the guide strand and the follower strand are carefully designed so as to have thermodynamically favorable strand unwinding activity with or without endonuclease cleavage. In addition, the specificity of the guide strand is preferably confirmed by BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0385] The present invention provides that the expression level of multiple target genes can be regulated using the methods and recombinant nucleic acids described herein. For example, the present invention provides that the first group of recombinant nucleic acids can be designed to include sequences (guide strands) designed to reduce the expression level of the first target gene, and the second group of recombinant nucleic acids can be designed to include sequences (guide strands) designed to reduce the expression level of the second target gene. Different groups of recombinant nucleic acids can be expressed and reside in the same or separate primary transcripts. In certain embodiments, such multiple methods, that is, using recombinant nucleic acids as described herein to regulate the expression level of two or more target genes, can have an enhanced therapeutic effect on patients. For example, if a cell expressing a recombinant nucleic acid molecule as described herein is provided to a patient to treat, prevent or improve the impact of cancer, it may be necessary to provide the patient with two or more types of recombinant nucleic acid molecules designed to reduce the expression level of multiple genes related to the activation or suppression of immune cells.

[0386] Compared to control cells not comprising the recombinant nucleic acid molecule, the recombinant nucleic acid molecule described herein can reduce the expression of the target gene in the cell by at least more than about 50%. For example, compared to control cells not comprising the recombinant nucleic acid molecule, the recombinant nucleic acid molecule (e.g., shRNA) can reduce the expression of the target gene in the group consisting of FAS, PTPN2 and TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more. The recombinant nucleic acid molecule is capable of reducing the expression of a target gene selected from the group consisting of FAS, PTPN2 and TOX in an immune cell by at least about 50%-100%, 50%-99%, 50%-95%, 50%-90%, 50%-85%, 50%-80%, 50%-75%, 50%-70%, 50%-65%, 50%-60%, 50%-55% compared to a control cell not comprising the recombinant nucleic acid molecule. In some embodiments, the recombinant nucleic acid molecule is capable of reducing the expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the recombinant nucleic acid molecule. In some embodiments, the recombinant nucleic acid molecule is capable of reducing the expression of PTPN2 in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the recombinant nucleic acid molecule. In some embodiments, the recombinant nucleic acid molecule is capable of reducing the expression of TOX in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the recombinant nucleic acid molecule.

[0387] Recombinant nucleic acid molecules can be chemically synthesized, or transcribed in vitro, and can also include one or more modifications to the phosphate-sugar backbone or nucleoside residues.

[0388] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated vector transport, chemical-mediated transport, such as calcium phosphate, etc. Thus, the recombinant nucleic acid molecule construct can be introduced with components that perform one or more of the following activities: enhance cellular uptake of RNA, promote annealing of shRNA duplexes, stabilize annealed shRNA strands, or otherwise increase inhibition of the target gene.

[0389] Additional components

[0390] In some embodiments, the one or more recombinant nucleic acids further comprise a 5' homology directional repair arm and / or a 3' homology directional repair arm complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more recombinant nucleic acids comprise a 5' homology directional repair arm and a 3' homology directional repair arm. In some embodiments, the one or more recombinant nucleic acids are incorporated into an expression cassette or an expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acids.

[0391] In some embodiments, the initiator receptor, CAR, the first nucleic acid and the second nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the initiator receptor, CAR, the first nucleic acid and the second nucleic acid are incorporated into two or more expression cassettes or expression vectors. In some embodiments, one or more expression vectors are non-viral vectors.

[0392] One or more interfering nucleic acid sequences (e.g., one or more shRNAs) can be encoded in an intron region of a recombinant nucleic acid insert, a DNA template, a single expression cassette, or a single expression vector that also encodes a promoter receptor and / or CAR. For example, if the DNA template includes a promoter, such as EF1α or an inducible promoter described herein, to drive CAR or to initiate expression of a receptor, one or more nucleic acid sequences (e.g., shRNA sequences) can be encoded in a promoter intron region. In some embodiments, one or more nucleic acid sequences are encoded in at least one intron region of a recombinant nucleic acid insert or DNA template. In some embodiments, one or more nucleic acid sequences are encoded in at least one EF1α intron region of a recombinant nucleic acid insert or DNA template.

[0393] In some embodiments, the present disclosure contemplates recombinant nucleic acid DNA template inserts comprising one or more transgenics encoding a start receptor and / or CAR as described herein. In some embodiments, the DNA template insert encodes a start receptor transgene. In some embodiments, the DNA template insert encodes a chimeric antigen receptor transgene. In some embodiments, the DNA template insert encodes a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence; and a second nucleic acid complementary to at least 15 nucleotides of a human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a start receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the DNA template insert comprises a start receptor transgene; a chimeric antigen receptor transgene; a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence; and a second nucleic acid complementary to at least 15 nucleotides of a human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a start receptor transgene; a chimeric antigen receptor transgene; a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence; and a second nucleic acid complementary to at least 15 nucleotides of a human PTPN2 or TOX mRNA sequence.

[0394] In some embodiments, the one or more recombinant nucleic acids are encoded on a single DNA template inset. In some embodiments, the one or more recombinant nucleic acids are encoded on multiple DNA template insets. For example, the one or more recombinant nucleic acids can be encoded on two, three or four DNA template insets.

[0395] The DNA template insert may also include a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine Teschovirus 1 (P2A) peptides, T. punctatus virus (T2A) peptides, equine rhinitis virus A (E2A) peptides, or foot-and-mouth disease virus (F2A) peptides. Self-cleaving 2A peptides allow multiple gene products to be expressed from a single construct. (See, e.g., Chang et al. "Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells," MAbs 7(2): 403-412 (2015)).

[0396] The DNA template insert may also comprise a WPRE element. The WPRE element is generally described in Higashimoto, T. et al., Gene Ther 14, 1298-1304 (2007); and Zufferey, R. et al., J Virol. 1999 Apr; 73(4): 2886-92., both of which are hereby incorporated by reference.

[0397] The DNA template insert may also contain an SV40 polyA tail.

[0398] Recombinant cells

[0399] Also provided herein is a recombinant immune cell, the recombinant immune cell comprising at least one DNA template inserted into the target region of the genome of the cell in a non-viral manner, wherein the DNA template encodes a priming receptor and a CAR system as described herein. Also provided herein is a recombinant immune cell, the recombinant immune cell comprising a priming receptor specifically binding to prostate-specific membrane antigen (PSMA) and a chimeric antigen receptor specifically binding to CA9.

[0400] Cells comprising DNA template inserts at target loci or safe harbor sites as described in the present disclosure may be referred to as engineered cells. In some embodiments, immune cells are any cells that can produce pluripotent immune cells. In some embodiments, immune cells are primary immune cells. In some embodiments, immune cells may be induced pluripotent stem cells (iPSC) or human pluripotent stem cells (HSPC). In some embodiments, immune cells include primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells or T cell progenitors. In some embodiments, immune cells are T cells. In some embodiments, T cells are regulatory T cells, effector T cells or naive T cells. In some embodiments, T cells are CD8 + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0401] In some embodiments, the engineered cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, a hematopoietic stem cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor cell. The non-limiting examples of the immune cells contemplated in the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, bone marrow cells and dendritic cells. The non-limiting examples of the stem cells contemplated in the present disclosure include pluripotent stem cells (PSC), embryonic stem cells (ESC), induced pluripotent stem cells (iPSC), embryonic stem cells (ntES obtained by nuclear transplantation; nuclear transplantation ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem cells / progenitor stem cells (HSPC), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and other cells (including osteocytes, chondrocytes, muscle cells, cardiomyocytes, neurons, tendon cells, adipocytes, pancreatic cells, hepatocytes, kidney cells, follicular cells, etc.) stem cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g., intentionally immortalized cell lines, cancer cell lines, etc.).

[0402] Also provided herein is a cell colony comprising a plurality of immune cells. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genome of the cell comprises a priming receptor and a CAR system as described herein.

[0403] Methods of treating cancer

[0404] CA9 is known to be overexpressed in glioblastoma, triple-negative breast cancer (TNBC), ovarian cancer, colorectal cancer, and non-small cell lung cancer (NSCLC). PSMA is known to be overexpressed in renal cell carcinoma, clear cell renal cell carcinoma (ccRCC), gastric cancer, colorectal cancer, urothelial carcinoma, hepatocellular carcinoma (HCC), triple-negative breast cancer (TNBC), non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), and sarcomas.

