X-ray genetic coding framework nucleic acid probe based on synchrotron radiation light source as well as preparation method and application of X-ray genetic coding framework nucleic acid probe

Abstract

The invention provides an X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation light source as well as a preparation method and application of the X-ray genetic coding framework nucleic acid probe. The preparation method comprises the following steps: 1) constructing phagocytids containing enzyme and fluorescent protein expression sequences; (2) carrying out phage amplification on the phagocytids to obtain single chains with neck ring structures at two ends of a target sequence; 3) adding an enzyme digestion buffer solution containing Mg < 2 + > to cut off a target sequence; (4) carrying out ring connection on the target sequence linear single chain by using DNA ligase; 5) adding DNA excision enzyme to decompose non-target sequence DNA; 6) adding a customized staple chain to synthesize a framework nucleic acid probe; and 7) transfecting the genetic coding framework nucleic acid probe into the cells, adding a substrate reaction solution, and polymerizing the enzyme catalyzed substrate molecules to generate the X-ray visible polymer. According to the present invention, the method capable of actively entering the core to perform high-specificity recognition and high-resolution imaging on the intracellular biological target is provided, and the good biomedical application prospect is provided.

Description

Technical Field

[0001] The present invention relates to the field of biochemical technology, and more specifically to an X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation light source, and a preparation method and application thereof. Background Art

[0002] Microscopic imaging technology is one of the main driving forces for the development of cellular life sciences. The recently developed synchrotron radiation X-ray microscopy is a natural super-resolution microscopy technology, as the wavelength of X-rays is in the range of 0.1-10nm, and the resolution can theoretically reach several nanometers. Compared with electron beams, X-rays have stronger penetration into biological samples and can image intact cells without sectioning. Therefore, it provides a revolutionary means for exploring various life activities of cells. Combined with X-ray sensitive probes, it can provide information on the intracellular spatial localization of a variety of biological macromolecules.

[0003] The Chinese invention patent application (CN201710228597.9) discloses an X-ray genetic encoding probe based on a synchrotron radiation light source, which introduces a fusion expression plasmid into the cell nucleus through a transfection reagent to achieve high-specificity recognition and imaging of multiple biological targets in the cell. However, the efficiency of plasmid transfection is low, and it is necessary to optimize the transfection conditions and improve the purity of the plasmid. In addition, plasmid transfection has certain toxicity and damage to cells, which may affect cell growth and metabolism. Therefore, at this stage, there is an urgent need to develop a method for preparing an X-ray genetic encoding probe that can be actively transported into the nucleus. Summary of the invention

[0004] The purpose of the present invention is to provide an X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation light source, and a preparation method and application thereof, so as to solve the problems that the existing X-ray genetic coding probes cannot actively enter the nucleus, have low transfection efficiency and have certain cytotoxicity, and the problem that the existing microscopic imaging technology cannot perform highly specific recognition and imaging of intracellular biological molecules.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] According to a first aspect of the present invention, a method for preparing an X-ray genetic coding probe based on a synchrotron radiation light source is provided, and the preparation method comprises the following steps: 1) constructing a phagemid, which comprises: an enzyme, a fluorescent protein expression sequence, a nuclear localization enhancement sequence, a eukaryotic gene expression promoter and enhancer, a nuclear targeting sequence, a pseudogene sequence for forming a neck ring structure, a deoxyribozyme site, a phage packaging and replication sequence, wherein the nuclear localization enhancement sequence enables the probe target sequence to actively enter the nucleus for transcription and expression in the cell; 2) performing phage amplification and purification on the phagemid, stripping off the protein shell, and collecting a circular DNA single strand having a neck ring structure at both ends of the target sequence; 3) adding Mg-containing 2+ Enzyme cleavage buffer, catalyzing the DNA enzyme site to cut the linear single strand of the target sequence; 4) using DNA ligase to connect the linear single strand of the target sequence into a circular single strand; 5) adding DNA exonuclease to decompose the linear single strand of the non-target sequence; 6) adding a customized staple chain to synthesize the framework nucleic acid probe; 7) transfecting the genetically encoded framework nucleic acid probe into the cell, adding the substrate reaction solution, and allowing the enzyme to catalyze the polymerization of the substrate molecules to generate X-ray visible polymers.

[0007] According to the method provided by the present invention, its working principle is: the target sequence of the genetic coding probe is constructed into a phagemid vector by molecular biological methods, single-stranded DNA is extracted by phage amplification, the constructed restriction site is activated to remove unnecessary redundant sequences of the probe, and then it is looped to make it stably expressed in the cell. The looped probe sequence and the DNA staple chain designed according to the required structure are synthesized into a complex DNA framework nucleic acid structure to achieve the delivery of gene instructions to the cell, and the enzyme with catalytic activity and the target protein are expressed in the cell at the same time. The enzyme catalyzes the polymerization of substrate molecules to generate X-ray visible polymers, thereby realizing the observation of the location of the biological target in the cell.

