Use of a PDGFRA inhibitor in the manufacture of a medicament for treating astrocytic tumors

Abstract

The present application relates to the use of PDGFRA inhibitors in the preparation of a medicament for treating astrocytic tumors. The present application first discovers and proves by experiments that PDGFRA inhibitors can significantly inhibit the excessive proliferation of astrocytic tumor cells, but do not affect the proliferation of normal cells of the same type, thereby can alleviate, improve or treat astrocytic tumors, or delay the progression of astrocytic tumors, and thus are expected to become a candidate therapeutic drug for astrocytic tumors, and have a great clinical application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to use of a PDGFRA inhibitor in preparing a medicine for treating astroblastoma. Background Art

[0002] Astroblastoma (ABM) is an understudied central nervous system tumor that primarily affects children and young adults. Its cellular origin and pathogenesis remain unclear. Currently, treatment options for astroblastoma mainly include surgical resection, radiotherapy, and chemotherapy, but due to its highly invasive nature and resistance to traditional treatments, the prognosis for patients remains poor.

[0003] Platelet-derived growth factor receptor alpha (PDGFRA) is a receptor tyrosine kinase that belongs to the platelet-derived growth factor (PDGF) receptor family. PDGFRA is expressed in a variety of cell types, particularly in vascular smooth muscle cells, glial cells, and certain stem cells. This receptor plays an important role in normal physiological processes, such as cell proliferation, differentiation, and migration, particularly in angiogenesis and tissue repair. Activation of PDGFRA is typically achieved through binding to its ligand, PDGF. This binding leads to dimerization and autophosphorylation of PDGFRA, which in turn activates downstream signaling pathways, such as the RAS / RAF / MEK / ERK and PI3K / AKT signaling pathways, which are critical for cell survival, proliferation, and metabolism.

[0004] Under pathological conditions, abnormal activation of PDGFRA, including gene mutation, amplification or overexpression, is associated with the occurrence and development of a variety of human diseases. For example, in gastrointestinal stromal tumors (GISTs), mutations in PDGFRA are key factors driving tumor growth. In addition, abnormal activation of PDGFRA also plays a role in certain chronic inflammatory and fibrotic diseases. In the field of neuroscience, research on PDGFRA mainly focuses on its role in the development and functional maintenance of the nervous system. PDGFRA signaling is essential for the proliferation and differentiation of neural progenitor cells, and in the mature nervous system, PDGFRA is involved in neuroprotection and repair processes.

[0005] Although the role of PDGFRA in various diseases has been widely studied, to date, there have been no reports on the use of PDGFRA inhibitors in the treatment of nervous system tumors. Summary of the Invention

[0006] Purpose of the Invention

[0007] In response to the problems or needs in the prior art, the present invention aims to provide a method for preparing a medicament for treating astroblastoma by using a PDGFRA inhibitor.

[0008] Specifically, the technical solutions of the present invention are as follows:

[0009] In a first aspect, the present invention provides use of a PDGFRA inhibitor in the preparation of a medicament for treating astroblastoma.

[0010] In a feasible embodiment, the PDGFRA inhibitor is a small molecule inhibitor targeting PDGFRA;

[0011] Further feasible, the PDGFRA inhibitor is selected from Crenolanib, CP-673451, and derivatives thereof.

[0012] Crenolanib (also known as CP-868596 or ARO 002), with a chemical formula of C26H29N5O2 and a molecular weight of 443.54, is a selective tyrosine kinase inhibitor that exerts its pharmacological effects by inhibiting the activity of tyrosine kinase. Crenolanib has high selectivity for inhibiting PDGFRα and PDGFRβ, with Kd values ​​of 2.1nM and 3.2nM in CHO cells, respectively.

[0013] CP-673451 is also a highly selective PDGFR inhibitor, mainly used to inhibit the activity of platelet-derived growth factor receptors (PDGFR-α and PDGFR-β); in cell-free experiments, the IC50 values ​​of this inhibitor for inhibiting PDGFR-α and PDGFR-β were 10nM and 1nM, respectively, which is more than 450 times higher than the selectivity for other angiogenic receptors.

[0014] The inventors of the present application found that the PDGFRA inhibitors Crenolanib or CP-673451 can significantly inhibit the proliferation of astroblastoma cell models stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5, while having no effect on normal cells of the same type.

[0015] Therefore, in a feasible embodiment of the above use, the astroblastoma is an astroblastoma with MN1, BEND2, or CXXC5 gene mutations, preferably an astroblastoma with MN1:BEND2 or MN1:CXXC5 gene fusion.

[0016] Preferably, the treatment of astroblastoma is achieved by specifically inhibiting the hyperproliferation of astroblastoma cells.

