Application of oswax13 gene in improving drought resistance and nitrogen use efficiency of rice

Abstract

The application relates to application of an OsWOX13 gene in synergistically improving drought resistance and nitrogen utilization efficiency of rice, and a rice breeding method for synergistically improving drought resistance and nitrogen utilization efficiency of rice, which comprises the step of increasing the expression amount of the OsWOX13 gene in the rice. The application excavates the multifunctional role of the OsWOX13 in regulating the response of the rice to drought stress and nitrogen utilization efficiency, provides a new perspective for creating high-quality rice resources, and provides a molecular basis for synergistically cultivating drought-resistant rice with high nitrogen utilization efficiency in the future.

Description

Technical Field

[0001] This invention relates to the field of rice molecular breeding, specifically to the application of the OsWOX13 gene in synergistically improving drought resistance and nitrogen use efficiency in rice, and to a rice breeding method for synergistically improving drought resistance and nitrogen use efficiency in rice. Background Technology

[0002] Rice (Oryza sativa L.) is one of the most important crops for the food needs of nearly half the world's population. In recent years, water scarcity caused by environmental changes has become a pressing global problem. Water scarcity affects crops' ability to absorb and utilize nitrogen, as well as their overall survival, leading to significant yield reductions. Enhancing rice's drought resistance and nitrogen use efficiency is crucial for ensuring sustainable agricultural development.

[0003] There is a significant interaction between drought tolerance and nitrogen use efficiency in crops. Studies have shown that nitrogen assimilation in rice is suppressed in response to environmental stresses such as drought. The C2H2 zinc-finger transcription factor DST (drought and salt tolerance), which responds to drought and salt stress in rice, inhibits nitrogen assimilation under drought stress by regulating the expression of the nitrate reductase OsNRT1.2, exhibiting an adaptive metabolic reprogramming. This metabolic reprogramming helps improve the drought tolerance of rice, but it poses a challenge for breeding rice varieties that are both drought-tolerant and have high nitrogen use efficiency.

[0004] OsWOX13 is a member of the plant-specific WUSCHEL-related homeobox (WOX) gene family, containing a highly conserved DNA-binding motif, ATTGATT, in its homeobox domain (HD). Currently, there are no reported studies on whether OsWOX13 regulates drought tolerance and nitrogen use efficiency in rice. Summary of the Invention

[0005] This invention provides the application of the OsWOX13 gene in synergistically improving drought resistance and nitrogen use efficiency in rice.

[0006] In one specific embodiment, the amino acid sequence encoded by the OsWOX13 gene is shown in SEQ ID NO:2.

[0007] In one specific implementation, the nucleic acid sequence of the OsWOX13 gene is shown in SEQ ID NO:1.

[0008] The present invention also provides a rice breeding method for synergistically improving the drought resistance and nitrogen use efficiency of rice, including the step of increasing the expression level of the OsWOX13 gene in rice.

[0009] In one specific implementation, the expression level of the OsWOX13 gene is increased by introducing an overexpression cassette of the OsWOX13 gene or by introducing a mutation that enhances the in situ expression of the OsWOX13 gene.

[0010] In one specific implementation, the expression level of the OsWOX13 gene is increased by introducing the OsWOX13 gene with a higher expression level into rice through hybridization.

[0011] In one specific embodiment, the amino acid sequence encoded by the OsWOX13 gene is shown in SEQ ID NO:2.

[0012] In one specific implementation, the nucleic acid sequence of the OsWOX13 gene is shown in SEQ ID NO:1.

[0013] This invention explores the multifunctional role of OsWOX13 in regulating rice's response to drought stress and nitrogen use efficiency, providing a new perspective for creating high-quality rice resources and a molecular basis for the future collaborative breeding of drought-resistant rice with high nitrogen use efficiency. Attached Figure Description

[0014] Figure 1 The diagram shows the OsWOX13 gene structure and the CRI SPR editing method. The upper part of the diagram shows the OsWOX13 gene structure and the sequence editing method using CRI SPR knockout technology.

[0015] Figure 2 Identification of positive families for OsWOX13 overexpression and complementary materials. (A) Figure shows the identification of positive families for OsWOX13 overexpression materials. (B) Figure shows the creation of OsWOX13 complementary materials and the identification of positive families.

[0016] Figure 3 OsWOX13 positively regulates the response of rice to drought stress. (A) Figure shows the phenotypic statistics of WT (ZH11), OsWOX13 overexpression (OE13), oswox13 mutant, and complementary material (Com13#1) before and after drought treatment and rehydration. (BE) Figures show the water loss rate and survival rate of the above materials after drought treatment.

[0017] Figure 4 WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials were used under different nitrogen fertilizer supply conditions (0, 100, and 200 kg ha). -1 A representative plant photo.