[0405] In another aspect, the present invention provides a method of treating an immune-related disorder (e.g., cancer) in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising an activating receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In another aspect, the present invention provides a method of enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising an activating receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0406] In some embodiments, the methods provided herein can be used to treat an immune-related disorder in an individual. In one embodiment, the individual is a human.

[0407] In some embodiments, the methods provided herein (such as methods for enhancing immune responses) can be used to treat cancer, so that individuals receiving the systems described herein suffer from cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immune evasive. In some embodiments, the cancer is immune responsive. In specific embodiments, the cancer is renal cell carcinoma. In specific embodiments, the cancer is clear cell renal cell carcinoma (ccRCC). In specific embodiments, the cancer is papillary renal carcinoma.

[0408] In some embodiments, treatment results in a decrease in the volume or size of the cancer. In some embodiments, treatment is effective to reduce the volume of the cancer compared to the volume of the cancer before the administration of the antibody. In some embodiments, treatment results in a decrease in the growth rate of the cancer. In some embodiments, treatment is effective to reduce the growth rate of the cancer compared to the growth rate of the cancer before the administration of the antibody. In some embodiments, treatment is effective to eliminate the cancer.

[0409] In some embodiments, CA9 and PSMA are expressed at higher levels in cancer compared to non-cancer cells. The levels of CA9 and PSMA can be assessed by any technique known in the art, including but not limited to protein assays or nucleic acid assays, such as FACS, Western blots, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassays, dot blots, immunodetection methods, HPLC, surface plasmon resonance, spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology and FISH, and combinations thereof.

[0410] Immunomodulatory methods

[0411] Methods of administering cells comprising a system as described herein comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9 can result in modulation of an immune response. Modulation can be an increase or decrease in the immune response. In some embodiments, modulation is an increase in the immune response.

[0412] In one aspect, administration of cells comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9 as described herein can result in the induction of proinflammatory molecules (such as cytokines or chemokines). In general, the induced proinflammatory molecules are present at levels higher than those achieved by isotype controls. Such proinflammatory molecules, in turn, lead to the activation of anti-tumor immunity, including but not limited to T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Therefore, administration of a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9 can induce a variety of anti-tumor immune mechanisms that lead to tumor destruction.

[0413] In another aspect, provided herein is a method of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0414] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0415] In any and all aspects of increasing an immune response as described herein, any increase or decrease or change in a characteristic or function is compared to a cell that does not comprise a composition comprising a system comprising an activating receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0416] Increasing an immune response can be enhancing an immune response or inducing an immune response. For example, increasing an immune response includes the initiation or initiation of an immune response, or increasing or amplifying an ongoing or existing immune response. In some embodiments, treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, an immune response is initiated or started by administering a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In some embodiments, an immune response is enhanced by administering a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0417] On the other hand, the present application provides a method for gene editing cells with a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, thereby resulting in the regulation of cellular immune function. The regulation can increase the immune response. In some embodiments, the regulation is an increase in immune function. In some embodiments, the regulation of function leads to the expression of CA9 CAR. In some embodiments, the regulation of function leads to the activation of cells comprising the system.

[0418] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

[0419] In some embodiments, the regulation of the function of cells comprising a activating receptor and a CAR system as described herein results in an increase in the ability of cells to stimulate natural and activated T cells, for example, by increasing the secretion of cytokines or chemokines of cells expressing activating receptors and CAR systems. In some embodiments, the regulation of function enhances or increases the ability of cells to produce cytokines, chemokines, CARs or costimulatory or activating receptors. In some embodiments, the regulation increases the T cell stimulation function of cells expressing activating receptors and CAR systems, including, for example, the ability of cells to trigger T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0420] In some embodiments, the increased immune response is the secretion of cytokines and chemokines. In some embodiments, compared with isotype control cells, the expression of at least one cytokine or chemokine in the activation receptor and CAR system induction cell is increased. In some embodiments, the at least one cytokine or chemokine is selected from the group consisting of: IL-2 and IFNγ. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNγ. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2, and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNγ and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0421] In some embodiments, the increased immune response is anti-tumor immune cell recruitment and activation.

[0422] In some embodiments, cells expressing the activation receptor and CAR system induce a memory immune response compared to isotype control cells. In general, a memory immune response is a protective immune response produced by the immune system after subsequent exposure to a previously encountered pathogen or antigen. Exemplary memory immune responses include immune responses after infection or vaccination with an antigen. In general, memory immune responses are mediated by lymphocytes such as T cells or B cells. In some embodiments, a memory immune response is a protective immune response against cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, a memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0423] Methods for editing cells

[0424] As used herein, the term "gene editing" or "genome editing" refers to a type of genetic manipulation that uses artificially manipulated nucleases or "molecular scissors" to insert, replace or remove DNA from the genome. It is a useful tool for elucidating the function and role of sequence-specific genes or proteins or for altering cell behavior (e.g., for therapeutic purposes).

[0425] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) to insert genes at safe harbor loci, such as the adeno-associated virus integration site 1 (AAVS1) safe harbor locus. The DICE (double integrase cassette exchange) system using phiC31 integrase and Bxb1 integrase is a tool for targeted integration. In addition, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0426] Site-specific gene editing methods can include homology-dependent mechanisms or homology-independent mechanisms.

[0427] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein to insert a construct at a gene target or safe harbor locus.

[0428] Provided herein are methods for inserting a nucleotide sequence greater than about 5 kilobases in length into a cell genome in the absence of a viral vector. In some embodiments, a nucleotide sequence greater than about 5 kilobases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0429] Integration of large nucleic acids (e.g., nucleic acids greater than 5 kilobases in size) into cells may be limited by low integration efficiency, off-target effects, and / or cell viability loss. Methods and compositions for achieving integration of nucleotide sequences (e.g., nucleotide sequences greater than about 5 kilobases in size) into the genome of cells are described herein. In some methods, integration efficiency is increased, off-target effects are reduced, and / or cell viability loss is reduced.

[0430] Plasmids can be introduced into immune cells using nucleases, such as CRISPR-associated systems (Cas). Nucleases can be introduced in the form of ribonucleoproteins together with guide RNAs (gRNAs) targeting specific sites on the immune cell genome. Nucleases cut genomic DNA at this specific site. This specific site can be part of the genome encoding an endogenous immune cell receptor. Therefore, cutting the genome at this site will cause immune cells to no longer express endogenous immune cell receptors.

[0431] The plasmid may include 5' and 3' homology-directed repair arms that are complementary to sequences at specific sites on the immune cell genome. The complementary sequences are located on both sides of the site cut by the nuclease, which allows the plasmid to be incorporated into the specific insertion site on the immune cell genome. Once incorporated into the plasmid, the cell will express the activation receptor. However, as explained, the design of the transgenic box ensures that the loop system receptor delivered virally does not express CAR before the activation receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0432] Initially, T cells are activated. T cells can be obtained from patients. Therefore, the present disclosure provides a method for harvesting immune cells such as T cells from patients. Plasmids encoding CAR and activating receptors are then introduced into T cells. Advantageously, electroporation can be used to introduce the plasmids of the present disclosure. When plasmids are introduced by electroporation, nucleases can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. T cells are then expanded and co-cultured to produce a sufficient number of engineered immune cells for use as therapeutic treatment.

[0433] A method for editing the genome of a cell may include: a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex, the RNP-DNA template complex comprising: (i) RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to generate an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the size of the DNA template is greater than about 200 nucleotides, wherein the 5' end and the 3' end of the DNA template comprise nucleotide sequences homologous to genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into a cell.

[0434] In some embodiments, the methods described herein provide at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher RNP-DNA template complex delivery efficiency. In some cases, efficiency is determined relative to the cells that survive after the RNP-DNA template is introduced into the cell. In some cases, efficiency is determined relative to the total number of cells (living cells or non-living cells) introduced into the cell by the RNP-DNA template.

