Cas protein, combinatorial protein, nucleic acid molecule, ribonucleoprotein complex, recombinant vector, transgenic cell and application thereof

Abstract

The invention relates to the field of nucleic acid editing, discloses a Cas protein, a combined protein, a nucleic acid molecule, a ribonucleoprotein compound, a recombinant vector, a transgenic cell and application thereof, and particularly discloses the Cas protein, the combined protein, a gene for coding the Cas protein or the combined protein, the nucleic acid molecule, the ribonucleoprotein compound and the recombinant vector. The invention discloses a transgenic cell, application thereof and a gene editing method. The Cas protein and the crRNA component thereof provided by the invention can perform specific targeted editing on genome DNA in eukaryotes and have wider target recognition, and the off-target potential of the Cas protein and the crRNA component thereof can be reduced by virtue of the PAM characteristics of four bases of the Cas protein and the crRNA component thereof.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid editing, and specifically to a Cas protein, a combination protein, a gene encoding the Cas protein or the combination protein, a nucleic acid molecule, a ribonucleoprotein complex, a recombinant vector, a transgenic cell and applications thereof, and a gene editing method. Background Art

[0002] The full name of CRISPR is Clustered Regularly Interspaced Short Palindromic Repeats, which is a lot of identical small segments, and then evenly insert them into a randomly arranged DNA. These sequences are called repeats, and the randomly arranged DNA that separates them is called spacer. The full name of Cas is CRISPR associated, which is abbreviated as CRISPR / Cas system.

[0003] The CRISPR / Cas system is widely present in a section of CRISPR repeat sequences and Cas protein-related sequences in the genomes of bacteria and archaea. It mainly participates in the immune response of bacteria to prevent bacteria from being invaded by foreign nucleic acids. Based on the characteristics that Cas proteins can accurately locate specific target fragments in the genome under the guidance of guide RNA (sgRNA), they are transformed into eukaryotic gene editing tools through genetic engineering and applied to gene function research, genetic improvement and medical research in animals and plants. When the CRISPR / Cas system functions, Cas9 protein and sgRNA form a protein-RNA complex. Cas protein can recognize PAM (Protospacer adjacent motif for short, protospacer adjacent motif, such as 5'-NGG-3' for Cas9 protein). With the assistance of sgRNA, Cas protein melts the DNA double strands complementary to sgRNA near PAM and cuts to form DNA double-strand breaks (DSBs). Subsequently, under the action of endogenous NHEJ or HDR repair pathways, frameshift mutations caused by base insertion or deletion (Indel) or other reasons are introduced at the target site, or the functional structure is affected and eventually knocked out.

[0004] According to the composition of Cas protein, CRISPR system can be divided into Class I and Class II, and six types (Type I to VI) are mainly divided according to its mode of action. In these two types of CRISPR systems, Class I (Type I, III, IV) requires multiple protein subunits to form a complex to perform nuclease function, while Class II (Type II, V, VI) only needs a single Cas protein and the corresponding sgRNA to perform targeted nuclease function, so Class II Cas protein is developed for gene editing. At present, the systems that can effectively act on chromosome engineering in eukaryotic cells are still mainly SpCas9 and AsCas12a, which belong to Type II and Type V respectively. When in use, SpCas9 is guided to the target site by a sgRNA composed of a segment of crRNA and tracrRNA to perform specific cutting, producing a blunt end incision; while AsCas12a only needs a segment of crRNA to cut the target site, and the resulting incision is usually a sticky end. Since the DSB at the sticky end usually needs to be modified to a flat end with the help of an exonuclease for connection during the repair process, the resulting mutation will produce more nucleotide deletions than SpCas9.

[0005] In addition, due to the short sgRNA, the Cas12 family can more easily enter the cell with the help of related delivery systems. At present, the CRISPR / Cas editing system has been widely used in the fields of basic biological research, genetic improvement and medical research. The various known CRISPR / Cas-based gene editing systems have their own advantages and disadvantages due to editing efficiency, target PAM restrictions, specificity and other reasons. Therefore, in order to meet the needs of various biological research or applications, new and diverse CRISPR / Cas gene editing systems still need to be developed.

[0006] Gene editing technology can manipulate or modify genomic DNA in a targeted manner, thereby changing the characteristics of an organism. Currently, this technology mainly includes: (1) zinc finger nuclease (ZFN) technology, which uses a zinc finger domain to specifically recognize bases and then uses Fok I nuclease to cut double-stranded DNA; (2) transcription activator-like effector nuclease TALEN technology, which uses transcription activator-like effectors to recognize bases and then cut double-stranded DNA through FokI; (3) gene technology based on the CRISPR / Cas system, which uses sgRNA to guide Cas protein to cut at the specified target site and introduce mutations with the help of the non-homologous end joining repair mechanism in the cell. Since the recognition of target sites by CRISPR / Cas gene editing technology relies on sgRNA to recognize target sequences through base complementary pairing, it has high specificity, and the system is simple to construct and has high editing efficiency. Therefore, this technology is currently the most widely used gene editing technology.