[0008] Wherein, the enzyme in step 1) includes: ascorbate peroxidase (APEX, APEX2), mini singlet oxygen generating protein (miniSOG), tetracysteine ​​peptide (tetracysteine) or horseradish peroxidase (HRP) and the like, and APEX2 is most preferred.

[0009] Preferably, the nuclear targeting sequence in step 1) can be selected from OrigP, Tet operator sequence or SV40 DTS sequence, and the most preferred is SV40 DTS sequence, which contains many transcription factor binding sites such as AP1, AP2, AP3, AP4, NF-KB, SP1, etc. The arrangement of the DTS sequence in the target sequence includes single or multiple repeats before or after the enzyme and fluorescent protein expression sequence, and the most preferred is three repeats after the expression sequence.

[0010] The cells acted by the probe are conventionally passaged or primary cultured cell lines, and in the actual application process, the DNA sequence expressing the enzyme with catalytic activity and the target protein is designed when constructing the fusion expression plasmid according to the species of the cells. Preferably, the DNA sequence can be designed and optimized according to the preference of different species in the use of codons, so that it can be better expressed in the cell.

[0011] Preferably, the helper phage used for phage amplification in step 2) includes VCS-M13, M13KO7, etc., and VCS-M13 is most preferred. VCS-M13 helper phage can provide pII protein for phagemid. When the phagemid is transformed into competent cells, pII protein can preferentially recognize the target gene interval on the phagemid, initiate rolling circle replication, and synthesize ssDNA.

[0012] Preferably, the competent cell transformation method used for phage amplification in step 2) is heat shock in a 37-45°C water bath for 60-120s, most preferably heat shock in a 42°C water bath for 90s, and quickly incubated on ice for 5 minutes to allow the phagemid to enter the competent cells.

[0013] Preferably, the phage purification method in step 2) is to add PEG8000 (30-50 g / L) and NaCl (30-50 g / L) to the supernatant of the bacterial solution, select the optimal concentration according to the amount of precipitation, mix and stand, and centrifuge at 0-4°C, preferably 4°C.

[0014] Preferably, the enzyme digestion buffer Mg used in step 3) is 2+ The concentration is 10-50 mM, preferably 20 mM, and the pH is 6.90-7.10, preferably 7.00. 2+ Under catalysis, the DNA is broken at the DNAzyme site to obtain ssDNA of the target sequence.

[0015] Preferably, the working temperature of the DNA enzyme that cuts off the linear single strand of the target sequence in step 3) is 60-120° C., most preferably 90° C., and the working time is 2-10 min, most preferably 5 min.

[0016] Preferably, the DNA ligase used in step 4) has an action temperature of 30-60°C, most preferably 45°C, and a time of 1-12 hours, most preferably 10 hours.

[0017] Preferably, the DNA exonuclease used in step 5) has an action temperature of 30-60°C, most preferably 37°C, and a time of 1-12 hours, most preferably 2 hours.

[0018] Preferably, the feed ratio of the staple chain used in step 6) to the circularized target sequence chain is 5:1 to 20:1, and most preferably 10:1.

[0019] Preferably, the annealing program used in the synthesis of the framework nucleic acid structure in step 6) is as follows: ① 95°C DNA denaturation; ② 85°C to 60°C, decreasing by 1°C every 10 to 30 minutes, preferably decreasing by 1°C every 10 minutes; ③ 60°C to 40°C, decreasing by 1°C every 10 to 30 minutes, preferably decreasing by 1°C every 30 minutes; ④ 40°C to 25°C, decreasing by 1°C every 10 to 30 minutes, most preferably decreasing by 1°C every 15 minutes. The optimal annealing time is selected according to the characteristics of different framework nucleic acid structures.

[0020] Under the preferred conditions of step 6), the occurrence of deformed, aggregated, and degraded framework nucleic acids can be better avoided, thereby improving the efficiency of subsequent entry of framework nucleic acid probes into cells.

[0021] It should be understood that designing a DNA staple strand based on the looped probe sequence and the desired framework nucleic acid structure is within the prior art in the art.

[0022] Preferably, the genetic coding framework nucleic acid probe used in step 7) includes a rod-shaped, tubular, triangular, or tetrahedral structure synthesized using the target sequence ssDNA and the stapled strand. Based on the comparison of transfection effects under the same conditions, the rod-shaped structure is most preferred.

[0023] According to the second aspect of the present invention, there is also provided an application of an X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation light source in cell imaging.

[0024] The application may include the identification and imaging of any protein involved in cellular life activities.