[0435] As another example, the delivery efficiency can be determined by the number of genome-edited cells in the quantitative cell population (compared with the total number of cells or total viable cells obtained after the introduction step). Various methods of quantitative genome editing can be used. These methods include, but are not limited to, the use of mismatch-specific nucleases, such as T7 endonuclease I; sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target loci amplified fragments); and high-throughput deep sequencing.

[0436] In some embodiments, compared with the loss of cell viability after naked DNA is introduced into cells or DNA is introduced into cells using viral vectors, the loss of cell viability is reduced. Reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage between these percentages. In some embodiments, compared with the integration of missing the target after naked DNA is introduced into cells or DNA is introduced into cells using viral vectors, the integration effect of missing the target is reduced. Reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage between these percentages.

[0437] In some cases, the methods described herein provide high cell viability of cells into which RNP-DNA templates have been introduced. In some cases, the viability of cells into which RNP-DNA templates have been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0438] In the methods provided herein, the molar ratio of RNP to DNA template can be about 3: 1 to about 100: 1. For example, the molar ratio can be about 5: 1 to 10: 1, about 5: 1 to about 15: 1, 5: 1 to about 20: 1, 5: 1 to about 25: 1; about 8: 1 to about 12: 1, about 8: 1 to about 15: 1, about 8: 1 to about 20: 1, or about 8: 1 to about 25: 1.

[0439] In some embodiments, the concentration of the DNA template is about 2.5 pM to about 25 pM. For example, the concentration of the DNA template can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM or any concentration between these concentrations.

[0440] In some embodiments, the size or length of the DNA template is greater than about 4.5 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb, 9.4 kb, 9.5 kb, 9.6 kb, 9.7 kb, 9.8 kb, 9.9 kb or 10 kb or any DNA template size between these sizes. For example, the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.

[0441] In some embodiments, the amount of the DNA template is about 1 μg to about 10 μg. For example, the amount of the DNA template may be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, about 1 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of the DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0442] In some cases, the size and number of the DNA templates are large enough to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes one, two, three, four, five, six, seven, eight, nine, ten or more genes.

[0443] In some embodiments, the DNA template includes regulatory sequences, such as promoter sequences and / or enhancer sequences, to regulate the expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0444] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to a single-stranded DNA that substantially lacks another or opposite DNA strand. "Substantially lacking" means that one strand in the pure single-stranded DNA lacks at least 100 times more than the other DNA strand.

[0445] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about one minute to about thirty minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any amount of time therebetween, at about 20° C., 21° C., 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any amount of time therebetween. In another example, the RNPs can be incubated with the DNA template for less than about one minute to about one minute, less than about one minute to about 5 minutes, less than about 1 minute to about 10 minutes, about 5 minutes to 10 minutes, about 5 minutes to 15 minutes, about 10 to about 15 minutes, about 10 minutes to about 20 minutes, or about 10 minutes to about 30 minutes at a temperature of about 20° C. to about 25° C. In some embodiments, the RNP-DNA template complex and the cells are mixed before the RNP-DNA template complex is introduced into the cells.

[0446] In some embodiments, the introduction of RNP-DNA template complexes includes electroporation. The methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in the embodiments herein. The additional or alternative methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens.Bioelectron.23,1353-1360 (2008). The additional or alternative methods, compositions and devices for electroporating cells to introduce RNP-DNA template complexes may include U.S. Patent Application Publication No. 2006 / 0094095; No. 2005 / 0064596; or No. 2006 / 0087522. Additional or alternative methods, compositions, and apparatus for electroporating cells to introduce RNP-DNA template complexes may include those described in Li, LH et al. Cancer Res. Treat. 1, 341-350 (2002); U.S. Pat. Nos. 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Application Publication Nos. 2014 / 0017213; and 2012 / 0088842, all of which are hereby incorporated by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes may include those described in Geng, T. et al. J. Control Release 144, 91-100 (2010); and Wang, J. et al. Lab. Chip 10, 2057-2061 (2010), all of which are hereby incorporated by reference.

[0447] In some embodiments, the Cas9 protein can be in the form of an active endonuclease, so that when combined with a target nucleic acid as part of a complex with a guide RNA or as part of a complex with a DNA template, a double-strand break is introduced into the target nucleic acid. Double-strand breaks can be repaired by NHEJ to introduce random mutations, or repaired by HDR to introduce specific mutations. A variety of Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease can be used that requires an NGG protospacer adjacent motif (PAM) at 3' of the region targeted by the adjacent guide RNA. Such Cas9 nucleases can target any region of the genome containing an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence without an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1; those described in Nature Methods 10, 1116-1121 (2013); and those described in Zetsche et al., Cell, Vol. 163, No. 3, p759-771, Oct. 22, 2015, both of which are hereby incorporated by reference.

[0448] In some cases, the Cas9 protein is a nickase, so that when combined with the target nucleic acid as part of a complex with a guide RNA, a single-strand break or nick is introduced into the target nucleic acid. A pair of Cas9 nickases (each nickase is combined with a structurally different guide RNA) can target two proximal sites in the target genomic region, thereby introducing a pair of proximal single-strand breaks into the target genomic region. The nickase pair can provide enhanced specificity because off-target effects may cause a single nick, which is generally repaired by a base excision repair mechanism without damage. Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0449] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally different RNP complexes. In some embodiments, the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains. In some embodiments, the at least two structurally different RNP complexes contain structurally different guide RNAs. In some embodiments, wherein the at least two structurally different RNP complexes contain structurally different guide RNAs, each structurally different RNP complex comprises a Cas9 nickase, and the structurally different guide RNAs hybridize to the opposite strands of the target region.

[0450] In some cases, multiple RNP-DNA templates containing structurally different ribonucleoprotein complexes are introduced into cells. For example, the Cas9 protein can be compounded with multiple (e.g., 2, 3, 4, 5 or more, e.g., 2-10, 5-100, 20-100) structurally different guide RNAs to target and insert DNA templates at multiple structurally different target genomic regions.

[0451] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, and the like. Optionally, the cells are mammalian cells, such as human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or precursor cells. Precursor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - T cells. Also provided are populations of any cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0452] In some cases, the cell is removed from the subject, modified using any of the methods described herein and administered to the patient. In other cases, any construct described herein is delivered to the patient. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials, No. 9, p. e441 (2017), both of which are hereby incorporated by reference.

[0453] In some embodiments, the RNP-DNA template complex is introduced into about 1x10 5 About 2x10 6 For example, the RNP-DNA template complex can be introduced into approximately 1x10 5 About 5x10 5cells, about 1x10 5 About 1x10 6 cells, 1x10 5 About 1.5x10 6 cells, 1x10 5 About 2x10 6 cells, about 1x10 6 About 1.5x10 6 cells or about 1x10 6 About 2x10 6 in a cell.

[0454] In some cases, the methods and compositions described herein can be used to produce, modify, use or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious diseases or autoimmune diseases in subjects. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express heterologous proteins (e.g., chimeric antigen receptors (CAR) or activating receptors).

[0455] Insertion site

[0456] Methods for editing T cell genomes, specifically methods for editing human T cell genomes, include inserting a nucleic acid sequence or construct into a target region of exon 1 of a TCR-α subunit (TRAC) gene in a human T cell. In some embodiments, the target region is located in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is located in exon 1, exon 2, or exon 3, before the start of the sequence encoding the TCR-α transmembrane domain.

[0457] Methods for editing T cell genomes also include methods for editing human T cell genomes, comprising inserting a nucleic acid sequence or construct into a target region of exon 1 of a TCR-β subunit (TRBC) gene in a human T cell. In some embodiments, the target region is located in exon 1 of a TRBC1 or TRBC2 gene.

[0458] Methods for editing T cell genomes, particularly including methods for editing human T cell genomes, comprise inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0459] Gene editing therapy includes, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional tumor formation (Kolb et al. Trends Biotechnol. 2005 23: 399-406; Porteus et al. Nat Biotechnol. 2005 23: 967-973; Paques et al. Curr Gen Ther. 2007 7: 49-66). However, site-specific integration is still faced with challenges such as low knock-in efficiency, risk of insertional tumor formation, instability and / or abnormal expression of adjacent genes or transgenes, low accessibility (e.g., within 20kB of adjacent genes). These challenges can be partially solved by determining and using safe harbor loci or safe harbor sites (SHS), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0460] The most widely used putative human safe harbor site is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified on the basis of homology, first identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in a growing number of human genes that appear to be non-essential in some cases. A putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection. Other potential genomic SHSs have been identified in humans and other cell types on the basis of viral integration site mapping or gene trap analysis, just like the original mouse Rosa26 locus. The three top SHSs, AAVS1, CCR5, and Rosa26, are in close proximity to many protein-coding genes and regulatory elements. (See Sadelain, M. et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety).