[0007] The CRISPR / Cas9 system derived from bacteria is the earliest technology developed for eukaryotic gene editing. The invention originates from the immune system of bacteria to resist the invasion of exogenous nucleic acids. When nucleic acids from other microorganisms such as bacteriophages are injected into bacteria for the first time, the Class I Cas enzymes expressed by the CRISPR locus, such as Cas1, Cas2, Cas4, etc., can cut exogenous nucleic acids and then insert a DNA sequence into the CRISPR repeat sequence cluster. When bacteria are invaded by the same exogenous nucleic acid again, the sequence of the CRISPR cluster is transcribed and processed to form a short crRNA, which can complement and pair with a partial sequence of tracrRNA transcribed near the CRISPR cluster, thereby forming a sgRNA composed of crRNA-tracrRNA, and then guiding the Cas9 protein to locate to the 5' end with a specific PAM sequence (such as SpCas9 is NGG, N is one of A, T, C, G), and recognize the target site through complementary pairing of 20nt base sequences. Cas9 protein has HNH and RuvC nuclease domains, which can cut double-stranded DNA to produce double-strand breaks, and then introduce mutations using intracellular repair mechanisms. Using genetic engineering methods, by expressing bacterial Cas9 protein and artificially synthesizing or transcribing sgRNA sequences, the Cas9 and sgRNA protein complexes are simultaneously transferred into cells, which can cut specific targets in the genome and achieve site-specific editing.

[0008] Since the CRISPR / Cas9 system can be used for eukaryotic gene editing, various types of CRISPR / Cas systems have been identified. The most widely used and most diverse Cas proteins belong to the Cas12 family. The Cas12 family protein components that were first discovered and developed as gene editing technology are Cas12a (also called Cpf1), including FnCpf1, LbCpf1, and AsCpf1, of which the recognition PAM of FnCpf1 is TTN, while that of LbCpf1 and AsCpf1 is TTTN. Unlike the aforementioned CRISPR / Cas9 system, the sgRNA of the Cpf1 protein only requires one short crRNA, does not rely on tracrRNA, and Cpf1 itself has the ability to process crRNA. In addition, the recognition target site of Cpf1 is 24nt and is located at the 3' end of the PAM. When using the CRISRP / Cas system to perform gene editing in eukaryotic organisms, one or more nuclear localization signals are usually added to both sides of the Cas protein to help the complex enter the cell nucleus in order to allow the Cas-sgRNA protein complex to enter the cell. In addition, since the sgRNA based on the Cpf1 system is shorter, it is easy to deliver into the cell. Summary of the invention

[0009] The purpose of the present invention is to provide a new gene editing component with good performance and robustness.

[0010] In order to achieve the above object, the first aspect of the present invention provides a Cas protein, the amino acid sequence of the Cas protein is an amino acid sequence selected from at least one of the following:

[0011] (1) the amino acid sequence shown in SEQ ID NO.1;

[0012] (2) An amino acid sequence derived from SEQ ID NO.1 that is at least 90% identical, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO.1, and whose enzyme activity remains unchanged.

[0013] The second aspect of the present invention provides a combined protein, which comprises the Cas protein described in the first aspect and a fragment a connected to the Cas protein; the fragment a is provided by at least one selected from a His tag and a nuclear localization signal peptide.

[0014] The third aspect of the present invention provides a gene I encoding the Cas protein described in the first aspect.

[0015] The fourth aspect of the present invention provides a gene II encoding the combined protein described in the second aspect.

[0016] The fifth aspect of the present invention provides a nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID NO.8 and / or SEQ ID NO.9.

[0017] The sixth aspect of the present invention provides a ribonucleoprotein complex, which comprises a protein component and a nucleic acid component; the protein component is selected from at least one of the Cas protein described in the first aspect and the combined protein described in the second aspect; the nucleic acid component comprises a guide sequence consistent with the target sequence and a nucleic acid molecule; the nucleic acid molecule is the nucleic acid molecule described in the fifth aspect.

[0018] The seventh aspect of the present invention provides a recombinant vector, which comprises the nucleic acid molecule described in the fifth aspect.

[0019] The eighth aspect of the present invention provides a transgenic cell, which comprises the recombinant vector described in the seventh aspect.

[0020] The ninth aspect of the present invention provides the use of the Cas protein described in the first aspect, the combined protein described in the second aspect, the gene I described in the third aspect, the gene II described in the fourth aspect, the nucleic acid molecule described in the fifth aspect, the ribonucleoprotein complex described in the sixth aspect, or the recombinant vector described in the seventh aspect in gene editing.

[0021] The tenth aspect of the present invention provides a method for gene editing, which delivers the ribonucleoprotein complex described in the sixth aspect and / or the recombinant vector described in the seventh aspect into a cell containing a target gene; the target gene contains a target sequence.

[0022] The technical solution provided by the present invention has at least the following advantages:

[0023] The Cas protein (EDG-01) and its crRNA component provided by the present invention can perform specific targeted editing of genomic DNA in eukaryotic organisms. The PAMs recognized by the present invention are mainly NTTV, TTTT and TTCN, as well as weak TCTV and TGTA cleavage activities, with a wider range of target recognition, and its 4-base PAM feature can reduce its off-target potential. In addition, the gene editing system provided by the present invention, sgRNA does not rely on tracrRNA.