[0017] Preferably, the treatment of astroblastoma comprises one or more of the following:

[0018] (1) Delaying the progression of astroblastoma;

[0019] (2) Relieve or improve the symptoms of astroblastoma.

[0020] Optionally, in the drug for treating astroblastoma, the PDGFRA inhibitor is the sole active ingredient or one of the active ingredients.

[0021] In a second aspect, the present invention provides a method for treating astroblastoma, comprising: administering a therapeutically effective amount of a PDGFRA inhibitor to a subject in need thereof.

[0022] The term "effective amount" refers to the amount or dosage of an active ingredient that, upon single or multiple administrations to a patient, provides the desired effect on the patient being treated. The effective amount can be determined by the attending diagnostician, as a skilled practitioner, using known techniques and observations made under similar circumstances. In determining the effective amount or dosage of the active ingredient to be administered, the attending diagnostician should consider a variety of factors, including, but not limited to: the species of the mammal; the size, age, and general health; the specific disease involved; the degree of involvement or severity of the disease; the response of the individual patient; the specific compound being administered; the mode of administration; the bioavailability properties of the administered formulation; the selected dosing regimen; the use of concomitant medications; and other relevant circumstances.

[0023] For the above method, preferably, the PDGFRA inhibitor is a small molecule inhibitor targeting PDGFRA;

[0024] Further preferably, the PDGFRA inhibitor is selected from Crenolanib, CP-673451, and derivatives thereof.

[0025] In a feasible embodiment of the above method, the astroblastoma is an astroblastoma with MN1, BEND2, or CXXC5 gene mutations, preferably an astroblastoma with MN1:BEND2 or MN1:CXXC5 gene fusion.

[0026] Preferably, the treatment of astroblastoma is achieved by specifically inhibiting the hyperproliferation of astroblastoma cells.

[0027] Preferably, the treatment of astroblastoma comprises one or more of the following:

[0028] (1) Delaying the progression of astroblastoma;

[0029] (2) Relieve or improve the symptoms of astroblastoma.

[0030] Optionally, the PDGFRA inhibitor is the sole active ingredient, or one of the active ingredients, in the treatment.

[0031] Beneficial effects

[0032] The present invention provides the use of a PDGFRA inhibitor (specifically, Crenolanib or CP-673451, or derivatives thereof) in the preparation of a medicament for treating astroblastoma. The inventors have experimentally confirmed that the small molecule PDGFRA inhibitor Crenolanib or CP-673451 can significantly inhibit the excessive proliferation of astroblastoma cell models (in which the fusion gene MN1:BEND2 or MN1:CXXC5 is stably expressed) without affecting the proliferation of normal cells of the same type. This can alleviate, improve, or treat astroblastoma, or delay the progression of astroblastoma. Therefore, these drugs can be used as potential therapeutic drugs for astroblastoma and have great clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] One or more embodiments are exemplarily illustrated by the accompanying figures, and these exemplary illustrations do not limit the embodiments. The word "exemplary" is used herein to mean "serving as an example, example, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0034] Figure 1 This is the plasmid map of PB-TRE3G-P2A-mNeonGreen.

[0035] Figure 2 Schematic diagram of the MN1:BEND2 knock-in hESC strategy; "1" shows the expression cassette of the PiggyBac transposon plasmid containing the MN1:BEND2 fusion gene, "2" shows the expression cassette of the TET-On regulatory element plasmid, and "3" shows the expression cassette of the transposase plasmid.

[0036] Figure 3 This is the plasmid map of the TET-On regulatory element plasmid PB-EF1a-TET3G.

[0037] Figure 4 This is the plasmid map of the transposase plasmid pCAG-CMV-PBase.

[0038] Figure 5 This is the result of immunofluorescence detection of the expression of fusion proteins HA-MN1:BEND2 and HA-MN1:CXXC5 in hESC.

[0039] Figure 6This is the result of Western Blot detection of the expression of fusion proteins HA-MN1:BEND2 and HA-MN1:CXXC5 in iNPC.

[0040] Figure 7 This is the result of immunofluorescence detection of the expression of NPC protein markers Nestin, SOX2, and SOX1 in iNPC.

[0041] Figure 8 Changes in the transcriptional levels of ABM marker genes in iNPCs stably expressing MN1 fusion mutations MN1:BEND2 and MN1:CXXC5.

[0042] Figure 9 The cell proliferation levels of iNPCs cells introduced with the fusion gene MN1:BEND2 (Figure a) or MN1:CXXC5 (Figure b) were compared with those of the control group.