[0461] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for carrying transgenes (e.g., DNA transgenes) with intended functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus of AAVS1 is chr19: 55,625,241-55,629,351. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosures of which are incorporated herein by reference. Exemplary AAVS1 target gRNAs and target sequences are provided below:

[0462] ·AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

[0463] AAVS1 target sequence: ggggccactagggacaggat

[0464] CCR5 is located at position 3p21.31 on chromosome 3 and encodes the main co-receptor of HIV-1. Disruption of this site in the CCR5 gene is beneficial for HIV / AIDS therapy and has promoted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus of CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

[0465] The mouse Rosa26 locus is particularly useful for genetic modification because it can be efficiently targeted and expressed in most tested cell types. Irion et al. 2007 ("Identification and targeting of the ROSA26 locus in human embryonic stem cells." Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which is incorporated herein by reference) identified the human homolog, human ROSA26, in chromosome 3 (position 3p25.3). The canonical SHS locus of human Rosa26 (hRosa26) is chr3: 9,415,082-9,414,043. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

[0466] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chrom osomal Sites with "Safe Harbor" Potential for Targeted Transgene I nsertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference. Examples of additional integration sites are provided in Table D.

[0467] In some embodiments, the safe harbor site allows high expression of the transgene (sufficient to achieve transgene functionality or treatment of the target disease) and stable expression of the transgene over days, weeks or months. In some embodiments, the knockout of the gene at the safe harbor locus confers a functional benefit to the cell, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus allows: the transgene is stably expressed in vitro with or without CD3 / CD28 stimulation, the off-target cleavage as detected by iGuide-Seq or CRISPR-Seq is negligible, the off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq is reduced, the transgene-independent cytotoxicity is negligible, the transgene-independent cytokine expression is negligible, the transgene-independent chimeric antigen receptor expression is negligible, the deregulation or silencing of nearby genes is negligible, and it is located outside the cancer-related gene.

[0468] As used, "nearby genes" can refer to genes within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB from the safe harbor locus (integration site).

[0469] In some embodiments, the present disclosure contemplates inserts comprising one or more transgenes. The transgene may encode a therapeutic protein, antibody, peptide, or any other target gene. Transgenic integration may result in, for example, enhanced therapeutic properties. As used herein, these enhanced therapeutic properties refer to the enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. The therapeutic properties of immune cells may include, but are not limited to, cell transplantation, transport, homing, vitality, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity. The therapeutic properties of immune cells are also manifested as: antigen-targeted receptor expression; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction and immunomodulation of bystander immune cells; target specificity improvement under reduced doses; resistance to treatments such as chemotherapy.

[0470] As used herein, the term "insert size" refers to the length of the nucleotide sequence that is integrated (inserted) into the target locus or safe harbor site. In some embodiments, the insert size includes at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size includes about 5000 nucleotides or more base pairs. In some embodiments, the insert size includes up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20kbp (kilobase pairs) or a size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20kbp or a size therebetween. In some embodiments, the insert size is in the range of 4.5-15kbp or any number within the range. In some embodiments, the insert size is in the range of 4.8-8.3kbp or any number in this range. In some embodiments, the insert size is in the range of 5-8.3kbp or any number in this range. In some embodiments, the insert size is in the range of 5-15kbp or any number in this range. In some embodiments, the insert size is in the range of 4.5-20kbp or any number in this range. In some embodiments, the insert size is 5-10kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, 9-10kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11 or 10-11kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12 or 11-12kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp. In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp.In some embodiments, the insert size is 4.5-17, 6-17, 7-17, 8-17, 9-17, 10-17, 11-17, 12-17, 13-17, or 14-17, 15-17, or 16-17 kbp. In some embodiments, the insert size is 4.5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15-18, 16-18, or 17-18 kbp. In some embodiments, the insert size is 4.5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15-19, 16-19, 17-19, or 18-19 kbp. In some embodiments, the insert size is 4.5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, or 19-20 kbp.

[0471] The insert of the present disclosure refers to a nucleic acid molecule or polynucleotide inserted into a target locus or a safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule such as genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises a smaller DNA fragment, such as plasmid DNA, mitochondrial DNA, or DNA isolated in the form of any other subgenomic segment of a plasmid, a Fox plasmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC) and / or DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. The nucleotides in the insert are considered to be naturally occurring nucleotides, non-naturally occurring nucleotides and modified nucleotides. As will be readily understood by those skilled in the art, nucleotides may be chemically or biochemically modified, or may contain non-natural or derivatized nucleotide bases. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, and internucleotide modifications. Polynucleotides may be in any topological conformation, including single-stranded conformation, double-stranded conformation, partially double-stranded conformation, triple-stranded conformation, hairpin conformation, circular conformation, and other three-dimensional conformations envisioned in the art.

[0472] The insert may have coding and / or non-coding regions. The insert may include non-coding sequences (e.g., control elements, such as promoter sequences). In some embodiments, the insert encodes a transcription factor. In some embodiments, the insert encodes an antigen binding receptor, such as a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, the insert is a human sequence. In some embodiments, the insert is a mimetic. In some embodiments, the insert is a multi-gene / multi-module therapeutic box. The multi-gene / multi-module therapeutic box refers to an insert or box having one or more than one receptor (e.g., a synthetic receptor), other exogenous protein coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0473] In some embodiments, the nucleic acid sequence is inserted into the genome of the T cell by non-viral delivery. In the non-viral delivery method, the nucleic acid can be naked DNA, or in a non-viral plasmid or vector. As described herein or known to those of ordinary skill in the art, the non-viral delivery technology can be a site-specific integration technology. Examples of site-specific technologies for integration into the safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0474] In some embodiments, the insert is integrated into the safe harbor site by introducing into the engineered cell: (a) a targeted nuclease that cleaves a target region in the safe harbor site to generate an insertion site; and (b) a nucleic acid sequence (insert) into which the insert is incorporated into the insertion site, for example, by HDR. Examples of non-viral delivery technologies that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entirety.

[0475] Examples of envisioned integration sites are provided in Table D.

[0476] Table D: sgRNA sequences

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485] CRISPR-Cas editing

[0486] An effective example of gene editing is the CRISPR-Cas method (e.g., CRISPR-Cas9). This method combines the use of a guide polynucleotide (e.g., a guide RNA or gRNA) and a cas endonuclease (e.g., Cas9 endonuclease).

[0487] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, wherein the Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks into DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0488] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can be complexed with a Cas endonuclease and allows the Cas endonuclease to recognize and cleave a DNA target site. The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). The guide polynucleotide comprising only ribonucleic acid is also referred to as a "guide RNA". In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a combination of a guide RNA (gRNA) and a cas endonuclease (e.g., a Cas9 endonuclease).

[0489] The guiding polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) complementary to the nucleotide sequence in the target DNA, and a second nucleotide that interacts with the Cas endonuclease polypeptide. It can be a bimolecular (also referred to as a double-stranded guiding polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this bimolecular guiding polynucleotide comprises two independent molecules that hybridize along the complementary region. The two independent molecules can be RNA sequences, DNA sequences and / or RNA-DNA combination sequences.

[0490] Genome editing using the CRISPR-Cas method relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonucleases). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes (including base substitutions, sequence insertions, and deletions). Conventional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homology arms that match the target genomic locus.

[0491] HITI (homologous-independent targeted insertion) uses a homology-independent strategy based on non-homologous end joining (NHEJ), and this method is more effective than HDR. Guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur through the HDR approach. The donor polynucleotide construct can be engineered to include a Cas9 cleavage site flanking the gene or sequence to be inserted. This results in Cas9 cleavage at the donor plasmid and genomic target sequence. Both the target and the donor have blunt ends, and the linear donor DNA plasmid is used by the NHEJ approach, resulting in integration into the genomic DSB site. (See, e.g., Suzuki, K. et al. (2016). In vivo genome editing via CRISPR / Cas9mediated homology-independent targeted integration. Nature, 540 (7631), 144-149, the relevant disclosures of which are incorporated herein in their entirety).