[0025] According to the preparation method of an X-ray genetic coding probe based on a synchrotron radiation light source provided by the present invention, the technical difficulties mainly lie in the design and construction of phagemids, the extraction of the desired single-stranded target sequence, and the design of a synthetic framework nucleic acid structure. The key steps are mainly in step 1), which includes designing and constructing a phagemid, which includes: enzymes, fluorescent protein expression sequences, nuclear localization enhancement sequences, eukaryotic gene expression promoters and enhancers, nuclear targeting sequences, pseudogene sequences for forming neck loop structures, deoxyribozyme sites, phage packaging and replication sequences, and the designed and constructed sequences directly affect the extraction of single-stranded DNA, the efficiency of excision, and the efficiency of nuclear expression of subsequent synthetic framework nucleic acids. Among them, the nuclear localization enhancement sequence enables the probe target sequence to be actively transfected into the nucleus for transcription and expression in the cell, and the pseudogene sequence and deoxyribozyme site for forming the neck loop structure are used to form a deoxyribozyme (DNAzyme) with self-cleavage catalytic activity on the original DNA ring, and the non-target gene fragment is excised, and its position is just before and after the target sequence. The pseudogene sequence and DNAzyme site used to form the neck loop structure can be added selectively, but they are necessary components in the construction of the phagemid of the present invention, and their functions are to remove redundant sequences, reduce the size of the framework nucleic acid, and reduce the non-essential sequences entering the cell for expression. Under the condition of transfecting the same mass of DNA, more target genes can enter the cell, greatly improving the expression efficiency. Under the condition of transfecting the same amount of DNA, a smaller length of DNA sequence can enter the cell, reducing the cell rejection reaction.

[0026] As described in the background technology section of the present invention, the existing X-ray genetic coding probe based on synchrotron radiation light source introduces the fusion expression plasmid into the cell nucleus through a transfection reagent to achieve specific recognition and imaging of intracellular biological targets. This method has low transfection efficiency and has certain toxicity and damage to cells. It should be understood that the present invention is not limited to the specific framework nucleic acid structure of the embodiment. The method provided by the present invention mainly provides such an inventive concept. Based on the framework nucleic acid structure, the target sequence to be expressed is designed in the framework nucleic acid of different morphologies, and the constructed framework nucleic acid nanostructure enters a variety of mammalian cell lines through endocytosis. By optimizing the framework nucleic acid structure and size, a transfection efficiency of more than 90% can be achieved. Therefore, the present invention provides a method for specific recognition and imaging of intracellular biological targets without the need for active nuclear entry of plasmids, which has good transfection efficiency and high biocompatibility, and is expected to have good application prospects in this field.

[0027] In summary, the present invention provides a method for highly specific recognition and high-resolution imaging of intracellular biomolecules, which has good prospects for biomedical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1This is a synchrotron radiation imaging image of the HEK293T cell nucleus labeled with an X-ray genetic coding framework nucleic acid probe. The black circular area in the image is the cell nucleus.

[0029] Figure 2 This is a synchrotron radiation imaging image of HeLa cell mitochondria labeled with an X-ray genetic coding framework nucleic acid probe. The black granular areas in the image are mitochondria.

[0030] Figure 3A-3B It is a comparison chart of transfection efficiency of X-ray genetic coding framework nucleic acid probe and X-ray genetic coding probe; wherein, Figure 3A Fluorescence imaging of cells labeled with X-ray genetic coding framework nucleic acid probes. Figure 3B This is a fluorescent image of cells labeled with X-ray genetic encoding probes. The white area is the successfully transfected cells.

[0031] Figure 4 This is a data graph showing the cell survival rate of X-ray genetic coding framework nucleic acid probe and X-ray genetic coding probe tested by MTT method, and normalized to the average survival rate of untreated cell group;

[0032] Figures 5A-5D This is a comparison chart of transfection efficiency of X-ray genetic coding framework nucleic acid probes with different morphologies; among them, Figure 5A and Figure 5B These are the atomic force microscopy characterization images of the rod-shaped and triangular-shaped X-ray genetic coding framework nucleic acid probe morphologies. The white area is the framework nucleic acid structure. Figure 5C and Figure 5D These are the fluorescence images of cells labeled with rod-shaped and triangular-shaped X-ray genetic coding framework nucleic acid probes. The white area indicates the successfully transfected cells. DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional operations in the art, or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and materials used in the examples can be obtained from commercial sources unless otherwise specified.

[0034] Example 1 Preparation of X-ray Genetic Coding Framework Nucleic Acid Probe and Its Application in Nuclear Imaging

[0035] The phagemid pM13-NLS-EGFP-APEX2-DTS containing the probe target sequence was constructed. The construction process of the phagemid was carried out by conventional molecular biological methods, and the vector used the phagemid vector M13mp18 commonly used for phage amplification. In the target gene sequence, the cell nuclear localization sequence NLS and the enzyme expression sequence APEX2 were cloned from the plasmid APEX2-NLS (Addgene plasmid #124617), and the nuclear targeting sequence DTS, the pseudogene sequence for forming the neck loop structure, and the deoxyribozyme site were synthesized by GeneScript. After PCR amplification of the target gene sequence, T4 DNA ligase was used to connect it to the vector, and the positive clones were transformed and screened and then amplified. Batch synthesis and purification of phagemid vectors were completed by GenScript. The target gene sequence (SEQ ID No.1) inserted into the phagemid vector constructed by this method is as follows:

