Application of natural inhibitor taking PRDX1 as drug target in preparation of anti-breast cancer drugs

Abstract

The invention discloses a novel drug application of a natural inhibitor taking PRDX1 as a drug target. The natural inhibitor is a macrolide compound pochonin D, can specifically target PRDX1, inhibits the expression of PRDX1 protein through the interaction between proteins, is applied to the field of breast cancer treatment, especially triple-negative breast cancer, has a remarkable in-vivo and in-vitro anti-tumor effect, effectively delays the in-vivo and in-vitro growth process of breast cancer, and has a good application prospect. And a new treatment scheme is provided for treatment of breast cancer. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to a drug application of a natural inhibitor taking PRDX1 as a drug target, and in particular to an application of a natural inhibitor taking PRDX1 as a drug target, namely a macrolide compound pochonin D, in the preparation of an anti-breast cancer drug. Background Art

[0002] Breast cancer is one of the most common malignant tumors in women. Factors such as estrogen levels, genetic genes, obesity, and ionizing radiation in women may all be factors that promote the occurrence and development of breast cancer. According to histopathological classification, triple negative breast cancer (TNBC) is a subtype of breast cancer in which the expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor (HER2) is low or absent in the patient's expression profile. Compared with other breast cancer subtypes, TNBC is the most invasive and heterogeneous, with a high rate of visceral metastasis, low diagnostic efficiency, limited treatment options, the worst prognosis, and easy recurrence.

[0003] Due to the lack and high heterogeneity of ERs, PRs and HER2, there are no specific target receptors, and TNBC is still difficult to be effectively treated with biological targeted therapy. Traditional chemotherapy is the main treatment method used clinically. Although doxorubicin can significantly improve the survival of breast cancer patients, it also has irreversible adverse reactions such as cardiotoxicity and bone marrow toxicity, which limits its application. Long-term use of paclitaxel can make tumor cells dependent and resistant, leading to chemotherapy failure. It can be seen that overcoming bottlenecks such as adverse reactions of chemotherapeutic drugs, multifactorial resistance and off-target toxicity is still a challenge that breast cancer and TNBC need to face in the treatment. Summary of the invention

[0004] Purpose of the invention: The present invention aims to provide a new drug application of a natural inhibitor of PRDX1 as a drug target, namely, a macrolide compound pochonin D, in the treatment of breast cancer.

[0005] Technical solution: The natural inhibitor of PRDX1 as a drug target, the macrolide compound pochonin D, is used in the preparation of drugs for treating breast cancer.

[0006]

[0007] Natural products have diverse biological activities and targets as well as low toxic side effects. They have become an important resource for new drug development and are expected to bring new treatment hope to breast cancer patients. Therefore, exploring new effective treatment targets for breast cancer and developing new and safer targeted drugs are key to solving current limitations.

[0008] The present invention studies the metabolites of the endophytic fungus Ilyonectria sp. FL-710 of the aster plant, and successfully obtains the natural macrolide compound pochonin D by using silica gel column chromatography, RP-18 and Sephadex LH-20 gel column chromatography. Compared with traditional chemical synthetic drugs, natural products can show significant advantages in the field of new anti-tumor drug discovery due to their structural complexity, structural diversity, low toxicity, and low resistance to drugs.

[0009] Preferably, the drug is a drug for treating triple-negative breast cancer.

[0010] Preferably, the drug is a drug that inhibits the proliferation of breast cancer cells.

[0011] More preferably, the drug is a drug that inhibits the proliferation of triple-negative breast cancer cells.

[0012] More preferably, the drug inhibits the proliferation of breast cancer cells in a dose-dependent manner.

[0013] Preferably, the drug is a drug that downregulates PRDX1 expression.

[0014] The present invention uses bioinformatics methods and clinical sample tissue chip analysis to find that PRDX1 is generally highly expressed in breast cancer patients, and its high expression is significantly correlated with the patients' poor prognosis. This not only reveals the clinical significance of PRDX1 protein in breast cancer, but also provides a potential drug target for breast cancer treatment.

[0015] Specifically, down-regulating the expression level of PRDX1 can significantly inhibit the proliferation of breast cancer cells and promote cell apoptosis, while up-regulating the expression level of PRDX1 can promote cell growth.

[0016] More specifically, downregulating the expression level of PRDX1 significantly inhibited the growth of breast cancer tumors, whereas upregulating the expression level of PRDX1 promoted tumor growth.