[0043] Figure 10 The figure shows the tracing results of iNPCs cells introduced with the fusion gene MN1:BEND2 (Figure a) or MN1:CXXC5 (Figure b) after being transplanted into the mouse cerebral cortex; among them, the green mark shows the mNeonGreen fluorescence signal, which indicates the survival of iNPCs cells in the brain after transplantation; the blue mark shows the fluorescence signal of HA antibody, which indicates the expression of the fusion protein MN1:BEND2 or MN1:CXXC5 in iNPC cells; the red mark shows the fluorescence signal of KI67 protein, which indicates the expression of the cell proliferation marker Ki67; the gray mark shows the staining result of DAPI staining of cell nuclei.

[0044] Figure 11 Shown are the changes in PDGFRA gene expression levels in iNPCs cells stably expressing the fusion genes MN1:BEND2 or MN1:CXXC5 compared with control iNPCs cells.

[0045] Figure 12 Shown are the changes in the proliferation capacity of ABM model cells treated with Crenolanib (Panel A) or CP-673451 (Panel B) compared with control iNPCs cells. DETAILED DESCRIPTION

[0046] Unless expressly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising", etc., will be understood to include the stated elements or components but not to exclude other elements or other components.

[0047] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0048] In order to make it easier to understand the present invention, some technical terms are specifically defined as follows. Unless otherwise clearly defined in other parts of this document, the technical terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs.

[0049] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit of 5% less than the specified numerical value and an upper limit of 5% greater than the specified numerical value, including but not limited to ±5%, ±2%, ±1%, and ±0.1%, as such variations are appropriate for performing the disclosed methods.

[0050] The term "and / or" should be understood to mean any one of the alternatives or a combination of any two or more of the alternatives.

[0051] As used herein, the term "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, i.e., including at least one of the numbers or elements in the list, but also including more than one, and optionally, additional unlisted items. Only when explicitly stated to the contrary, such as "only one" or "exactly one" or when used in a claim, "consisting of..." will refer to only one of the listed numbers or one of the elements of the list.

[0052] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form.

[0053] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0054] In the following examples, we first constructed iNPCs stably expressing the MN1:BEND2 or MN1:CXXC5 fusion gene and verified their feasibility as ABM cell models. We then explored the expression of PDGFRA in the ABM cell models (compared to control cells). Finally, we verified the therapeutic effect of PDGFRA inhibitors on ABM diseases in the ABM cell models.

[0055] Example 1: Obtaining human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0056] 1. Construction of plasmids for co-transfection

[0057] (1) Construction of PiggyBac transposon plasmids containing the fusion gene MN1:BEND2 or MN1:CXXC5

[0058] Materials and reagents: human BEND2 cDNA (synthesized by Shanghai Bioengineering Co., Ltd.), human MN1 and CXXC5 cDNA (generated from Hela cell cDNA by PCR), Phanta Max Master Mix (Vazyme, P515-01), Gel Extraction Kit (OMEGA, D2500-02), ClonExpress Ultra One Step Cloning Kit (Vazyme, C115), PB-TRE3G-P2A-mNeonGreen vector (generated by inserting TRE3G sequence and P2A mNeonGreen sequence into the basic vector PB, the specific map is shown in Figure 2). Figure 1 as shown), 5α competent cells.

[0059] The plasmid construction method is as follows:

[0060] By PCR technology, a gene fragment of the fusion gene MN1:BEND2 with a 3xHA tag at the 5' end (the fusion gene MN1:BEND2 contains exon 1 of the MN1 gene and exons 7-14 of the BEND2 gene, and its sequence is shown in the following SEQ ID NO: 1) was amplified, and purified and recovered by agarose gel electrophoresis; the above two fragments were cloned into the PB-TRE3G-P2A-mNeonGreen vector using homologous recombination technology to obtain

[0061] PB-TRE3G-3xHA-MN1:BEND2-P2A-mNeonGreen recombinant expression plasmid. Figure 2 The structure of the expression cassette in the recombinant expression plasmid is shown.

[0062]

[0063]

[0064]

[0065]

[0066] In the above SEQ ID NO: 1, the underlined portion is the coding nucleotides for exon 1 of MN1, and the bolded portion is the coding nucleotides for exons 7-14 of BEND2.

[0067] In a similar manner, a PB-TRE3G-3xHA-MN1:CXXC5-P2A-mNeonGreen recombinant expression plasmid was constructed (wherein the gene sequence of MN1:CXXC5 is shown in the following SEQ ID NO: 2).

[0068]

[0069]

[0070]

[0071] In the above SEQ ID NO: 2, the underlined portion is the coding nucleotides of exon 1 of MN1, and the bolded portion is the coding nucleotides of part of exon 3 and part of exon 4 of CXXC5.