[0036] ATTACTATTATAGTTGAGCTGTCACGTCGAATCGACGTGACGTTGAAGTAATAGTAAT

[0037] CAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACG

[0038] GTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATG

[0039] ACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT

[0040] ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC

[0041] CCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACC

[0042] TTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGT

[0043] GATCGGTTTTGGCAGTACATCAATGGGGCGTGGATAGCGGTTTGACTCACGGGGATT

[0044] TCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACG

[0045] GGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGC

[0046] GTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCT

[0047] AGCGCTACCGGACTCAGATCTCGAATGGCTAGCCCCAAAAAGAAGAGGAAAGTGG

[0048] AGGGAGCTCCCAAGAAAAAGCGCAAGGTAGGTAGTTCCGCCACCATGGTGAGCAA

[0049] GGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACG

[0050] TAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGC

[0051] AAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC

[0052] CCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT

[0053] GAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCA

[0054] CCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAG

[0055] GGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG

[0056] GCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCA

[0057] TGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATC

[0058] GAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCG

[0059] ACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGC

[0060] AAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGC

[0061] CGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGGCGCGCCAAGGGCTCGGGCT

[0062] CGACCTCGGGCTCGGGCGGGAAATCATACCCAACAGTGTCCGCAGACTACCAGGAT

[0063] GCCGTGGAGAAAGCCAAGAAGAAGCTGAGAGGGTTTATCGCAGAAAAGAGGTGCG

[0064] CACCTCTGATGCTGAGACTGGCTTTCCACAGCGCAGGCACCTTTGACAAGGGAACC

[0065] AAAACAGGCGGACCCTTTGGAACAATCAAGCACCCTGCTGAACTGGCACATAGTGC

[0066] CAACAATGGGCTGGACATCGCCGTGCGGCTGCTGGAACCTCTGAAAGCAGAGTTCC

[0067] CAATTCTGTCCTACGCCGATTTTTATCAGCTGGCAGGAGTGGTCGCTGTGGAGGTCA

[0068] CTGGGGGCCCCAAGGTGCCTTTCCACCCAGGACGGGAGGACAAACCAGAACCACC

[0069] TCCAGAGGGGCGCCTGCCAGATCCGACAAAGGGCTCCGACCATCTGCGAGATGTGT

[0070] TTGGGAAAGCTATGGGCCTGACTGACCAGGATATCGTCGCACTGTCTGGAGGGCAC

[0071] ACCATTGGCGCCGCTCATAAGGAAAGGTCAGGCTTCGAGGGACCCTGGACAAGCAA

[0072] CCCCCTGATTTTCGACAATTCTTACTTTACTGAACTGCTGAGTGGAGAGAAGGAAGG

[0073] GCTGCTGCAGCTGCCCAGCGACAAAGCCCTGCTGTCCGATCCCGTGTTCAGACCTCT

[0074] GGTCGATAAGTATGCAGCCGACGAGGATGCTTTTTTCGCAGATTACGCAGAAGCACA

[0075] TCAGAAGCTGTCAGAACTGGGATTTGCCGACGCCTAAGCGGCCGCGACTCTAGATC

[0076] ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACC

[0077] TCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGC

[0078] AGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTT

[0079] TTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCTTTCT

[0080] TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGG

[0081] GATGCGGCCGCTCGAGTCTAGAGGAATTCATCCGGTGTGGAAAGTCCCCAGGCTCC

[0082] CCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAAAGCTCT

[0083] AGAGATCCGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA

[0084] TGCATCTCAATTAGTCAGCAACCAAAGCTTTAAACCATCCGGTGTGGAAAGTCCCCA

[0085] GGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAA

[0086] AGCGCGGAGCATCTTAGTAGATCAgctaagctgatcgaTTGGGGAATAGATCTTTGGGACCC

[0087] GCGCTTTG

[0088] Phage amplification and ssDNA extraction. The constructed phagemid was co-transformed with Trans1-blue competent cells and the same amount of VCS-M13 helper phage, and cultured and amplified. Centrifuge all the bacterial liquid, take the supernatant, add 40g / LPEG8000 and 30g / L NaCl (final concentration), mix well, ice bath for 30min, centrifuge at 4℃4000×g for 30min, and remove the supernatant. Redissolve with pH 8.5TE buffer, centrifuge to remove the precipitate, add 2 volumes of PPB2 solution (0.2M NaOH, 1% SDS) to the supernatant, mix slowly, and denature and separate the phage protein coat and DNA under alkaline conditions. Then add 1.5 volumes of PPB3 (3M potassium acetate, pH=5.5), mix slowly, and renature and dissolve the DNA. Ice bath for 30 minutes, centrifuge to remove SDS and protein components, take the supernatant and use ethanol method to extract and purify ssDNA.