[0017] Preferably, the drug is a drug that targets and inhibits PRDX1 protein.

[0018] More preferably, the drug inhibits the expression of PRDX1 protein in a dose- and time-dependent manner.

[0019] More preferably, the drug can enhance the resistance of PRDX1 protein to protease degradation.

[0020] More preferably, the drug enhances the resistance of PRDX1 protein to protease degradation in a dose-dependent manner.

[0021] Specifically, pochonin D can reduce the intracellular PRDX1 protein level and inhibit its protein activity, and the four technologies of CETSA, DARTS, ITC and MST confirmed that pochonin D and PRDX1 can interact.

[0022] More specifically, in in vitro experiments, downregulating PRDX1 can alleviate the toxicity of pochonin D to two breast cancer cells, while overexpressing PRDX1 can enhance its cytotoxicity; in in vivo experiments, pochonin D can significantly inhibit the growth of breast cancer tumors. Overexpressing PRDX1 can be observed to significantly inhibit tumor growth, while downregulating PRDX1 did not observe the effect of pochonin D in inhibiting tumor growth. The above results further indicate that pochonin D plays a role in treating breast cancer by targeting PRDX1.

[0023] Preferably, the preparation method of the macrolide compound pochonin D comprises the following steps:

[0024] (1) fermenting the endophytic fungus Ilyonectria sp. FL-710 from Aster plant in a rice solid culture medium and extracting with ethyl acetate to obtain an extract;

[0025] (2) separating and purifying the extract obtained in step (1) to obtain the macrolide compound pochonin D.

[0026] Specifically, Ilyonectria sp. FL-710 was cultured until the mycelium completely covered the culture dish, and then the mycelium was chopped and transferred to the rice culture medium under a sterile environment, and continued to ferment statically. The rice fermentation product of strain Ilyonectria sp. FL-710 was extracted with ethyl acetate, and the extract was concentrated under reduced pressure to obtain a total extract. It was then treated with silica gel column chromatography and gradient eluted with petroleum ether / acetone in different ratios (1:0, 20:1, 2:1, 1:1) to obtain 4 fractions (Fr.1~Fr.4). Among them, Fr.2 was subjected to silica gel column chromatography and gradient eluted with methanol / water (10%~90%) to obtain 5 fractions (Fr.2-1~Fr.2-5). Among them, Fr.2-3 was subjected to column chromatography and isocratically eluted with chloroform / methanol (1:1) to obtain 6 fractions (Fr.2-3-1~Fr.2-3-6). Among them, Fr.2-3-2 was separated by semi-preparative high performance liquid chromatography to obtain compound pochonin D.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0028] The present invention finds that pochonin D can specifically target PRDX1 and inhibit the expression of PRDX1 protein through the interaction between proteins. It can be applied to the field of breast cancer treatment, especially triple-negative breast cancer. It has significant anti-tumor effects in vivo and in vitro, and can effectively delay the growth process of breast cancer in vivo and in vitro, providing a new treatment plan for the treatment of breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 To investigate the expression of PRDX1 in breast cancer and its relationship with poor prognosis;

[0030] Figure 2 To investigate the effects of knockdown and overexpression of PRDX1 on proliferation and apoptosis of breast cancer cells MDA-MB-231 and 4T1;

[0031] Figure 3 To investigate the effects of knockdown and overexpression of PRDX1 on the growth of 4T1 subcutaneous xenograft tumors in mice;

[0032] Figure 4 The preparation process of the macrolide compound pochonin D is provided;

[0033] Figure 5 The effect of pochonin D on the proliferation of breast cancer cells MDA-MB-231 and 4T1;

[0034] Figure 6 The effects of pochonin D on PRDX1 protein expression and activity as well as the binding test results;

[0035] Figure 7 To investigate the effects of knockdown and overexpression of PRDX1 on the cytotoxicity of pochonin D against breast cancer cells MDA-MB-231 and 4T1;

[0036] Figure 8 The effects of pochonin D on the growth of normal 4T1 subcutaneous xenograft tumors in mice and after knockdown and overexpression of PRDX1. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described below in conjunction with embodiments.