[0492] Methods for gene editing using CRISPR-Cas methods are known to those of ordinary skill in the art. (See, e.g., U.S. Application Nos. 16 / 312,676, 15 / 303,722, and 15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties). In addition, the use of endonucleases for inserting transgenes into safe harbor loci is described, e.g., in U.S. Application No. 13 / 036,343, the disclosures of which are incorporated herein by reference in their entireties.

[0493] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more oligonucleotides for enhancing activity, cell distribution or part or conjugate of cellular uptake. The non-limiting examples of such parts include lipid moieties (such as cholesterol moieties), cholic acid, thioethers, thiocholesterols, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids (e.g., two-hexadecyl-racemization-glycerol or triethylammonium 1,2-two-O-hexadecyl-racemization-glycerol-3-H-phosphonates), polyamines or polyethylene glycol chains, adamantaneacetic acid, palmityl moieties and octadecylamine or hexylamino-carbonyl-t-hydroxycholesterol moieties. See, for example, U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0494] Therapeutic applications

[0495] For therapeutic applications, the engineered cells, their populations, or compositions thereof are administered to a subject, typically a mammal, typically a human, in an effective amount. The engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other administration methods known to those of ordinary skill in the art.

[0496] The engineered cells provided herein can be used not only for gene therapy, but also for non-pharmaceutical uses, such as, for example, the generation of animal models and the generation of recombinant cell lines expressing target proteins.

[0497] The engineered cells of the present disclosure can be any cell, typically a mammalian cell, typically a human cell, that has been modified by integration of a transgene at a safe harbor locus as described herein.Exemplary cells are provided in the Recombinant Cells section.

[0498] The engineered cells, compositions and methods disclosed herein can be used for therapeutic applications such as CAR T cell therapy and TCRT cell therapy. In some embodiments, inserting a sequence encoding a transgene into a safe harbor locus maintains TCR expression relative to the absence of the insertion, and achieves transgene expression while maintaining TCR function.

[0499] In some embodiments, the disclosure provides a method for treating a subject by administering a composition comprising any engineered cell described herein to a subject in need of treatment. In some embodiments, the administration of the engineered cell composition results in desired pharmacological and / or physiological effects. The effect can be a partial or complete cure of the disease and / or a side effect caused by the disease. In some embodiments, treatment encompasses any treatment of a subject (e.g., a mammal, such as a human) disease. In addition, treatment can stabilize or reduce adverse clinical symptoms of a subject (e.g., a patient). Cells, colonies thereof, or compositions thereof provided herein can be administered during or after the occurrence of a disease.

[0500] In certain embodiments, the subject suffers from a disease, illness and / or injury that can be treated and / or improved by cell therapy. In some embodiments, the subject in need of cell therapy is a subject with injury, disease or illness, thereby causing cell therapy (e.g., a therapy in which cellular material is administered to the subject). However, it is envisioned that it is possible to treat, improve at least one symptom associated with injury, disease or illness and / or reduce its severity.

[0501] Application method

[0502] An effective amount of immune cells comprising the system can be administered to treat cancer. The appropriate dosage of immune cells comprising the system can be determined based on the type of cancer to be treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0503] Pharmaceutical composition

[0504] The engineered recombinant cells provided herein can be administered as part of a pharmaceutical composition. In addition to one or more of the recombinant cells, these compositions may also include pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other substances well known to those skilled in the art. The substance should be non-toxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other substances may depend on the route of administration, such as oral, intravenous, transdermal or subcutaneous, nasal, intramuscular, intraperitoneal routes. The pharmaceutical composition may include one or more pharmaceutical excipients. Any suitable pharmaceutical excipient can be used, and a person of ordinary skill in the art can select a suitable pharmaceutical excipient. Therefore, the pharmaceutical excipients provided below are intended to illustrate rather than limit. Additional pharmaceutical excipients include, for example, those described in the following: Handbook of Pharmaceutical Excipients, Rowe et al. (ed.) 6th edition (2009), which is incorporated by reference as a whole.

[0505] Various modes of administration of the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.

[0506] Depending on the condition to be treated, the composition may be administered alone or in combination with other treatments, either simultaneously or sequentially.

[0507] Medicine boxes and products

[0508] The present application provides a kit comprising any one or more of the systems or cell compositions described herein and instructions for use. The instructions for use may be present in the kit as a package insert, in a label of the kit container or a component thereof, or may be in digital form (e.g., on a CD-ROM, via a link on the Internet). The kit may include one or more genome targeting nucleic acids, polynucleotides encoding genome targeting nucleic acids, site-directed polypeptides, and / or polynucleotides encoding site-directed polypeptides. Additional components within the kit, such as buffers (such as reconstitution buffers, stabilization buffers, dilution buffers) and / or one or more control vectors are also contemplated.

[0509] In some embodiments, the kit further comprises a component selected from any one of a secondary antibody, an immunohistochemical analysis reagent, a pharmaceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein and one or more pharmaceutically acceptable excipients.

[0510] The present application also provides an article of manufacture comprising any of the antibody compositions or kits described herein. Examples of articles of manufacture include vials (including sealed vials).

[0511] Example

[0512] The following are examples of specific embodiments for carrying out the present invention. The examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to the numerical values ​​used (e.g., quantity, temperature, etc.), but of course some experimental errors and deviations should be allowed.

[0513] Unless otherwise indicated, the implementation of the present invention will adopt conventional protein chemistry, biochemistry, recombinant DNA technology and pharmacological methods that belong to the skills of the art. Such techniques are fully described in the literature. See, for example, TECreighton, Proteins: Structures and Molecular Properties (WH Freeman and Company, 1993); A Lehninger, Biochemistry (Worth Publishers, Inc., new in this issue); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan, Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rd Edition (Plenum Press) Volumes A and B (1992).

[0514] Example 1: Synthesis and characterization of PSMA primeR and CA9 CAR logic gates

[0515] method

[0516] T cell engineering

[0517] A PSMA / CA9 logic gate (LG) circuit was constructed with PSMA primeR containing anti-PSMA J591 scFv (VL-VH orientation) and HNF1a-p65 transcription factor. The PrimeR scFv also contained a MYC tag at the 5' end. The LG circuit also contained an inducible CAR containing anti-CA9 scFv clone G36 (VH-VL orientation). The CAR contained a FLAG tag at the 3' end for easy detection. The construct also included an shRNA cassette targeting luciferase as a control gene. Figure 1A A schematic of the PSMA / CA9 LG construct is shown.

[0518] Non-viral T cell engineering for in vitro studies.

[0519] Lymphoprep (STEMCELL Technologies) and EasySep human T cell isolation kit (STEMCELL Technologies) were used to enrich T cells from peripheral blood mononuclear cells (PBMC) obtained from normal donor Leukopaks (STEMCELL Technologies). T cells were then activated with CD3 / CD28 Dynabeads at a 1:1 bead: cell ratio (ThermoFish er, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng / ml human IL-7 and IL-15 (Miltenyi premium grade), cultured at 37°C, 5% CO2 for 48 hours, and then electroporated.

[0520] CRISPR RNP was prepared by combining 120 μM sgRNA targeting the DNA sequence (Synthego) GAGCCA TGCTTGGCTTACGA (GS94), 62.5 μM sNLS-SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) in a volume ratio of 5:1:3:6 and incubated at room temperature for 15 minutes. The optimized amount of plasmid DNA (ranging from 0.5-3 micrograms) determined by the dose titration experiment was mixed with 3.5 μl RNP. T cells were counted, de-beaded, centrifuged at 90X G for 10 minutes, and resuspended at 10^6 cells / 14.5 μl P3 (Lonza) supplemented with supplements. 14.5 μl T cell suspension was added to the DNA / RNP mixture, transferred to the Lonza 384-well nuclear cuvette strip, and pulsed in the Lonza HTNucleofector System code EH-115. The cells were allowed to rest at room temperature for 15 minutes and then transferred to TexMACS medium supplemented with 12.5 ng / ml human IL-7 and IL-15 (Miltenyi premium grade) in a 96-well plate (Sarstedt).