[0072] In addition, a PiggyBac transposon plasmid containing only mNeonGreen, MN1 exon 1, and BEND2 exons 7-14 was constructed in a similar manner as a control plasmid, which is abbreviated as eGFPCtrl or Ctrl, MN1 e1, and BEND2 e7-14, respectively, below and in the figures.

[0073] (2) Construction of TET-On regulatory element plasmid and transposase plasmid

[0074] Furthermore, a TET-On regulatory element plasmid PB-EF1a-TET3G regulatory plasmid was constructed (wherein the nucleotide sequence of TET3G is shown in SEQ ID NO: 3, and the plasmid map is shown in Figure 3 shown) and transposase plasmids

[0075] pCAG-CMV-PBase (wherein the nucleotide sequence of PBase is shown in SEQ ID NO: 4, and the plasmid map is shown in Figure 4 shown).

[0076] SEQ ID NO:3 is as follows:

[0077] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAA

[0078] TGGAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGT

[0079] TGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCC

[0080] CTGCCAATCGAGATGCTGGACAGGCATCATACCCACTCCTGCCCCCTGGAAGGCG

[0081] AGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATACCGCTGTGCTCTCCTC

[0082] TCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGT

[0083] ACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGA

[0084] GAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGG

[0085] AGGAACAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATT

[0086] CTATGCCCCCACTTCTGAAACAAGCAATTGAGCTGTTCGACCGGCAGGGAGCCGA

[0087] ACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAA

[0088] AGTGCGAAAGCGGCGGGCCGACCGACGCCCTTGACGATTTTGACTTAGACATGCT

[0089] CCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTG

[0090] ACGATTTTGACCTTGACATGCTCCCCGGGTAA;

[0091] The sequence of SEQ ID NO:4 is as follows:

[0092] ATGGGCTCTAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCG

[0093] ACGACGAACTGGTGGGCGAGGACAGCGACAGCGAGGTCAGCGACCACGTGTCCG

[0094] AGGACGACGTGCAGTCCGACACCGAGGAAGCCTTCATCGACGAGGTGCACGAAG

[0095] TGCAGCCTACCAGCAGCGGCTCCGAGATCCTGGACGAGCAGAACGTGATCGAGC

[0096] AGCCTGGCAGCTCCCTGGCCAGCAACAGAATCCTGACCCTGCCCCAGAGAACCAT

[0097] CAGAGGCAAGAACAAGCACTGCTGGTCCACCTCCAAGAGCACCAGGCGGAGCAG

[0098] AGTGTCCGCCCTGAACATCGTGCGGAGCCAGAGGGGCCCCACCAGAATGTGCAG

[0099] AAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATC

[0100] AGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGAGGCGGGAGAGC

[0101] ATGACCAGCGCCACCTTCAGAGACACCAACGAGGACGAGATCTACGCCTTCTTCG

[0102] GCATCCTGGTGATGACCGCCGTGAGAAAGGACAACCACATGAGCACCGACGACC

[0103] TGTTCGACAGATCCCTGAGCATGGTGTACGTGTCCGTGATGAGCAGAGACAGATT

[0104] CGACTTCCTGATCAGATGCCTGAGAATGGACGACAAGAGCATCAGACCCACCCTG

[0105] CGGGAGAACGACGTGTTCACCCCCGTGCGGAAGATCTGGGACCTGTTCATCCACC

[0106] AGTGCATCCAGAACTACACCCCTGGCGCCCACCTGACCATCGATGAGCAGCTGCT

[0107] GGGCTTCAGAGGCAGATGCCCCTTCAGAGTGTACATCCCCAACAAGCCCAGCAA

[0108] GTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAA

[0109] CGGCATGCCCTACCTGGGCAGAGGCACCCAGACAAACGGCGTGCCCCTGGGCGA

[0110] GTACTACGTGAAAGAACTGAGCAAGCCTGTGCATGGCAGCTGCAGGAACATCAC

[0111] CTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAACCC

[0112] TACAAGCTGACCATCGTGGGCACCGTGCGGAGCAACAAGCGGGAGATCCCAGAG

[0113] GTGCTGAAGAACAGCAGATCCAGACCTGTGGGAACAAGCATGTTCTGCTTCGACG

[0114] GCCCCCTGACCCTGGTGTCCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCT

[0115] GTCCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGAT

[0116] GGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTG

[0117] CAGCGTGATGACCTGCAGCAGAAAGACCAACAGATGGCCCATGGCCCTGCTGTA

[0118] CGGCATGATCAATATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTG

[0119] TCCAGCAAGGGCGAGAAGGTGCAGAGCCGGAAGAAATTCATGCGGAACCTGTAC

[0120] ATGAGCCTGACCTCCAGCTTCATGAGAAAGAGACTGGAAGCCCCCACCCTGAAG

[0121] AGATACCTGCGGGACAACATCAGCAACATCCTGCCCAAGGAAGTGCCAGGAACA

[0122] AGCGACGACAGCACCGAGGAACCCGTGATGAAGAAGAGGACCTACTGCACCTAC

[0123] TGTCCCAGCAAGATCAGAAGAAAGGCCAACGCCAGCTGCAAGAAATGCAAAAAA

[0124] GTGATCTGCCGGGAGCACAACATCGACATGTGCCAGAGCTGTTTCTGA.