[0038] Example 1: Expression of PRDX1 in breast cancer and its relationship with poor prognosis

[0039] 1. Experimental methods

[0040] This experiment analyzed the expression level of PRDX1 gene in breast cancer and its relationship with patient prognosis and survival by accessing TCGA, GTEx and UALCAN databases (http: / / ualcan.path.uab.edu / analysis.html). In addition, the expression level of PRDX1 protein was detected by using different breast cancer tumor tissues and adjacent tissue chips, and the expression level of PRDX1 protein in two clinically representative breast cancer tissue samples was analyzed with the help of HPA database. In order to evaluate the effect of PRDX1 on the overall survival of breast cancer patients, the univariate Cox regression model and Kaplan-Meier survival curve analysis were used to reveal the value of this gene as a potential prognostic marker.

[0041] 2. Experimental results

[0042] like Figure 1 As shown in the study, the expression of PRDX1 in breast cancer tissue was significantly higher than that in normal breast tissue; breast cancer patients with high expression of PRDX1 gene had a poor prognosis and a significantly shorter overall survival period than patients with low expression of PRDX1 gene (P=0.02). The above results suggest that PRDX1 is commonly highly expressed in breast cancer patients, and high expression of PRDX1 is closely related to poor prognosis of patients, making it a potential target for breast cancer treatment.

[0043] Example 2: Effects of knockdown and overexpression of PRDX1 on proliferation and apoptosis of breast cancer cells MDA-MB-231 and 4T1

[0044] 1. Experimental methods

[0045] (1) siRNA cell transfection experiment: The PRDX1 siRNA used in this experiment was chemically synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., and the siRNA stock solution (20 μM) was subsequently prepared according to the siRNA synthesis report and instruction manual. The primer sequences were F: CAGAUGGUCAGUUUAAAGAUA, R: UAUCUUUAAACUGACCAUCUG.

[0046] MDA-MB-231 or 4T1 cells were inoculated in a 6-well plate at an appropriate concentration, and allowed to adhere to the wall in an incubator for 24 hours. 1.6 mL of fresh antibiotic-free medium containing 10% FBS was replaced. Take 2 sterile centrifuge tubes, fill each with 200 μL of serum-free medium, add 4 μL siRNA to one tube, and add 4 μL Lipofectamine RNAiMAX to one tube, mix them gently, let them stand at room temperature for 5 minutes, mix the two tubes of solution evenly, and let them stand for 15 minutes. The siRNA transfection complex solution was dripped into the well plate drop by drop, gently shaken, and returned to the 37°C carbon dioxide incubator for culture, and the cells were collected after 48 hours.

[0047] (2) PRDX1 overexpression experiment: MDA-MB-231 or 4T1 was inoculated into a 6-well plate at an appropriate concentration and allowed to adhere to the plate in an incubator for 24 hours. A pair of sterile EP tubes were filled with 200 μL of serum-free culture medium, 2 μg of the extracted overexpression plasmid was added to one tube, and 4 μL of Lipofectamine 2000 was added to the other tube. The tubes were gently mixed and allowed to stand for 5 minutes. The two tubes were then gently mixed to form a complex, which was allowed to stand for 10 minutes. The liquid was added dropwise to the culture medium and gently shaken, then returned to the incubator and the medium was changed after 8 hours. The cells were harvested after 24 hours.

[0048] (3) SRB detection of cell proliferation: After the above-mentioned PRDX1 knockdown and overexpression operations were performed on breast cancer cells MDA-MB-231 and 4T1, they were digested with trypsin and centrifuged. Subsequently, they were seeded into 96-well plates at appropriate densities and placed in a 37°C incubator for 48 h before SRB colorimetric determination. The absorbance value was detected at 540 nm and the cell survival rate was calculated.

[0049] (4) Flow cytometry detection: After knockdown and overexpression of PRDX1 breast cancer cells MDA-MB-231 and 4T1 were inoculated into 6-well plates, they were digested with EDTA-free trypsin when they adhered to the wall and grew to an appropriate density (about 80%), and then the cells were blown with pre-cooled PBS and centrifuged at 300g, 5min, and 4°C to collect the cells. Then, the cells were washed twice with PBS, the residual liquid was removed, and the cells were resuspended with 100μL flow buffer. Finally, the flow dye containing Annexin V and PI was added to the cells and incubated in the dark for 15min, and then the cells were passed through a 200-mesh cell screen to detect the level of cell apoptosis on a flow cytometer.