[0089] Enzyme digestion and cyclization of ssDNA. The extracted ssDNA was dissolved in Buffer 1 (50mM HEPE, 100mM NaCl, pH = 7.00). The sample was placed in a 90°C environment for 5 minutes for denaturation, and the ribozyme formed a secondary structure after slow cooling. Then an equal volume of Buffer 2 (50mM HEPES, 100mM NaCl, 4mM ZnCl2, 20mM MgCl2, pH = 7.00) was added and incubated in a 37°C environment to allow the deoxyribozyme to catalyze the cleavage of ssDNA. The recovered ssDNA was mixed with a splint chain (20nt) designed according to the enzyme cleavage site, heated to 95°C, and then slowly annealed. The splint chain was synthesized by Shanghai Shenggong Biotechnology Co., Ltd. After annealing, T4 DNA ligase (purchased from New England Biolabs) and 10×T4 DNA ligase buffer were added, and incubated at 45°C for 10 hours to synthesize circular ssDNA.

[0090] Design and synthesis of framework nucleic acid structure. Cadnano 2 (Version 2.4) software was used to generate staple strand sequences according to the target gene sequence. 1 (Douglas, SM; Marblestone, AH; Teerapittayanon, S.; Vazquez, A.; Church, GM; Shih, WM. Raded Prototyping of 3D DNA-Origami Shapes with caDNAno. Nucleic Acids Res. 2009, 37(15), 5001–5006. https: / / doi.org / 10.1093 / nar / gkp436) The stapler chains were all synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The oligonucleotide sequences were purified by ULTRAPAGE purification, and the DNA powder was then dissolved in ultrapure water and used after quantification. The circularized ssDNA was mixed with the mixed staple strands at a ratio of 1:10 and dissolved in 1×TAE Mg buffer (40mM Tris-HCl, 20mM acetic acid, 2.5mM EDTA and 12.5mM MgCl2, pH 8.0). Slow annealing was performed by PCR instrument, and the general annealing program was as follows: ① 95℃ DNA denaturation; ② 85℃ to 60℃, 1℃ decrease every 10 minutes; ③ 60℃ to 40℃, 1℃ decrease every 30 minutes; ④ 40℃ to 25℃, 1℃ decrease every 15 minutes. After annealing, store at 4℃.

[0091] The splint strand gene sequence (SEQ ID No. 2) used for circularizing ssDNA is as follows: TACTATTACTCCGCGCTTTG.

[0092] Cell culture and probe labeling. HEK293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences. Cells in the logarithmic growth phase were taken and silicon nitride windows were placed in cell culture plates. After UV sterilization, 1.0×10 5 Cells were seeded in 24-well plates and cultured to normal growth. The synthetic EGFP-APEX2-NLS-DTS genetic coding framework nucleic acid probe was transfected into the cells at a ratio of 200 ng per well. After 24 hours, the culture medium was removed, fixed with 2.5% glutaraldehyde, permeabilized with 0.25% TritonX, and metal-enhanced DAB reaction solution containing 0.3% H2O2 was added for 10 minutes. The reaction solution was removed and fixed with 4% paraformaldehyde. Dehydrated with gradient ethanol.

[0093] The X-ray imaging experiment of cells labeled with the NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe was carried out at the BL07W soft X-ray imaging line station of the National Synchrotron Radiation Laboratory. The experimental method was soft X-ray transmission imaging (TXM). The X-rays were extracted by an undulator, monochromated by a plane grating monochromator, and then focused on the sample by a zone plate with a resolution of 30nm in all directions. The sample was placed in a vacuum sample chamber, and the X-ray incident energy was selected to be 520eV. The moving motor was used to complete the search and focusing of the sample, and then X-ray imaging was performed.

[0094] The TXM imaging results of HEK293T cells labeled with the NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe are shown in Figure 1 It can be observed that the X-ray absorption of the cell nucleus is much higher than that of other parts, and the outline of the cell nucleus is clear.

[0095] Example 2 Preparation of X-ray Genetic Encoding Framework Nucleic Acid Probe and Its Application in Mitochondrial Imaging

[0096] The phagemid pM13-COX4-EGFP-APEX2-DTS containing the probe target sequence was constructed. The construction process of the phagemid was carried out by conventional molecular biological methods, and the vector used the phagemid vector M13mp18 commonly used for phage amplification. Among the target gene sequences, the mitochondrial localization sequence COX4 and the enzyme expression sequence APEX2 were cloned from the plasmid APEX2-COX4 (Addgene plasmid #72480), and the nuclear targeting sequence DTS, the pseudogene sequence for forming the neck loop structure, and the deoxyribozyme site were synthesized by GeneScript. After PCR amplification of the target gene sequence, T4 DNA ligase was used to connect it to the vector, and the positive clones were transformed and screened and then amplified. Batch synthesis and purification of phagemid vectors were completed by GenScript.