[0125] 2. hESC Cell Culture and Transfection

[0126] Materials and reagents: CB0003 hESC cell line, Matrigel (Corning 354277), StemFlex TM Culture medium (Gibco A3349401), ReLeSR TM Agent (STEMCELL Technologies 100-0483).

[0127] The specific steps are as follows:

[0128] In Matrigel-coated culture dishes, using StemFlex TMhESCs were maintained in an undifferentiated state using the culture medium and passaged every 5-7 days using ReLeSR reagent.

[0129] Using Lipofectamine™ Stem Reagent (Invitrogen 2693947), piggyBac transposon plasmids containing mNeonGreen alone, MN1 (exon 1) alone, BEND2 (exon 7-14) alone, or the fusion genes MN1:BEND2 or MN1:CXXC5 were co-transfected with TET-On regulatory element plasmids and transposase plasmids at a 1:1:1 ratio into hESCs. Stable integration clones were then selected using puromycin.

[0130] HA-MN1:BEND2 or HA-MN1:CXXC5 expression in hESCs transfected with the PiggyBac transposon plasmid containing the fusion gene MN1:BEND2 or MN1:CXXC5 was detected by immunofluorescence staining using an HA tag antibody. The specific steps for immunofluorescence staining are as follows:

[0131] 1) Cell Slide Preparation: Plate an appropriate number of cells onto a cell slide. For human iNPCs, pre-coat the slide with Matrigel for 30-60 minutes before seeding. After the cells have grown to an appropriate density, remove the culture medium and wash three times with PBS.

[0132] 2) Cell fixation: After washing the cell slides with PBS, the cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes.

[0133] 3) Blocking: Use a blocking solution containing 1% FBS and 0.5% Triton X-100 for 30-60 minutes at room temperature. This step not only reduces non-specific binding of the primary antibody, but also punctures the cell nucleus to allow the antibody to better enter the cell nucleus.

[0134] 4) Primary antibody incubation: Dilute HA-Tag (C29F4) Rabbit mAb (CST) in blocking buffer (1:200), mix well, overlay on the cell slide, and incubate at 4°C overnight.

[0135] 5) Secondary Antibody Incubation: After recovering the primary antibody, wash the slides three times with PBS (10 min each wash). Use Donkey anti-Rabbit IgG-Alexa Fluor 488 (ThermoFisher) as the secondary antibody at a 1:500 dilution. Incubate at room temperature in the dark for 1 hour.

[0136] 6) Washing: Remove the secondary antibody and wash the slides three times with PBS, 10 min each time, protecting from light.

[0137] 7) DAPI staining: After washing with PBS, dilute DAPI according to a certain ratio and add it to the cell slide. Incubate at room temperature for 10 minutes, and then wash three times with PBS, each time for 10 minutes. Be careful to avoid light.

[0138] 8) Mounting: Place approximately 5 μl of mounting medium onto a glass slide, taking care to avoid bubbles. Remove any PBS from the surface of the slide with lens tissue, then cover the slide with the cells. Store briefly in a -4°C freezer or store in a -20°C freezer.

[0139] 9) Photography: A Leica TCS-SP8 STED 3x laser confocal microscope was used on the focusing room platform of the Institute of Basic Research.

[0140] Among them, the immunofluorescence detection results of HA-MN1:BEND or HA-MN1:CXXC5 are as follows Figure 5 As shown, Figure 5 In the figure, blue fluorescence shows the DAPI staining result, which is used to mark the cell nucleus; green fluorescence shows the HA staining result, which indicates the expression of the fusion protein HA-MN1:BEND or HA-MN1:CXXC5.

[0141] Depend on Figure 5 It can be seen that the signal of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein is strong and overlaps with the DAPI signal, indicating the successful expression of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein in hESC and its localization in the cell nucleus. This result confirms the effectiveness of this expression system, that is, the stable expression of HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein in hESC is achieved.