[0050] 2. Experimental results

[0051] like Figure 2 As shown in the figure, compared with the control group, the apoptosis level of breast cancer cells MDA-MB-231 and 4T1 was significantly increased and the cell proliferation activity was decreased after knocking down PRDX1; on the contrary, overexpression of PRDX1 promoted cell proliferation.

[0052] Example 3: Effects of knockdown and overexpression of PRDX1 on tumor growth in 4T1 xenograft mice.

[0053] 1. Experimental methods

[0054] The 4T1 cells with knockdown and overexpression of PRDX1 were trypsinized, centrifuged, and resuspended in sterile PBS to adjust the cell density to 2 × 10 5The experiment used 6-week-old BALB / c female mice, which were divided into three groups: WT group, PRDX1-KD group and PRDX1-OV group, with 7 mice in each group. After depilating the right armpit of the mice, 100 μL of the above cell fluid was subcutaneously injected into each mouse in the corresponding group. The long and short diameters of the tumors were measured every two days. According to the mouse tumor calculation formula, tumor volume = 1 / 2 (long diameter × short diameter) 2 ), calculate the tumor size and record it. At the end of the experiment, all mice were killed by cervical dislocation, and after the tumor was removed, the tumor mass of each group of mice was weighed and photographed to record the shape and size.

[0055] 2. Experimental results

[0056] like Figure 3 As shown, compared with the tumors in the WT group of mice, the tumor growth in the PRDX1-KD group of mice was significantly inhibited, while PRDX1-OV could promote tumor growth.

[0057] Example 4: Preparation of the macrolide compound pochonin D

[0058] Ilyonectria sp. FL-710 was cultured in PDA medium at 28°C until the mycelium completely covered the culture dish. The mycelium was then chopped and transferred to 45 1L conical flasks filled with rice medium (each flask contained 180g of rice and 220mL of tap water, and sterilized at 121°C for 30min) under a sterile environment. Static fermentation was carried out for 35 days under the same temperature conditions.

[0059] The rice fermentation product of strain Ilyonectria sp.FL-710 was extracted with ethyl acetate three times (15L×3 times), and the extract was concentrated under reduced pressure to obtain a total extract. It was then chromatographed on a silica gel column and gradient eluted with petroleum ether / acetone in different ratios (1:0, 20:1, 2:1, 1:1) to obtain four fractions (Fr.1 to Fr.4). Fr.2 was chromatographed on an RP-18 silica gel column and gradient eluted with methanol / water (10% to 90%) to obtain five fractions (Fr.2-1 to Fr.2-5). Fr.2-3 was chromatographed on a Sephadex LH-20 column and isocratically eluted with chloroform / methanol (1:1) to obtain six fractions (Fr.2-3-1 to Fr.2-3-6). Fr.2-3-2 was purified by YMC-Pack ODS-AC 18 The compound pochonin D was separated by semi-preparative high performance liquid chromatography (HPLC).

[0060] Example 5: Evaluation of the effect of macrolide compounds on the proliferation of breast cancer cells MDA-MB-231 and 4T1 using sulforhodamine B (SRB) colorimetry

[0061] 1. Experimental Principle

[0062] Sulforhodamine B dye can specifically bind to the basic amino acid residues of intracellular proteins under slightly acidic conditions to form a complex and produce an absorption peak at a wavelength of 540nm. The measured absorbance value is linearly positively correlated with the number of cells. Therefore, this method can be used to determine the survival rate of living cells to reflect the toxicity of drugs to cells.

[0063] 2. Experimental methods

[0064] MDA-MB-231 and 4T1 cells with appropriate density and good growth status were digested and resuspended, and inoculated into 96-well plates. When the cells in the wells were attached to the wall and the density was about 50%, the prepared pochonin D was added to each well for 24 hours. The final concentrations of the drugs were 20μM, 10μM, 5μM, 2.5μM, and 1.25μM, respectively, and three parallel wells were set for the blank group and each drug group. After the intervention end point, 25μL of 50% acetic acid was added to each well and fixed at room temperature for 1h, and then the liquid in the well was discarded and slowly rinsed under water and inverted at room temperature to dry. 100μL of 0.4% SRB dye solution was added to each well and stained at room temperature for 30min. After the dye solution was discarded, it was washed three times with 1% acetic acid solution. After the oven was dried, 100μL of 10mM Tris was added and shaken for more than 5min, and the absorbance value was detected at a wavelength of 540nm to calculate the IC of the drug. 50 value.