[0018] Figure 5Photographs of rice panicles from representative plants of WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials after drought treatment.

[0019] Figure 6 WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials were used under different nitrogen fertilizer supply conditions (0, 100, and 200 kg ha). -1 The number of tillers is statistically analyzed.

[0020] Figure 7 WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials were used under different nitrogen fertilizer supply conditions (0, 100, and 200 kg ha). -1 The number of grains per ear is counted.

[0021] Figure 8 WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials were used under different nitrogen fertilizer supply conditions (0, 100, and 200 kg ha). -1 The yield per plant.

[0022] Figure 9 Under normal conditions, WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials were tested under different nitrogen fertilizer supply conditions (100 and 200 kg ha). -1 Nitrogen use efficiency (NUE) of ).

[0023] Figure 10 WT, OsWOX13 overexpression (OE13), and oswox13 mutant materials under normal and drought conditions were tested under different nitrogen fertilizer supply conditions (100 and 200 kg ha). -1 Nitrogen use efficiency (NUE) of ). Detailed Implementation

[0024] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0025] 1. Knockout and overexpression of the OsWOX13 gene

[0026] The sequence of the OsWOX13 gene in rice was obtained, as shown in SEQ ID NO:1; the encoded amino acid sequence is shown in SEQ ID NO:2.

[0027] 1) Based on the OsWOX13 gene sequence, select two knockout target sites:

[0028] oswox13-target 1:5'-AGGAGGGCTCGGGTACGTGA-3' (SEQ ID NO:3);

[0029] oswox13-target 2:5'-GTTTGTTTATCTAGGGCTCT-3' (SEQ ID NO:4).

[0030] 2) Based on the OsWOX13 gene sequence, primers for the OsWOX13 overexpression vector were designed. The primer sequences are as follows:

[0031] OsWOX13-F: ATGGAGTGGGACAAGGCCAA (SEQ ID NO: 5);

[0032] OsWOX13-R:ATACATATCAAAGCTTTCACCGGATC (SEQ ID NO:6).

[0033] 3) Based on the OsWOX13 gene sequence, primers for the OsWOX13 overexpression vector were designed. The primer sequences are as follows:

[0034] OsWOX13-CF:CTGTGCAAGTCCAAGAGCTAGTCA (SEQ ID NO:7);

[0035] OsWOX13-CR:ATACATATCAAAGCTTTCACCGGATC (SEQ ID NO:8).

[0036] 4) The target site from step 1) is fused into the promoter sequence of pCXUN via homologous recombination and amplified to obtain a promoter sequence containing the target site. The amplified fragment is digested with the corresponding restriction endonuclease, and simultaneously, the knockout vector pCXUN is also digested with the corresponding restriction endonuclease. Then, it is ligated with homologous recombinase and heat-shocked transformed into competent Trnas5α cells. The transformation vector pCXUN-oswox13 is obtained; using Agrobacterium-mediated transgenic methods, the vector is introduced into the rice recipient Zhonghua11 (ZH11) to obtain the corresponding transformed plants.

[0037] The results are as follows Figure 1 As shown, the mutant yielded two homozygous families. The first family's mutation involved a deletion of a base in exon OsWOX13, leading to premature termination of its coding. The second family's mutation involved a substitution of a base in exon OsWOX13, causing coding variation.

[0038] 5) The target sequence was amplified using the primers from steps 2) and 3). The amplified fragment was digested with the corresponding restriction endonuclease, and the knockout vector was simultaneously cleaved with the corresponding restriction endonuclease. The fragments were then ligated with homologous recombinase and heat-shocked into competent Trnas5α cells. Transformation vectors pU2301-OsWOX13 and pfa2300-OsWOX13 were obtained. These vectors were then introduced into the rice recipient Zhonghua11 using Agrobacterium-mediated transgenic methods to obtain the corresponding positive transformation plants.

[0039] As shown in Figure 2, multiple overexpressing strains and complementary strains were obtained.

[0040] 2. Functional study of OsWOX13 in rice response to drought stress

[0041] 2.1 Effects of OsWOX13 on plant survival rate

[0042] ZH11 wild-type (WT), OsWOX13 overexpression and oswox13 mutant seedlings with consistent growth were grown under normal hydroponic conditions for 2 weeks, and then the hydroponic solution was replaced with 20% PEG 6000 to simulate drought stress for 3-5 days.

[0043] Remove 20% of PEG6000, rehydrate with normal hydroponic solution for one week, and then count the survival rate of each material.

[0044] The results are as follows Figure 3 As shown in A, B, and D, after drought stress treatment, OsWOX13 overexpressing plants showed a higher survival rate compared to wild type, while oswox13 mutants showed a significantly reduced survival rate.