[0142] 3. iNPC differentiation and culture

[0143] Materials and reagents: Matrigel (Corning 354277), STEMdiff TM Neural Induction Medium+

[0144] SMADi (STEMCELL Technologies 05835), Gentle Cell Dissociation Reagent (STEMCELL Technologies 100-0485), Y-27632 (MCE HY-10071), Accutase dissociation medium (STEMCELL Technologies 07920), sox2 (abcam lot:1007374-3), nestin(abcam), sox1(abcam,lot:1018056-6), HA(C29F4)(CST,lot:3724), STEMdiff TM Neural ProgenitorMedium(STEMCELL Technologies 05833)

[0145] (1) iNPC induction:

[0146] ① Pretreat the culture plate with Matrigel.

[0147] ② Prepare STEMdiff containing apoptosis inhibitor Y-27632 (to increase cell survival rate) TM Neural Induction Medium + SMADi was used as the induction medium.

[0148] ③Use Gentle Cell Dissociation Reagent to disperse hESCs, count and adjust the cell density.

[0149] ④ hESC cells stably transfected with HA-MN1:BEND2 or HA-MN1:CXXC5 fusion protein expression plasmids or control plasmids eGFPCtrl, MN1 e1, BEND2 e7-14 were seeded in the above-mentioned induction medium. The preheated induction medium was replaced daily until day 6 (or day 9). The cells were digested using Accutase dissociation medium for passage.

[0150] ⑤ According to the above culture conditions and passaging method, three passages were performed and the induction culture was carried out for a total of 18-21 days to obtain iNPC cells; among them, iNPC cells induced by hESCs stably transfected with the fusion protein HA-MN1:BEND2 or HA-MN1:CXXC5 may be referred to as KI iNPC (i.e., Knockin iNPC) below and in the accompanying drawings, and iNPC cells induced by hESCs stably transfected with the control plasmid eGFPCtrl may be referred to as Ctrl iNPC below and in the accompanying drawings.

[0151] (2) iNPC identification:

[0152] The expression and molecular weight of the fusion protein were verified by Western Blot using HA antibody. Figure 6 As shown. Figure 6 It can be seen that iNPC cells induced by hESCs expressing the fusion proteins HA-MN1:BEND2 or HA-MN1:CXXC5 successfully expressed the MN1:BEND2 or MN1:CXXC5 fusion proteins, respectively.

[0153] Immunofluorescence was used to identify the expression of protein markers such as Sox2, Nestin, and Sox1 in iNPC cells. The results showed that the iNPC cells induced by the above steps clearly expressed typical NPC markers Sox2, Nestin, and Sox1, indicating that iNPCs differentiated from hESCs possessed the molecular characteristics of neural progenitor cells, proving the success of the differentiation process.

[0154] As representative results, Figure 7 The immunofluorescence detection results of iNPC cells induced by hESCs expressing the fusion protein HA-MN1:BEND2 or HA-MN1:CXXC5 are shown. Figure 7 In the figure, blue fluorescence shows the DAPI staining result, which is used to mark the cell nucleus; green fluorescence shows the staining result of Nestin, Sox2, Sox1 and other proteins. Figure 7 It can be seen that iNPC cells induced by hESCs expressing the fusion protein HA-MN1:BEND2 or HA-MN1:CXXC5 all expressed typical NPC markers Sox2, Nestin and Sox1 at high levels, indicating that these iNPC cells have the molecular characteristics of neural precursor cells, proving the success of the differentiation process.

[0155] (3) iNPC cultivation:

[0156] iNPC cells were cultured in STEMdiff TMThe cells were cultured in Neural Progenitor Medium (STEMCELL Technologies 05833) and passaged every 3 days using Accutase dissociation medium to digest the cells.

[0157] Example 2: Identification of ABM disease molecular phenotype and cell proliferation capacity of human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0158] (1) Verification of the expression of ABM signature genes in iNPC obtained in Example 1 by RNA-seq

[0159] The iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were cultured in a STEMdiff TM After culturing in Neural Progenitor Medium for 48 hours, cells were harvested and RNA was extracted using the TRIZOL method. Total RNA integrity was assessed using a Bioanalyzer 2100 or 2200 (Agilent). Subsequently, libraries were constructed using the VAHTS Universal V6 RNA-seq Library Preparation Kit (Vazyme) and sequenced on the Illumina Novoseq platform using 150 bp paired-end sequencing mode.

[0160] The RNA-Seq data processing pipeline is as follows: First, RNA-Seq reads from transgenic human iNPCs were aligned to the human reference genome GRCh38 using Hisat2. Next, data conversion and sorting were performed using Samtools. The transcript counts per million (TPM) expression of each gene was calculated using featureCounts. When performing differential expression analysis using the EdgeR package, genes with fewer than 10 reads were excluded. Heatmaps were generated using Pheatmap to display changes in gene expression.