[0065] 3. Experimental results

[0066] like Figure 5 As shown, macrolide compounds intervention for 24 hours can inhibit the proliferation of breast cancer cells MDA-MB-231 and 4T1 in a dose-dependent manner.

[0067] Example 6: Effects of the macrolide compound pochonin D on PRDX1 protein expression and activity and binding ability experiments

[0068] 1. Experimental methods and principles

[0069] (1) Western blotting experiment: MDA-MB-231 and 4T1 cells with appropriate density and good growth status were digested, centrifuged, resuspended, and inoculated in 6-well plates. After 24 hours of attachment, DMSO control group and drug treatment group were set up, and the final concentration of pochonin D drug was prepared to be 1.25, 2.5, 5, 10, and 20 μM. After 24 hours of drug administration, the cells were collected for western blotting experiments. In addition, the same drug concentration (5 μM) was used for drug administration, and cell lysate proteins were collected after 0 hours, 3 hours, 6 hours, 12 hours, 24 hours, and 36 hours of intervention for western blotting experiments.

[0070] (2) The ELISA sandwich method was used to evaluate the PRDX1 protein level in the lysate of breast cancer cell MDA-MB-231. The culture medium was discarded and the cells were scraped off and resuspended in PBS. The collected cells were repeatedly frozen and thawed three times under liquid nitrogen-room temperature conditions, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected. The Human PRDX1 ELISAKIT (Shanghai Hengyuan Biotechnology Co., Ltd., catalog number: H2403J02) was used for enzyme activity determination according to its instructions.

[0071] (3) Cellular thermal shift (CETSA) experiment: The principle is that when a drug molecule interacts with its target protein, the thermal stability of the protein will change. Therefore, it can be detected by western blotting or other methods that the protein will degrade as the temperature rises. However, at the same temperature, the protein bound to the drug molecule will have a relatively reduced degradation amount due to the improved thermal stability, and the melting curve of the protein will also shift to the right. This method can be used to evaluate the binding efficiency of the drug molecule and its target protein in the cell.

[0072] The specific experimental method is to inoculate MDA-MB-231 and 4T1 cells with good growth status at an appropriate density in a 6 cm dish, set up a DMSO control group and a pochonin D (10 μM) group, and after the drug intervention for 24 hours, the cells are digested with trypsin and collected by centrifugation, and washed three times with pre-cooled PBS. After that, they are resuspended and mixed evenly with PBS containing 1% phosphatase inhibitors and protease inhibitors, and each group is divided into 6 equal parts, respectively, heated at 50, 55, 60, 65, 70, and 75 ° C for 3 minutes, and then stand at room temperature for 3 minutes. The liquid nitrogen-37 ° C water bath freezing method is used to freeze and thaw three times to lyse the cells, and then centrifuged at 12000 rpm for 15 minutes at 4 ° C, the supernatant is taken and added to 5× SDS-PAGE loading buffer, and heated at 100 ° C for 10 minutes in a constant temperature metal bath to prepare protein samples for western blotting analysis.

[0073] (4) Drug Affinity Reaction Targeted Stability (DARTS) experiment: The principle is that when a protein interacts with its ligand drug molecule to form hydrogen bonds, hydrophobic bonds or electrostatic forces, the free energy changes and the protein conformation tends to form a state that is more thermodynamically stable and conducive to ligand binding. At this time, the enzymatic stability of the protein is greatly improved and it is not easily hydrolyzed by a broad spectrum of proteases. Subsequently, detection methods such as western blotting or mass spectrometry can be used to verify the binding of the drug molecule to the target protein in the cell.

[0074] The experimental method is to select MDA-MB-231 and 4T1 cells with good growth status, digest them and centrifuge them, wash them with pre-cooled PBS three times, discard the supernatant, add Lysis lysis solution mixed with 1% phosphatase inhibitor and protease inhibitor, lyse them on ice for 15 minutes, centrifuge them at 12000rpm for 15 minutes at 4℃, and take the supernatant. The supernatant was set as 6 groups, including the control group with DMSO alone, the group with Pronase and DMSO, and the group with Pronase and pochonin D (1, 5, 10, 20μM). First, different concentrations of pochonin D and DMSO were given and rotated and incubated overnight at 4℃, and then Pronase protease solution was added according to the group setting (protease solution concentration: sample protein concentration = 1:5000), hydrolyzed at 37℃ for 20 minutes, and then 5×SDS-PAGE loading buffer was immediately added, and the protein samples were heated at 100℃ in a constant temperature metal bath for 10 minutes to prepare protein samples for western blotting analysis.