[0045] 2.2 Effects of OsWOX13 on plant tissue water loss rate

[0046] WT, OsWOX13 overexpression, and oswox13 mutant seedlings with consistent growth were grown under normal hydroponic conditions for 2 weeks. Then, the hydroponic solution was replaced with 20% PEG 6000 to simulate drought stress treatment for 0, 1, 2, 4, 6, and 12 hours. Leaf tissues of the plants at the corresponding treatment times were collected for water loss detection.

[0047] The results are as follows Figure 3 As shown in C and E, OsWOX13 overexpressing plants exhibited a significantly reduced water loss rate, while the oswox13 mutant exhibited a significantly increased water loss rate.

[0048] 3. Functional study of OsWOX13 in nitrogen use efficiency of rice

[0049] To measure nitrogen use efficiency (NUE), ZH11 wild-type (WT), OsWOX13 overexpression (OE13), and oswox13 mutant rice plants were grown in three independent plots, supplied with 100 and 200 kg / ha of nitrogen, respectively. Nitrogen fertilizer was applied in the form of urea in two stages: 40% at the tillering stage and 60% at the heading stage. Each line was cultured in randomized plots with a row and plant spacing of 20 cm, and each plot contained at least 50 plants per line.

[0050] Calculation of NUE (nitrogen use efficiency) under normal conditions. All grains were collected from 6-10 mature wild-type (ZH11), OsWOX13 overexpression (OE13), and oswox13 mutant plants under nitrogen supply conditions of 100 and 200 kg / ha, respectively. The collected grains were then dried at 50°C for 48 hours. NUE was calculated (NUE = yield per plant (g) / nitrogen fertilizer applied (kg)) (biological replication n≥5).

[0051] The number of tillers, number of grains per ear, and yield per plant were statistically analyzed. The number of tillers and all grains of 20 mature wild-type (ZH11), OsWOX13 overexpression (OE13), and oswox13 mutant plants were counted under nitrogen supply conditions of 0, 100, and 200 kg / ha, respectively. The number of grains per ear was counted and the yield per plant was calculated (n>6).

[0052] Calculation of NUE (nitrogen use efficiency) after drought stress. Wild-type (ZH11), OsWOX13 overexpression (OE13), and oswox13 mutant rice plants were grown in three independent plots, supplied with 100 and 200 kg / ha of nitrogen. Nitrogen fertilizer was applied in two stages in the form of urea: 40% at the tillering stage and 60% at the heading stage. Each line was cultured in randomized plots with a row and plant spacing of 20 cm, with each plot containing at least 50 plants per line. Drought stress was applied to the field before the rice plants reached the heading stage, lasting approximately 7 days. After treatment, rehydration was performed. Subsequently, all grains from 6-10 mature plants of wild-type (ZH11), OsWOX13 overexpression (OE13), and oswox13 mutant materials were harvested under nitrogen supply conditions of 100 and 200 kg / ha, respectively. The harvested grains were then dried at 50°C for 48 hours. Calculate NUE (NUE = yield per plant (g) / amount of nitrogen fertilizer applied (kg)) (biological replication n≥5).

[0053] The results are as follows Figure 4-10 As shown, overexpression of the transcription factor encoding gene OsWOX13 can not only increase the number of rice tillers, but also improve the nitrogen use efficiency of rice.

[0054] Although the embodiments of this invention only list specific methods for overexpressing OsWOX13 in wild-type rice and the osWOX13 mutant, the experiments of this invention have actually demonstrated that the OsWOX13 mutation synergistically reduces drought resistance and nitrogen use efficiency in rice, while overexpression of OsWOX13 and reversion of the OsWOX13 mutation synergistically increase drought resistance and nitrogen use efficiency in rice. Those skilled in the art will readily understand after reading this invention that simply using appropriate methods to overexpress OsWOX13 in rice, or to revert the mutation in the OsWOX13 mutant or overexpress the OsWOX13 gene, can improve drought resistance and nitrogen use efficiency in rice. Therefore, the means to achieve the above objectives should not be used to limit the scope of protection of this invention; all means capable of achieving the above objectives should be included within the scope of protection of this invention.

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. OsWOX13 The application of genes in synergistically improving drought resistance and nitrogen use efficiency in rice, OsWOX13 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, The OsWOX13 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. A rice breeding method for synergistically improving drought resistance and nitrogen use efficiency in rice, characterized in that, Including improving rice OsWOX13 The gene expression level step, described OsWOX13 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

2.

4. The method according to claim 3, characterized in that, Through transfer OsWOX13 Gene overexpression cassettes to enhance OsWOX13 Gene expression levels.

5. The method according to claim 3, characterized in that, By hybridization, those with higher expression levels OsWOX13 Genes are introduced into rice to improve OsWOX13 Gene expression levels.

6. The method according to claim 3, characterized in that, The OsWOX13 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

Images