[0161] The results are as follows Figure 8 shown. Figure 8 The results showed that compared with iNPCs stably expressing mNeonGreen (i.e., eGFPCtrl in the figure), MN1 exon 1 (i.e., MN1 e1 in the figure), and BEND2 exons 7-14 (i.e., BEND2 e7-14 in the figure), iNPCs stably expressing the fusion genes MN1:BEND2 and MN1:CXXC5 showed significantly upregulated transcript levels of oncogenes associated with ABM disease. This result indicates that iNPC cells overexpressing the fusion genes MN1:BEND2 and MN1:CXXC5 have the molecular phenotype of ABM disease.

[0162] (II) Determination of cell proliferation ability of iNPC obtained in Example 1

[0163] The iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were seeded into 24-well plates at a density of 10^5 cells / well and incubated in a STEMdiff containing 1 μg / ml doxycycline. TM The cells were cultured in Neural Progenitor Medium, and the cell numbers were counted on days 1, 3, and 5, and a growth curve was prepared.

[0164] The results are as follows Figure 9 shown. Figure 9 The results showed that compared with iNPCs stably transfected with mNeonGreen (i.e., Ctrl iNPC in the figure), the proliferation rate of iNPCs stably transfected with the fusion genes MN1:BEND2 and MN1:CXXC5 (i.e., MN1:BEND2 KI iNPC and MN1:CXXC5KI iNPC in the figure) was significantly increased, indicating that the MN1 fusion gene caused abnormal cell proliferation, which is consistent with the proliferation characteristics of ABM.

[0165] Example 3: Transplantation of human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes into mice

[0166] The iNPCs expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were cultured according to the above method. iNPCs were digested, collected and kept on ice. 8-9 day old NSG mice were anesthetized with 2.5% pentobarbital (avertin) and fixed on a stereotaxic apparatus (RWD brand), to which was connected a microliter syringe (Shanghai Gaoge Industry and Trade Co., Ltd., 10 μL specification) and a syringe pump (KD Scientific #788130). The injection needle was inserted into the brain at a 40-degree angle to a depth of 0.8 mm. A total of 200,000 to 400,000 iNPCs expressing the fusion protein MN1:BEND2 or MN1:CXXC5 obtained in Example 1 (i.e., KI iNPCs in the figure) or control iNPCs (i.e., Ctrl iNPCs in the figure, in which a control plasmid containing only mNeonGreen was stably transfected) were suspended in 2 μL of PBS and slowly injected into the cerebral cortex. Starting on the third day after surgery, animals received daily intraperitoneal injections of 50 mg / kg of doxycycline (Beyotime #ST039A). Two weeks after transplantation, the entire brain was excised and fixed, dehydrated, embedded, and frozen. The excised brain tissue was then sliced ​​into 30-μm-thick sections using a freezing microtome. Immunofluorescence staining was then used to examine the transplantation efficacy of iNPCs and their proliferation in the brain following transplantation.

[0167] The specific procedures of immunofluorescence staining are as follows:

[0168] Frozen brain tissue sections were blocked with 5% donkey serum and then stained. The staining process was as follows: primary antibodies HA-rabbit (1:500), mNeonGreen-mouse (1:200), and KI67-rat (1:500) were used for staining overnight at 4°C, followed by washing the primary antibodies and adding secondary antibodies donkey anti rabbit Alexa Fluor 647 (1:500), donkey anti mouse Alexa Fluor 488 (1:500), and donkey anti rat Cyanine cy3 (1:500) for staining at room temperature for 2 hours. After washing the secondary antibodies, the sections were mounted with mounting medium and then scanned using a Leica inverted confocal microscope. The image scanning magnification was 40 times.

[0169] The above procedures were used to detect the intracellular expression of mNeonGreen, the fusion genes MN1:BEND2 or MN1:CXXC5HA, and the KI67 protein. Since all stably transfected plasmids carry the mNeonGreen fluorescent gene, its fluorescent signal (green) will indicate the distribution and survival of iNPCs transplanted with the stably transfected plasmid within the brain. Since the expression plasmids for the fusion proteins MN1:BEND2 or MN1:CXXC5HA contain an HA tag, the expression level of the fusion protein can be indicated by the fluorescent signal of the HA tag antibody (blue). Furthermore, the KI67 protein is a nuclear protein that can be used as a marker to indicate the level of cell proliferation, and its fluorescent signal is red.

[0170] Immunofluorescence staining results Figure 10 shown.

[0171] Figure 10 The study showed that control iNPCs efficiently differentiated into post-proliferative cells after transplantation into the mouse cerebral cortex, as evidenced by their expression of KI67. However, iNPCs overexpressing MN1:BEND2 or MN1:CXXC5 maintained a highly proliferative state, as demonstrated by strong KI67 expression and rosette formation. These observations are consistent with the proliferative properties and histological morphology of MN1 fusion gene-mutant ABM tumors. In other words, iNPCs stably expressing the MN1:BEND2 or MN1:CXXC5 fusion genes can still effectively mimic the characteristics of ABM tumors after transplantation into animal brains.