[0075] (5) Isothermal titration calorimetry (ITC): The principle is that when a compound binds to its target protein, the heat will change accordingly. Based on this, the compound can be used as a ligand and an isothermal titration calorimeter (PEAQ-ITC) can be used to rotate and titrate the protein sample during a constant temperature process. The energy generated by the temperature change in the sample pool and the reference pool can be sensitively measured, and the binding force between the compound and its target protein can be calculated.

[0076] The experimental method is to perform a water drop experiment on the PEAQ-ITC instrument after cell and syringe cleaning, confirm that the baseline is smooth, the peak value is less than 0.04ucal / s, and the interval between peaks is uniform before titrating the PRDX1 protein sample with pochonin D ligand. The specific experimental parameters are set as follows: experimental temperature is 25°C, rotation speed: 750rpm, feedback mode: high, titration drops: 19 drops, fixed volume: 2μL, titration duration: 0.5μL / s, titration interval: 150s, and small molecules are dripped into the sample pool according to the set program. The raw data of the experiment was analyzed using MicroCal PEAQ-ITCAnalysis Sofware.

[0077] (6) Microscale thermophoresis (MST): This method is used to detect interactions between biomolecules. The characteristic of biomolecules that they can move in a directional manner in a microscopic temperature gradient is used to detect and quantify their directional movement in the microscopic temperature gradient field formed by infrared laser irradiation. When the drug molecule, i.e., the ligand, binds to the protein, it will affect the fluorescent group and produce a change in fluorescence intensity. Therefore, the binding constant K can be calculated based on the rate of change of the detection signal after different concentrations of ligand bind to the fluorescent protein. D The value of fitting.

[0078] The experimental method is to fluorescently label the PRDX1 protein with a His tag with the RED-tris-NTA dye in the His-Tag-LabelingKitRED-tris-NTA kit (Cat. No.: LO18) at room temperature for 30 minutes in the dark according to the instructions. The sample was then centrifuged at 4°C, 15000rpm for 10 minutes and the supernatant was taken. Prepare 16 PCR tubes and mark them as 1 to 16. Add 20μL of pochonin D drug to tube 1 and 10μL of PBS-T to the other 15 tubes. Take 10μL of pochonin D from tube 1 and add it to tube 2 and mix it evenly. Then, perform a 2-fold gradient dilution tube by tube in this way, and discard 10μL from tube 16. Add 10μL of the labeled protein to each of the 16 PCR tubes and mix them thoroughly. Use a capillary to absorb the sample and then test it on the machine. Set the instrument to 25°C, 100% LED / excitation power and medium MSTpower on the MO.Control2 software and run according to the set program. The experimental data obtained were then analyzed using MO.AfnityAnalysis Software.

[0079] 2. Experimental results

[0080] like Figure 6 As shown in the figure, western blotting experiments proved that pochonin D could inhibit the expression of PRDX1 protein in 4T1 and MDA-MB-231 breast cancer cells in a concentration-dependent and time-dependent manner. ELISA experiments showed that pochonin D could inhibit the activity of PRDX1 protein, and its half inhibitory concentration (IC 50 The CETSA experiment showed that compared with the DMSO group, the degree of degradation of PRDX1 protein after administration was significantly reduced with the increase of temperature, indicating that there was an interaction between pochonin D and PRDX1 protein, thereby enhancing its thermal stability. The DARTS experiment showed that pronase could significantly hydrolyze PRDX1 under the condition of 37°C water bath for 20 minutes. However, after overnight incubation of pochonin D with PRDX1 at different concentrations, the degree of hydrolysis was significantly reduced and showed obvious concentration dependence. The above experimental results show that pochonin D can interact with PRDX1 to improve its resistance to protease degradation. The ITC experiment showed that pochonin D can stably bind to PRDX1 protein in vitro, and its binding affinity constant is 0.675μM. The MST experiment also showed that the two have good binding, and the binding affinity constant is calculated to be 0.77±0.62μM.

[0081] The above combined results strongly prove that PRDX1 protein is a good target for pochonin D molecule.

[0082] Example 7: Effects of pochonin D on the toxicity of two breast cancer cells (MDA-MB-231 and 4T1) after PRDX1 knockdown and overexpression.