[0521] Transgene expression was detected by staining with anti-Myc antibody (Cell Signaling Technology, clone 9B11) and anti-Flag antibody (RnDsystems, clone 1042E) and analyzed on an Attune NxT flow cytometer. Other antibodies used were Live / Dead Fixable Near-IR (Thermo Fisher), CD4 antibody (BioLegend, clone RPA-T4), CD8 antibody (BioLegend, clone SK1).

[0522] FLAG-tagged CA9 CAR 1: anti-CA9 scFv-CD8a hinge-CD8a-TMD-4-1BB co-stimulatory domain-CD3z activation domain.

[0523] Myc-tagged PSMA priming receptor: anti-PSMA scFv-CD8a hinge-Notch1TMD-Notch1 STS-HNF1aDBD-p65 activation domain.

[0524] T cell stimulation

[0525] Using the above-mentioned in vitro method manufacturing process, T cells from two donors were engineered to express a logic gate system that combines CA9 binders with the CAR format of the PSMA activation receptor. On day 9 after activation, T cells expressing LG were counted, and 3e3 edited T cells were plated into 60uL medium without IL-7 and IL-15 in each well of a 384-well round-bottom plate. Engineered T cells were plated with cell lines (20ul) at a ratio of 1:3 edited T cells: target cells. After 72 hours of co-culture, T cells were stained with anti-myc PE and anti-FLAG APC to determine PrimeR and CAR expression, respectively, and analyzed by flow cytometry on iQue Intellicyt.

[0526] PSMA PrimeR expression

[0527] Primary human T cells were isolated and activated, and two days later, the T cells were electroporated with RNPs and plasmids containing PSMA+CA9 loop DNA. RNPs alone were used as negative controls. Seven days after T cell activation, cells were stained with Myc-PE antibody and myc expression was measured by flow cytometry (iQue Intellicyt). Myc expression was used to quantify loop knock-in by detecting constitutively expressed PrimeR in the loop.

[0528] CA9 CAR expression

[0529] Engineered T cells expressing PSMA / CA9 LG were co-cultured with target K562 cells expressing PSMA or CA9 antigens. After 72 hours, cells were stained with myc and flag antibodies to detect PrimeR and CAR, respectively, by flow cytometry (Attune). The number of edited cells expressing Flag was quantified to determine the extent of CAR induction. N=1 donor, technical replicates.

[0530] Cytokine secretion assay

[0531] Target cell lines K562 and 786-O were transduced with lentivirus to express PSMA (K562), CA9 (K562), or both (786-O PSMA / CA9). Cell lines were sorted to include populations expressing target antigens. Prior to assay setup, cells were stained with antibodies against CA9, PSMA, MSLN (negative control), or isotype control. Expression of target proteins was confirmed by flow cytometry of stained samples ( Figure 4 ).

[0532] Engineered T cells expressing PSMA / CA9 LG were co-cultured with target cells expressing CA9 alone (K562-CA9) or PSMA + CA9 antigens (786-O PSMA / CA9). Supernatants were collected and frozen 72 hours after co-culture setup. IL-2 and IFNγ were measured by running Luminex kits on Flexmap following the manufacturer's instructions. N = 1 donor, technical replicates.

[0533] result

[0534] like Figure 1B As shown, primary T cells were engineered to express the PSMA primeR molecule. Figure 1B Two technical replicates of a representative donor are shown. N = 2 donors.

[0535] Co-culture of engineered T cells with PSMA-expressing target cells resulted in induction of CA9 CAR expression ( Figure 2 ). K562 expressing PSMA induced significantly more CA9 CAR expression than K562 expressing CA9 without PSMA priming antigen ( Figure 2 ).

[0536] Engineered T cells expressed the cytokine IFNγ ( Figure 3A ) and IL-2( Figure 3B ), but did not express this cytokine after co-culture with target cells expressing only the cytolytic antigen (K562-CA9).

[0537] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternative embodiments, it will be understood by one skilled in the relevant art that various changes in form and details may be made therein without departing from the spirit and scope of the invention.

[0538] All references, issued patents, and patent applications cited within the subject matter of this specification are hereby incorporated by reference in their entirety for all purposes.

[0539] Informal Sequence Listing

[0540]

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568]

[0569]

[0570]

[0571]

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

Claims

1. A system comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein a. the first chimeric polypeptide comprises a triggering receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA); and b. The second chimeric polypeptide comprises a CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9).

2. The system of claim 1, further comprising at least one nucleic acid sequence having a length of at least 15 nucleotides, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence shown in SEQ ID NO: 39, a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO: 40; and a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence shown in SEQ ID NO:

41. 3 . The system of claim 2 , wherein the at least one nucleic acid sequence is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:

39.

4. The system of claim 2, wherein the at least one nucleic acid sequence is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:

40.

5. The system of any one of claims 2 to 4, wherein the at least one nucleic acid sequence comprises: a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39; and a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:

40.

6. The system of any one of claims 2-5, wherein the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

7. The system of any one of claims 2-6, wherein the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

8. The system of claim 7, wherein the at least one nucleic acid sequence is a shRNA.

9. The system of any one of claims 2-8, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 42-71.

10. The system of claim 9, wherein the at least one nucleic acid comprises the sequence shown in SEQ ID NO:

49.

11. The system of any one of claims 2-10, wherein the nucleic acid reduces expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the at least one nucleic acid.

12. The system of any one of claims 2-8, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 72-97.

13. The system of claim 12, wherein the at least one nucleic acid comprises the sequence shown in SEQ ID NO:

82.

14. The system of any one of claims 2-8, 12 and 13, wherein the nucleic acid reduces the expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the at least one nucleic acid.

15. The system of any one of claims 2 to 14, wherein the at least one nucleic acid sequence comprises: a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:39; and a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:

40.

16. The system of claim 15, wherein the first nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 42-71, and the second nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 72-97.

17. The system of claim 16, wherein the first nucleic acid comprises the sequence shown in SEQ ID NO:49, and the second nucleic acid comprises the sequence shown in SEQ ID NO:

82.

18. The system of any one of claims 1-17, wherein the system is expressed in an immune cell or a primary immune cell.

19. The system of claim 18, wherein the immune cells are primary human immune cells.

20. The system of claim 18 or 19, wherein the immune cells are allogeneic immune cells.

21. The system of any one of claims 18-20, wherein the immune cells are autologous immune cells.

22. The system of any one of claims 18-21, wherein the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

23. The system of any one of claims 18-22, wherein the primary immune cells are primary T cells.

24. The system of any one of claims 18-23, wherein the primary immune cells are primary human T cells.

25. The system of any one of claims 18-24, wherein the primary immune cells are virus-free.

26. The system of any one of claims 1-25, wherein the triggering receptor comprises, from N-terminus to C-terminus: a. the first extracellular antigen binding domain; b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. An intracellular domain comprising a human or humanized transcriptional effector, wherein binding of the first extracellular antigen binding domain to PSMA results in cleavage at the one or more ligand-inducible proteolytic cleavage sites.

27. The system of claim 26, wherein the priming receptor further comprises a first hinge domain positioned between the first extracellular antigen binding domain and the first transmembrane domain.

28. The system of claim 27, wherein the first hinge domain comprises CD8α or a truncated CD8α hinge domain.

29. The system of claim 28, wherein the first hinge comprises the sequence shown in SEQ ID NO:

19.

30. The system of any one of claims 1-29, wherein the first transmembrane domain comprises a Notch1 transmembrane domain.

31. The system of claim 30, wherein the first transmembrane domain comprises the sequence shown in SEQ ID NO:

20.

32. The system of any one of claims 26-31, wherein the intracellular domain comprises a HNF1a / p65 domain or a Gal4 / VP64 domain.

33. The system of claim 32, wherein the intracellular domain comprises the sequence shown in SEQ ID NO:

24.

34. The system of any one of claims 1-33, wherein the initiation receptor further comprises a termination transfer sequence or a membrane-proximal domain between the first transmembrane domain and the intracellular domain.