[0097] The target gene sequence (SEQ ID No.3) inserted into the phagemid vector is shown as follows:

[0098] TAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTAC

[0099] ATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGAC

[0100] GTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAA

[0101] TGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGC

[0102] CAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCC

[0103] AGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT

[0104] ATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACT

[0105] CACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACC

[0106] AAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATG

[0107] GGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGT

[0108] CAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGGCCGCCACCATGCTGGCCACCC

[0109] GCGTGTTCAGCCTGGTGGGCAAGCGCGCCATCAGCACCAGCGTGTGCGTGCGCGCC

[0110] CACAAGGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT

[0111] CCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAG

[0112] GGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGG

[0113] CAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGT

[0114] GCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGC

[0115] CCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAG

[0116] ACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGA

[0117] AGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAA

[0118] CTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGG

[0119] TGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCAC

[0120] TACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTA

[0121] CCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGG

[0122] TCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTAC

[0123] AAGGGGCGCGCCAAGGGCTCGGGCTCGACCTCGGGCTCGGGCGGGAAATCATACCC

[0124] AACAGTGTCCGCAGACTACCAGGATGCCGTGGAGAAAGCCAAGAAGAAGCTGAGA

[0125] GGGTTTATCGCAGAAAAGAGGTGCGCACCTCTGATGCTGAGACTGGCTTTCCACAG

[0126] CGCAGGCACCTTTGACAAGGGAACCAAAACAGGCGGACCCTTTGGAACAATCAAG

[0127] CACCCTGCTGAACTGGCACATAGTGCCAACAATGGGCTGGACATCGCCGTGCGGCT

[0128] GCTGGAACCTCTGAAAGCAGAGTTCCCAATTCTGTCCTACGCCGATTTTTATCAGCT

[0129] GGCAGGAGTGGTCGCTGTGGAGGTCACTGGGGGCCCCAAGGTGCCTTTCCACCCAG

[0130] GACGGGAGGACAAACCAGAACCACCTCCAGAGGGGCGCCTGCCAGATCCGACAAA

[0131] GGGCTCCGACCATCTGCGAGATGTGTTTGGGAAAGCTATGGGCCTGACTGACCAGG

[0132] ATATCGTCGCACTGTCTGGAGGGCACACCATTGGCGCCGCTCATAAGGAAAGGTCAG

[0133] GCTTCGAGGGACCCTGGACAAGCAACCCCCTGATTTTCGACAATTCTTACTTTACTG

[0134] AACTGCTGAGTGGAGAGAAGGAAGGGCTGCTGCAGCTGCCCAGCGACAAAGCCCT

[0135] GCTGTCCGATCCCGTGTTCAGACCTCTGGTCGATAAGTATGCAGCCGACGAGGATGC

[0136] TTTTTTCGCAGATTACGCAGAAGCACATCAGAAGCTGTCAGAACTGGGATTTGCCGA

[0137] CGCCTAAGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTT

[0138] ACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGC

[0139] AATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCA

[0140] TCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAA

[0141] ACTCATCAATGTATCTTAAGGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGT

[0142] TCCCTAAGTCCAACTACTAAACTGGGGATGCGGCCGCTCGAGTCTAGAGGAATTCAT

[0143] CCGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATC

[0144] TCAATTAGTCAGCAACCAAAGCTCTAGAGATCCGGTGTGGAAAGTCCCCAGGCTCC

[0145] CCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAAAGCTTTA

[0146] AACCATCCGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA

[0147] TGCATCTCAATTAGTCAGCAACCAAAGCGCGG

[0148] The extraction, enzyme digestion and cyclization of ssDNA were the same as in Example 1. The design of the framework nucleic acid structure was performed by using Cadnano 2 (Version 2.4) software to generate the staple chain sequence according to the target gene sequence. 1 Methods The length and arrangement of the staple chains were optimized. All staple chains were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. After purification by ULTRAPAGE, the staple chain DNA powder was dissolved in ultrapure water and used after quantification. The method for annealing and synthesizing the framework nucleic acid structure was the same as in Example 1.

[0149] Cell culture and probe labeling. HeLa cells were purchased from the Cell Bank of the Chinese Academy of Sciences Typical Culture Collection Committee. Cells in the logarithmic growth phase were taken and silicon nitride windows were placed in cell culture plates. They were sterilized by ultraviolet light and 7.0×10 4 Cells were seeded in 24-well plates and cultured to normal growth. Synthesized COX4-EGFP-APEX2-DTS genetic coding framework nucleic acid probe was transfected into cells at a ratio of 200 ng per well. After 24 hours, the culture medium was removed, fixed with 2.5% glutaraldehyde, permeabilized with 0.25% Triton X, and metal-enhanced DAB reaction solution containing 0.3% H2O2 was added for 10 minutes. The reaction solution was removed and fixed with 4% paraformaldehyde. Dehydrated with gradient ethanol.

[0150] The X-ray imaging experiment of cells labeled with the COX4-EGFP-APEX2-DTS genetic coding framework nucleic acid probe was carried out at the BL07W soft X-ray imaging beamline of the National Synchrotron Radiation Laboratory, and the imaging method was the same as that in Example 1.

[0151] The results of TXM imaging of HeLa cells labeled with COX4-EGFP-APEX2-DTS genetic coding framework nucleic acid probe are shown in Figure 2 It can be observed that the X-ray absorption of the mitochondrial part is much higher than that of other parts, and the mitochondrial outline is clear with good resolution.