[0083] 1. Experimental methods

[0084] After the above-mentioned PRDX1 knockdown and overexpression operations were performed on two breast cancer cells, MDA-MB-231 and 4T1, they were digested and centrifuged with trypsin, and then inoculated in 96-well plates at appropriate densities. After the cells adhered to the wall and grew to a density of about 50%, a DMSO blank control group and a drug-treated group were set up, and different concentrations of pochonin D were configured to make the final concentrations of 20, 10, 5, 2.5, 1.25, and 0.625 μM, respectively. Three parallel wells were set up for each group. After the intervention endpoint of 24 hours of drug action, SRB colorimetry was performed, and the absorbance value was detected at 540 nm and the cell survival rate was calculated.

[0085] 2. Experimental results

[0086] like Figure 7 As shown, pochonin D significantly reduced the cytotoxicity of two breast cancer cell lines, MDA-MB-231 and 4T1, in which PRDX1 expression was knocked down, while it showed stronger cytotoxicity to cells overexpressing PRDX1. This finding further confirmed that pochonin D can effectively inhibit the proliferation of two breast cancer cell lines, MDA-MB-231 and 4T1, by inhibiting PRDX1.

[0087] Example 8: Effects of pochonin D on normal 4T1 subcutaneous transplanted tumors in mice and on tumor growth after knockdown and overexpression of PRDX1.

[0088] 1. Experimental methods

[0089] After the above-mentioned PRDX1 knockdown and overexpression operations, breast cancer 4T1 cells were digested with trypsin, centrifuged, and resuspended in sterile PBS to adjust the cell density to 2×10 5 / 100μL, placed on ice for later use. The experiment used 6-week-old BALB / c female mice, which were divided into four groups, namely PRDX1-KD group, PRDX1-KD+PoD (40mg / kg) treatment group, PRDX1-OV group and PRDX1-OV+PoD (20mg / kg) treatment group, with 7 mice in each group. After depilating the right armpit of the mice, each mouse in the corresponding group was subcutaneously injected with 100μL of cells treated with corresponding PRDX1 overexpression or knockdown. The long and short diameters of the tumor were measured every two days, and the tumor volume was calculated and recorded. The drug was administered intraperitoneally once every 2 days for 2 consecutive weeks. All mice were killed by dislocation of the neck at the end of the experiment. After the tumor was removed, the mouse tumor mass was weighed and photographed to record the morphology.

[0090] 2. Experimental results

[0091] like Figure 8 As shown in the figure, when pochonin D was used at a dose of 20 mg / kg to treat 4T1 xenograft tumor mice overexpressing PRDX1, a significant inhibitory effect on tumor growth was observed. For 4T1 xenograft tumor mice with knocked-down PRDX1 expression, the drug dose was increased to 40 mg / kg, and the tumor volume was still no significantly different from that of mice without drug treatment. This result further confirmed that pochonin D inhibited the growth of mouse tumors in vivo by targeting PRDX1.

Claims

1. Use of a natural inhibitor with PRDX1 as a drug target in the preparation of a drug for treating breast cancer, wherein the natural inhibitor is a macrolide compound pochonin D, 2. The use according to claim 1, characterized in that: The medicine is a medicine for treating triple-negative breast cancer.

3. The use according to claim 1, characterized in that: The medicine is a medicine for inhibiting the proliferation of breast cancer cells.

4. The use according to claim 3, characterized in that: The drug inhibits the proliferation of breast cancer cells in a dose-dependent manner.

5. The use according to claim 1, characterized in that: The drug is a drug that downregulates PRDX1 expression.

6. The use according to claim 1, characterized in that: The drug is a drug that targets and inhibits PRDX1 protein.

7. The use according to claim 6, characterized in that: The drug inhibits the expression of PRDX1 protein in a dose- and time-dependent manner.

8. The use according to claim 6, characterized in that: The drug can enhance the resistance of PRDX1 protein to protease degradation.

9. The use according to claim 8, characterized in that: The drug enhances the resistance of PRDX1 protein to protease degradation in a dose-dependent manner.

10. The use according to claim 1, characterized in that: The preparation method of the macrolide compound pochonin D comprises the following steps: (1) fermenting the endophytic fungus Ilyonectria sp. FL-710 from Aster plant in a rice solid culture medium and extracting with ethyl acetate to obtain an extract; (2) separating and purifying the extract obtained in step (1) to obtain the macrolide compound pochonin D.

Images