35. The system of claim 34, wherein the stop transfer sequence or juxtamembrane domain comprises the sequence shown in SEQ ID NO:

21.

36. The system of any one of claims 1-35, wherein the priming receptor comprises the sequence shown in SEQ ID NO:

165.

37. The system of any one of claims 1 to 36, wherein the CAR comprises, from N-terminus to C-terminus: a. a second extracellular antigen binding domain; b. The second transmembrane domain; c. an intracellular co-stimulatory domain; and d. Intracellular activation domain.

38. The system of claim 37, wherein the CAR comprises a second hinge domain.

39. The system of claim 38, wherein the second hinge domain comprises CD8α or a truncated CD8α hinge domain.

40. The system of claim 39, wherein the second hinge domain comprises the sequence shown as SEQ ID NO:

27.

41. The system of any one of claims 37-39, wherein the second transmembrane domain comprises a CD8α transmembrane domain.

42. The system of claim 41, wherein the second transmembrane domain comprises the sequence shown in SEQ ID NO:

28.

43. The system of any one of claims 37-41, wherein the intracellular co-stimulatory domain comprises a 4-1BB domain.

44. The system of claim 43, wherein the intracellular co-stimulatory domain comprises the sequence shown in SEQ ID NO:

29.

45. The system of any one of claims 37-43, wherein the intracellular activation domain comprises a CD3 zeta domain.

46. ​​The system of claim 45, wherein the intracellular activation domain comprises the sequence shown in SEQ ID NO:

30.

47. The system of any one of claims 1-45, wherein the CAR comprises the sequence shown in SEQ ID NO:

166.

48. The system of any one of claims 1-34, wherein the activating receptor and the CAR are capable of binding to the same target cell if the target cell expresses PSMA and CA9.

49. The system of claim 48, wherein the target cell is a human cell.

50. The system of claim 48 or 49, wherein the target cell is a cancer cell.

51. The system of any one of claims 50, wherein the cancer cell is a solid cancer cell or a liquid cancer cell.

52. The system of any one of claims 50-51, wherein the cancer cell is renal cell carcinoma or clear cell renal cell carcinoma (ccRCC).

53. One or more recombinant nucleic acids, comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of any one of claims 1-52.

54. One or more recombinant nucleic acids, wherein the one or more recombinant nucleic acids encode: a. a first chimeric polypeptide comprising a triggering receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA); b. a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9); and c. at least one nucleic acid sequence of at least 15 nucleotides in length, wherein the nucleic acid sequence is selected from the group consisting of: a nucleic acid sequence complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO: 39, a nucleic acid sequence complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO: 40; and a nucleic acid sequence complementary to nucleotides 1294 to 2141 of the mRNA encoding human TOX comprising the sequence shown in SEQ ID NO:

41.

55. The one or more recombinant nucleic acids of claim 54, wherein the at least one nucleic acid sequence is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO:

39.

56. One or more recombinant nucleic acids according to claim 54 or 55, wherein the at least one nucleic acid sequence is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:

40.

57. One or more recombinant nucleic acids according to claims 54-56, wherein the at least one nucleic acid sequence is complementary to nucleotides 1294 to 2141 of the mRNA encoding human TOX comprising the sequence shown in SEQ ID NO:

41.

58. One or more recombinant nucleic acids according to any one of claims 54 to 56, wherein the at least one nucleic acid sequence comprises: a first nucleic acid sequence which is complementary to nucleotides 1126 to 1364 of the mRNA encoding human FAS comprising the sequence shown in SEQ ID NO: 39; and a second nucleic acid sequence which is complementary to nucleotides 518 to 559 of the mRNA encoding human PTPN2 comprising the sequence shown in SEQ ID NO:

40.

59. One or more recombinant nucleic acids as described in claim 58, wherein the first nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 42-71, and the second nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 72-97.

60. The one or more recombinant nucleic acids of claim 58, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO:49, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:

82.

61. One or more recombinant nucleic acids as described in any one of claims 54-60, wherein the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

62. One or more recombinant nucleic acids as described in any one of claims 54-61, wherein the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

63. The one or more recombinant nucleic acids of claim 62, wherein the at least one nucleic acid sequence is a shRNA.

64. One or more recombinant nucleic acids according to any one of claims 54 to 63, wherein said at least one nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 42 to 71.

65. One or more recombinant nucleic acids as described in claim 64, wherein the at least one nucleic acid comprises the sequence shown in SEQ ID NO:

49.

66. One or more recombinant nucleic acids as described in any one of claims 54-65, wherein the nucleic acid reduces the expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the at least one nucleic acid.

67. One or more recombinant nucleic acids according to any one of claims 54 to 63, wherein said at least one nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 72 to 97.

68. One or more recombinant nucleic acids as described in claim 67, wherein at least one nucleic acid comprises the sequence shown in SEQ ID NO:

82.

69. One or more recombinant nucleic acids of any one of claims 54-63, 67 or 68, wherein the nucleic acid reduces the expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the at least one nucleic acid.

70. One or more recombinant nucleic acids according to any one of claims 54-63, wherein said at least one nucleic acid comprises a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 98-125.

71. One or more recombinant nucleic acids as described in claim 70, wherein at least one nucleic acid comprises the sequence shown in SEQ ID NO:99 or 104.

72. One or more recombinant nucleic acids of any one of claims 54-63, 70 or 71, wherein the nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not comprising the at least one nucleic acid.

73. One or more recombinant nucleic acids as described in any one of claims 54-72, wherein the at least one nucleic acid sequence is a sequence selected from the group consisting of sequences shown in SEQ ID NOs: 157-164.

74. One or more recombinant nucleic acids as described in any one of claims 54-73, wherein said at least one nucleic acid sequence is encoded in at least one intron region of said recombinant nucleic acid.

75. One or more recombinant nucleic acids, comprising at least one nucleic acid fragment, comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA, and a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9.

76. One or more recombinant nucleic acids as described in any one of claims 54-75, wherein the recombinant nucleic acid comprises two or more nucleic acid fragments.

77. One or more recombinant nucleic acids as described in any one of claims 54-76, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

78. One or more recombinant nucleic acids as described in any one of claims 54-77, wherein the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the initiation receptor.

79. The recombinant nucleic acid of any one of claims 54-78, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the promoter receptor.

80. The recombinant nucleic acid of any one of claims 54-79, wherein the constitutive promoter is EF1α.

81. The recombinant nucleic acid of any one of claims 54-80, wherein the nucleic acid comprises in the 5' to 3' direction: a. the constitutive promoter; b. a nucleotide sequence encoding a priming receptor; c. the inducible promoter; and d. Nucleotide sequence encoding a chimeric antigen receptor.

82. The recombinant nucleic acid of any one of claims 54-80, wherein the nucleic acid comprises in the 5' to 3' direction: a. the inducible promoter; b. a nucleotide sequence encoding a chimeric antigen receptor; c. the constitutive promoter; and d. Nucleotide sequence encoding the activating receptor.

83. The recombinant nucleic acid of any one of claims 54-80, wherein the recombinant nucleic acid comprises in the 5' to 3' direction: a. The first group of typing promoters; b. a nucleotide sequence encoding the activation receptor; c. the second group of typing promoters; d. a nucleotide sequence encoding at least one nucleic acid complementary to human FAS, human PTPN2 or human TOX; e. the inducible promoter; and f. a nucleotide sequence encoding the chimeric antigen receptor.

84. The recombinant nucleic acid of any one of claims 54-80, wherein the recombinant nucleic acid comprises in the 5' to 3' direction: a. the first constitutive promoter; b. a nucleotide sequence encoding the activation receptor; c. the second constitutive promoter; d. a nucleotide sequence encoding the first nucleic acid complementary to human FAS; e. a nucleotide sequence encoding the second nucleic acid or the third nucleic acid complementary to human PTPN2 or TOX; f. the inducible promoter; and g. a nucleotide sequence encoding the chimeric antigen receptor.

85. The recombinant nucleic acid of any one of claims 54-80, wherein the recombinant nucleic acid comprises in the 5' to 3' direction: a. the inducible promoter; b. a nucleotide sequence encoding the chimeric antigen receptor; c. the second constitutive promoter; d. a nucleotide sequence encoding the first nucleic acid complementary to human FAS; e. a nucleotide sequence encoding the second nucleic acid or the third nucleic acid complementary to human PTPN2 or TOX; f. the first constitutive promoter; and g. A nucleotide sequence encoding the activating receptor.