[0152] Example 3 Comparison of transfection efficiency of X-ray genetic coding framework nucleic acid probe and X-ray genetic coding probe

[0153] Cell culture and probe labeling. HEK293T cells were cultured at 5.0 × 10 5 The cells were inoculated in wells B1 to B4 of a 12-well plate and cultured to a normal growth state. Well B1 was not treated, and the NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe synthesized in Example 1 was transfected into the B2 well cells at a ratio of 500 ng per well, and the EGFP-APEX2-NLS genetic coding probe was transfected into the B3 well cells at a ratio of 475 ng per well. The EGFP-APEX2-NLS genetic coding probe was added to the B4 well cells at a ratio of 475 ng per well without special treatment. After 24 hours, the culture medium was removed and fixed with 4% paraformaldehyde. Fluorescence imaging was used to compare the transfection efficiency. Among them, the preparation method of the EGFP-APEX2-NLS genetic coding probe refers to the Chinese invention patent application with application number ZL201710228597.9 and the invention name "A kind of X-ray genetic labeling probe based on synchrotron light source and its preparation method and application", which is used as a control in this embodiment.

[0154] Fluorescence imaging was used to compare transfection efficiency. Imaging was performed using a Zeiss Axios Imager.A2 fluorescence microscope, using a gold halide light source and a 490nm filter channel, and a 10x objective to obtain clear cell fluorescence images.

[0155] The fluorescence imaging results of HEK293T cells labeled with the synthetic NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe are shown in Figure 3A The fluorescence imaging results of HEK293T cells labeled with EGFP-APEX2-NLS genetically encoded probe are shown in Figure 3B It can be observed that Figure 3A The ratio of fluorescent expression cells Figure 3B The higher the value, the higher the transfection efficiency of X-ray genetic encoding framework nucleic acid probe is.

[0156] Example 4 Comparison of cytotoxicity of synchrotron radiation X-ray genetic encoding framework nucleic acid probe and synchrotron X-ray genetic encoding probe

[0157] Cell culture and probe cytotoxicity assay. HEK293T cells were cultured at 5.0 × 10 4The cells were inoculated in wells C1 to E12 in a 96-well plate and cultured to a normal growth state. Wells C1 to C12 were not treated, and the NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe synthesized in Example 1 was labeled with cells in wells D1 to D12 at a ratio of 50 ng per well, and the EGFP-APEX2-NLS genetic coding probe (see Example 3) was labeled with cells in wells E1 to E12 at a ratio of 48 ng per well, and cultured for 24 hours. Cytotoxicity was determined by the MTT method. 10 μL of MTT (0.5 mg / mL) solution was added to each well and incubated at 37°C for 3 hours to obtain crystals. The supernatant was removed and dissolved with 200 μL of DMSO per well. The absorbance value was recorded at 590 nm using an enzyme marker. The absorbance of untreated cells in wells C1 to C12 was used as a control to compare the survival rates of cells in wells D1 to D12 and E1 to E12.

[0158] The cell survival rate was tested by MTT method and normalized to the mean survival rate of the untreated cell group. Figure 4 The survival rate of cells labeled with the NLS-EGFP-APEX2-DTS genetic coding framework nucleic acid probe was 93.5%, which was significantly higher than that of cells labeled with the EGFP-APEX2-NLS genetic coding probe, indicating that the genetic coding framework nucleic acid probe labeling has higher biosafety.

[0159] Example 5 Comparison of transfection efficiency of X-ray genetic coding framework nucleic acid probes with different morphologies

[0160] Design and synthesis of framework nucleic acid structures. The rod-shaped framework nucleic acid and the triangle-shaped framework nucleic acid structures were designed using Cadnano 2 (Version 2.4) software to generate staple chain sequences based on the target gene sequence. 1 Methods Optimize the length and arrangement of staple chains. All staple chains were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The oligonucleotide sequences were purified by ULTRAPAGE purification, and the DNA powder was then dissolved in ultrapure water and used after quantification. The method for combining the rod-shaped framework nucleic acid and the triangular framework nucleic acid was the same as in Example 1.

[0161] Characterization of framework nucleic acid structure. After the rod-shaped framework nucleic acid and the triangular framework nucleic acid structure were synthesized and purified, the morphology was characterized by Bruker multimode 8 atomic force microscope (AFM). AFM morphology characterization of rod-shaped genetic coding framework nucleic acid probes can be found in Figure 5A , AFM morphology characterization of triangular genetic coding framework nucleic acid probes see Figure 5B , clear shape and no impurities.

[0162] Cell culture and probe labeling. HEK293T cells were cultured at 5.0 × 10 5Cells were inoculated in wells B1 to B3 of a 12-well plate and cultured to normal growth. Well B1 was not treated, and the synthetic NLS-EGFP-APEX2-DTS rod-shaped genetic coding framework nucleic acid probe was transfected into the cells of well B2 at a ratio of 500ng per well, and the NLS-EGFP-APEX2-DTS triangle-shaped genetic coding framework nucleic acid probe was transfected into the cells of well B3 at a ratio of 500ng per well. After 24h, the culture medium was removed and fixed with 4% paraformaldehyde. Fluorescence imaging can be quickly performed to compare the transfection efficiency.