[0172] The above results all indicate that the iNPCs stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 can be used as a cell model for ABM.

[0173] Example 4: Increased expression of PDGFRA in human induced neural progenitor cells (iNPCs) stably expressing MN1:BEND2 or MN1:CXXC5 fusion genes

[0174] Total RNA was extracted from iNPCs stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5 (experimental group) and iNPCs stably expressing eGFPCtrl, MN1 e1, and BEND2 e7-14 (control group) obtained in Example 1 using RNAiso Plus reagent (Takara 9108). cDNA was synthesized using the Hifair III First Strand cDNA Synthesis Kit (Yeasen 11139ES60) and purified using the Hieff UNICON TMUniversal Blue qPCR Master Mix (Yeasen 11184ES) was used for the experiments on a StepOnePlus Real-Time PCR System (Applied Biosystems), and the experimental procedures followed the manufacturer's instructions.

[0175] The primers for real-time PCR are as follows:

[0176] hPDGFRA forward primer 5'-ACTGTTGGAGCTACAGGGAG-3' (SEQ ID NO: 5),

[0177] hPDGFRA reverse primer 5'-TTAGGCTCAGCCCTGTGAGA-3' (SEQ ID NO: 6), hGAPDH forward primer 5'-AGATCCCTCCAAAATCAAGTGG-3' (SEQ ID NO: 7), hGAPDH reverse primer 5'-GGCAGAGATGATGACCCTTTT-3' (SEQ ID NO: 8).

[0178] The results are as follows Figure 11 shown. Figure 11 The results showed that compared with the control iNPCs, the gene expression level of PDGFRA was significantly increased in iNPCs stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5, with the increase being as high as 300-500 times.

[0179] Example 5: PDGFRA inhibitors can suppress excessive proliferation of ABM cell models

[0180] In this example, iNPCs stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5 obtained in Example 1 were used as ABM cell models to explore the inhibitory effects of two PDGFRA inhibitors, Crenolanib and CP-673451, on one of their ABM phenotypes (hyperproliferative ability).

[0181] Specifically, the iNPC stably expressing the fusion gene MN1:BEND2 or MN1:CXXC5 or the control iNPC stably expressing eGFPCtrl obtained in Example 1 was heated to 10 5 Cells / well were seeded in 24-well plates and the cells were cultured in STEMdiff TM After culturing in Neural Progenitor Medium for 16 hours, the medium was replaced with STEMdiff containing 2 μM Crenolanib (MCE, HY-13223) or CP-673451. TMNeural Progenitor Medium was used, and a DMSO-treated group was set up as a control. The culture medium containing Crenolanib, CP-673451, or DMSO was replaced every 24 hours. The cells were counted after 96 hours of treatment, and the cell count was used to indicate cell proliferation.

[0182] The cell counts of ABM model cells treated with Crenolanib or CP-673451 were as follows Figure 12 As shown in Figures A and B.

[0183] Depend on Figure 12 As shown in Figures A and B, the proliferation ability of ABM model cells was effectively inhibited after treatment with Crenolanib or CP-673451, even reaching a level almost the same as that of control iNPCs; while the proliferation ability of control iNPCs was almost unaffected before and after treatment with Crenolanib or CP-673451.

[0184] The above results indicate that the PDGFRA inhibitors Crenolanib and CP-673451 can completely and effectively inhibit the excessive proliferation of ABM cells. Proliferation is one of the important characteristics of ABM. Therefore, it can be inferred that PDGFRA inhibitors can effectively inhibit the excessive proliferation of ABM, thereby having a therapeutic effect on ABM.

[0185] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Use of a PDGFRA inhibitor in the preparation of a drug for treating astroblastoma, wherein: The PDGFRA inhibitor is selected from the group consisting of Crenolanib and CP-673451.

2. The use according to claim 1, characterized in that The astroblastoma is an astroblastoma accompanied by MN1, BEND2, and CXXC5 gene mutations.

3. The use according to claim 2, characterized in that The astroblastoma is an astroblastoma with MN1:BEND2 or MN1:CXXC5 gene fusion.

4. The use according to any one of claims 1 to 3, characterized in that The method for treating astroblastoma is achieved by specifically inhibiting the excessive proliferation of astroblastoma.

5. The use according to any one of claims 1 to 3, characterized in that The treating astroblastoma includes delaying the progression of astroblastoma.

6. The use according to any one of claims 1 to 3, characterized in that In the drug, the PDGFRA inhibitor is the only active ingredient or one of the active ingredients.

Images