86. The recombinant nucleic acid of any one of claims 54-85, wherein the nucleic acid further comprises a 5' homology-directed repair arm and / or a 3' homology-directed repair arm complementary to an insertion site in a host cell chromosome.

87. The recombinant nucleic acid of any one of claims 54-86, wherein the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-immolative 2A peptide (P2A).

88. The recombinant nucleic acid of any one of claims 54-87, wherein the P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

89. The recombinant nucleic acid of any one of claims 54-87, wherein the P2A is at the 3' end of the nucleotide sequence encoding the priming receptor.

90. The recombinant nucleic acid of any one of claims 54-89, wherein the recombinant nucleic acid further comprises a Woodchuck Hepatitis Virus Post-Translational Regulatory Element (WPRE).

91. The recombinant nucleic acid of claim 90, wherein the WPRE is located 3' to the nucleotide sequence encoding the chimeric antigen receptor and 5' to the nucleotide sequence encoding the priming receptor, or wherein the WPRE is located 3' to the nucleotide sequence encoding the priming receptor and 5' to the nucleotide sequence encoding the chimeric antigen receptor.

92. The recombinant nucleic acid of any one of claims 54-90, wherein the recombinant nucleic acid further comprises an SV40 polyA element.

93. The recombinant nucleic acid of any one of claims 54-92, wherein the nucleic acid is incorporated into an expression cassette or an expression vector.

94. The recombinant nucleic acid of claim 93, wherein the expression vector is a non-viral vector.

95. An expression vector comprising the recombinant nucleic acid of any one of claims 53-94.

96. The vector of claim 95, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking the insertion site in the genome of the primary cell.

97. The vector of claim 96, wherein the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

98. An immune cell, comprising: a. A system as claimed in any one of claims 1 to 52; b. the recombinant nucleic acid of any one of claims 53 to 94; and / or c. The vector of any one of claims 95-97.

99. The cell of claim 98, wherein the immune cell is a primary immune cell.

100. The cell of claim 98 or 99, wherein the immune cell is a primary human immune cell.

101. The cell of any one of claims 98-100, wherein the immune cell is an allogeneic immune cell.

102. The cell of any one of claims 98-100, wherein the immune cell is an autologous immune cell.

103. The cell of any one of claims 98-102, wherein the immune cell or primary immune cell is a natural killer (NK) cell, a T cell, a CD8+T cell, a CD4+T cell, a primary T cell, or a T cell progenitor cell.

104. The cell of any one of claims 98-103, wherein the immune cell or primary immune cell is a primary T cell.

105. The cell of any one of claims 98-104, wherein the immune cell or primary immune cell is a primary human T cell.

106. The cell of any one of claims 98-105, wherein the immune cell or primary immune cell is virus-free.

107. A primary immune cell, comprising at least one recombinant nucleic acid, comprising: a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9, the recombinant nucleic acid being inserted into a target region of the genome of the primary immune cell, and wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

108. A live, virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises: a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9, and wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking an insertion site in the genome of the primary cell.

109. The primary cell of claim 107 or 108, further comprising at least one nucleic acid sequence having a length of at least 15 nucleotides, wherein the at least one nucleic acid sequence comprises one or more of the following: (1) a first nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas cell surface death receptor (FAS) comprising the sequence shown in SEQ ID NO:39, (2) a second nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human non-receptor protein tyrosine phosphatase 2 (PTPN2) comprising the sequence shown in SEQ ID NO:40; and (3) a third nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence shown in SEQ ID NO:

41.

110. A cell population comprising a plurality of immune cells according to any one of claims 98-109.

111. A pharmaceutical composition comprising the immune cell of any one of claims 98 to 109 or the cell population of claim 110, and a pharmaceutically acceptable excipient.

112. A pharmaceutical composition comprising the recombinant nucleic acid of any one of claims 53-94 or the vector of any one of claims 95-97, and a pharmaceutically acceptable excipient.

113. A method for editing immune cells, the method comprising: a. providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises the recombinant nucleic acid of any one of claims 53 to 94, and wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences flanking the insertion site in the genome of the immune cell; b. introducing the RNP-recombinant nucleic acid complex into the immune cell in a non-viral manner, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to generate the insertion site in the genome of the immune cell; as well as c. Editing the immune cell by inserting the recombinant nucleic acid of any one of claims 53 to 94 into the insertion site in the genome of the immune cell.

114. The method of claim 113, wherein non-viral introduction comprises electroporation.

115. The method of claim 113 or 114, wherein the nuclease domain comprises a CRISPR-associated nuclease (Cas), optionally a Cas9 nuclease.

116. The method of any one of claims 113 to 115, wherein the target region of the genome of the cell is a T cell receptor alpha constant (TRAC) locus or a genomic safe harbor (GSH) locus.

117. The method of any one of claims 113 to 116, wherein the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.

118. The method of any one of claims 113 to 117, wherein the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.

119. The method of any one of claims 113 to 118, wherein the immune cells are primary human immune cells.

120. The method of any one of claims 113 to 119, wherein the immune cell is an autologous immune cell.

121. The method of any one of claims 113 to 119, wherein the immune cells are allogeneic immune cells.

122. The method of any one of claims 113 to 121, wherein the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor cell.

123. The method of any one of claims 113 to 122, wherein the immune cells are primary T cells.

124. The method of any one of claims 113 to 123, wherein the immune cells are primary human T cells.

125. The method of any one of claims 113 to 124, wherein the immune cells are virus-free.

126. The method of any one of claims 113 to 125, further comprising obtaining the immune cells from a patient and introducing the recombinant nucleic acid in vitro.

127. A method of treating a disease in a subject, the method comprising administering to the subject the immune cell of any one of claims 98-110 or the pharmaceutical composition of claim 111 or 112.

128. The method of claim 127, wherein the disease is cancer.

129. The method of claim 128, wherein the cancer is a solid cancer or a liquid cancer.

130. The method of claim 128 or 129, wherein the cancer is renal cell carcinoma or clear cell renal cell carcinoma (ccRCC).

131. The method of any one of claims 128-130, wherein the administration of the immune cells enhances an immune response in the subject.

132. The method of claim 131, wherein the enhanced immune response is an adaptive immune response.

133. The method of claim 131, wherein the enhanced immune response is an innate immune response.

134. The method of any one of claims 128-133, wherein the enhanced immune response is increased expression of at least one cytokine or chemokine.

135. The method of claim 134, wherein the at least one cytokine or chemokine is IL-2 or IFNγ.

136. The method of any one of claims 127-130, further comprising administering immunotherapy to the subject simultaneously with or after the immune cells.

137. A method of inhibiting a target cell in a subject, the method comprising administering to the subject the immune cell of any one of claims 98-110, wherein the immune cell inhibits the target cell.

138. The method of claim 137, wherein the target cells express PSMA and CA9.

139. The method of claim 137 or 138, wherein the target cell is a cancer cell.

140. A method for inducing expression of a chimeric antigen receptor and a priming receptor in an immune cell, the method comprising: a. obtaining immune cells, the immune cells comprising i. The system of any one of claims 1-52; ii. the recombinant nucleic acid of any one of claims 53-94; and / or iii. The vector of any one of claims 95-97; as well as b. contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor.

141. A method for regulating immune cell activity, the method comprising: a. obtaining immune cells, the immune cells comprising i. The system of any one of claims 1-52; ii. the recombinant nucleic acid of any one of claims 53-94; and / or iii. The vector of any one of claims 95-97; as well as b. contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, and wherein binding of the chimeric antigen receptor to CA9 on the target cell regulates the activity of the immune cell.

142. The method of claim 141, wherein the modulation of the immune cell activity comprises enhancing an immune response.

143. The method of claim 142, wherein the enhanced immune response is an adaptive immune response.

144. The method of claim 142, wherein the enhanced immune response is an innate immune response.

145. The method of any one of claims 141-144, wherein the immune cell activity is increased expression of at least one cytokine or chemokine.

146. The method of claim 145, wherein the at least one cytokine or chemokine is IL-2 or IFNγ.

Images