[0163] Fluorescence imaging to compare transfection efficiency. Imaging was performed using a Zeiss Axios Imager.A2 fluorescence microscope, and the imaging method was the same as in Example 3. Clear cell fluorescence images were obtained under a 10x objective lens.

[0164] Fluorescence imaging of cells labeled with NLS-EGFP-APEX2-DTS rod-shaped genetic coding framework nucleic acid probe Figure 5C , fluorescent imaging of cells labeled with triangular genetic coding framework nucleic acid probes Figure 5D The fluorescence expression efficiency of cells labeled with rod-shaped genetic coding framework nucleic acid probes was higher than that of cells labeled with triangle-shaped genetic coding framework nucleic acid probes.

[0165] The above is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention. The above embodiments of the present invention can also be modified in various ways. All simple, equivalent changes and modifications made according to the claims and the description of the present invention fall within the scope of protection of the claims of the present invention. The contents not described in detail in the present invention are all conventional technical contents.

Claims

1. A method for preparing an X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation source, characterized in that: The preparation method comprises the following steps: 1) constructing a phagemid, which includes: an enzyme, a fluorescent protein expression sequence, a nuclear localization enhancement sequence, a eukaryotic gene expression promoter and enhancer, a nuclear targeting sequence, a pseudogene sequence for forming a neck loop structure, a deoxyribozyme site, a phage packaging and replication sequence, wherein the nuclear localization enhancement sequence enables the probe target sequence to actively enter the nucleus for transcription and expression in the cell; 2) amplifying and purifying the phagemid, stripping off the protein coat, and collecting a circular DNA single strand with a neck-loop structure at both ends of the target sequence; 3) Add Mg 2+ Enzyme digestion buffer, catalyzing the DNA enzyme site to cut the linear single strand of the target sequence; 4) Connect the linear single strand of the target sequence into a circular single strand using DNA ligase; 5) Add DNA exonuclease to decompose linear single strands of non-target sequences; 6) Adding customized staple strands to synthesize framework nucleic acid probes; 7) Transfect the genetic coding framework nucleic acid probe into the cell, add the substrate reaction solution, and allow the enzyme to catalyze the polymerization of the substrate molecules to generate X-ray visible polymers.

2. The preparation method according to claim 1, characterized in that: The enzyme in step 1) includes ascorbate peroxidase, mini singlet oxygen generating protein, tetracysteine ​​peptide or horseradish peroxidase.

3. The preparation method according to claim 1, characterized in that: The nuclear targeting sequence in step 1) can use OrigP, Tet operator sequence or SV40 DTS sequence, the SV40 DTS sequence contains a transcription factor binding site selected from AP1, AP2, AP3, AP4, NF-KB, SP1, and the arrangement of the nuclear targeting sequence in the target sequence includes single or multiple repeats before or after the enzyme and fluorescent protein expression sequence.

4. The preparation method according to claim 1, characterized in that: The auxiliary phages used for phage amplification in step 2) include VCS-M13 and M13KO7; the competent cell transformation method used for phage amplification in step 2) is: heat shock in a 37-45°C water bath for 60-120s, and quickly incubate on ice for 5-10min; the phage purification method is to add 30-50g / L PEG8000 and 30-50g / L NaCl to the supernatant of the bacterial liquid, mix well, let stand, and centrifuge at 0-4°C.

5. The preparation method according to claim 1, characterized in that: The enzyme digestion buffer used in step 3) is Mg 2+ The concentration is 10-50 mM, and the pH is 6.90-7.10; the working temperature of the deoxyribozyme for cutting off the linear single-stranded target sequence is 60-120° C., and the time is 1-10 minutes.

6. The preparation method according to claim 1, characterized in that: The DNA ligase used in step 4) has an action temperature of 30-60°C for 1-12 hours; the DNA exonuclease used in step 5) has an action temperature of 30-60°C for 1-12 hours.

7. The preparation method according to claim 1, characterized in that: The staple chain and target sequence chain feed ratio used in step 6) is 5:1 to 20:1; the annealing program used in the framework nucleic acid structure synthesis in step 6) is as follows: ① 95°C DNA denaturation; ② 85°C to 60°C, decreasing by 1°C every 10 to 30 min; ③ 60°C to 40°C, decreasing by 1°C every 10 to 30 min; ④ 40°C to 25°C, decreasing by 1°C every 10 to 30 min.

8. The preparation method according to claim 1, characterized in that: The genetic coding framework nucleic acid probe used in step 7) includes a rod-shaped, tubular, triangular, or tetrahedral structure synthesized using target sequence ssDNA and staple chains.

9. An X-ray genetic coding framework nucleic acid probe based on a synchrotron radiation light source, prepared according to the preparation method according to any one of claims 1 to 8.

10. Use of the X-ray genetic coding framework nucleic acid probe based on synchrotron radiation source according to claim 9 in cell imaging.

Images