[0024] In addition, EDG-01 identified in the present invention has low homology with the currently reported Cas12a family proteins for eukaryotic gene editing, and is a new type of gene editing component system. In eukaryotic organisms such as plants, the editing efficiency of the ribonucleoprotein complex provided by the present invention can reach more than 70%. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a schematic diagram of the secondary structure formed by crRNA;

[0026] Figure 2 It is the amino acid sequence alignment diagram of EDG-01 and LbCpf1, Ascpf1 and Fncpf1 proteins;

[0027] Figure 3 It is the amino acid sequence consistency analysis diagram of EDG-01 and LbCpf1, Ascpf1 and Fncpf1 proteins;

[0028] Figure 4 It is the predicted three-dimensional structure of the complex of EDG-01, sgRNA and substrate;

[0029] Figure 5 This is the characteristic diagram of the PAM sequence recognized by the EDG-01 and sgRNA complex;

[0030] Figure 6 It is a schematic diagram of the depletion ability of EDG-01 at 64 PAM sites;

[0031] Figure 7 This is the electrophoretic profile of EDG-01 cleaving 32 PAM substrates in vitro;

[0032] Figure 8 It is a schematic diagram comparing the depletion abilities of EDG-01 and Fncpf1 at 64 PAM sites;

[0033] Fig. 9 It is the electrophoretic profile of EDG-01 and Fncpf1 cleaving 8 PAM substrates in vitro;

[0034] Fig.10 It is the electrophoresis pattern of the three mutants of EDG-01 cutting double-stranded DNA in vitro;

[0035] Fig.11 is the pEGEDG-01Pubi-H and pEGLbCpf1Pubi-H expression vector map;

[0036] Fig.12 It is the map of pEGEDG-01Pubi-H-BEL-T and pEGLbCpf1Pubi-H-BEL-T editing vectors;

[0037] Fig.13 This is a statistical chart of the editing efficiency of EDG-01 in plant cells;

[0038] Fig.14 This is a schematic diagram of the specific types of bases deleted by EDG-01 gene editing mutation;

[0039] Fig.15 This is a schematic diagram of the percentage of missing sequence length after EDG-01 editing.

[0040] The partial sequence information involved in the present invention is shown in Table 1.

[0041] Table 1

[0042] Sequence number describe SEQ ID NO.1 Amino acid sequence of Cas protein (EDG-01 or CasEDG-01) SEQ ID NO.2 Optimized nucleotide sequence (with the nucleotide sequence encoding the nuclear localization signal peptide added) SEQ ID NO.3 pEGEDG-01Pubi-H vector sequence SEQ ID NO.4 pEGEDG-01Pubi-H-BEL-T test vector sequence SEQ ID NO.5 pEGLbCpf1Pubi-H-BEL-T control vector sequence SEQ ID NO.6 Amino acid sequence of Cas protein with 6xHis tag SEQ ID NO.7 Nucleotide sequence of the open reading frame encoding the Cas protein SEQ ID NO.8 CRISPR repeat sequence fragment SEQ ID NO.9 Processed CRISPR repeat sequence fragment (crRNA) SEQ ID NO.10 Nucleotide sequence of crRNA of LbCpf1 SEQ ID NO.21 Nucleic acid sequences of non-targeting strands used in the 3D structure of EDG-01 SEQ ID NO.22 Nucleic acid sequence of the targeting strand used in the 3D structure of EDG-01 SEQ ID NO.23 A specific sgRNA nucleic acid sequence used in the EDG-01 three-dimensional structure DETAILED DESCRIPTION

[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0044] The terms "guide RNA" or "sgRNA" or "nucleic acid component" are used interchangeably and have the meanings generally understood by those skilled in the art. Generally speaking, any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and guide sequence-specific binding of a nucleic acid targeting complex to the target nucleic acid sequence is included. It may comprise a direct repeat sequence and a guide sequence, or consist essentially of or consist of a direct repeat sequence and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system).

[0045] crRNA (CRISPR RNA): CRISPR RNA or crRNA is an RNA transcript from the CRISPR locus. In the Cpf1 (Cas12a) system, crRNA is a short single-stranded RNA, mainly composed of a repeat sequence (direct repeat sequence). The direct repeat sequence consists of a stem and a small loop. The stem is composed of a left arm (stem left) and a right arm (stem right). The left arm and the right arm are paired to form the main structure of the direct repeat sequence. The direct repeat sequence is highly conserved, and most of them have the same stem loop. The repeat sequence is a conserved region that binds to the Cpf1 protein and is responsible for forming a complex with Cpf1.

[0046] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0047] In the present invention, EDG-01 or CasEDG-01 both represent the Cas protein described in the present invention.

[0048] In the present invention, "V" in the nucleotide sequence indicates that it is selected from A, C, and G; "N" in the nucleotide sequence indicates that it is selected from A, C, G, and T;

[0049] As mentioned above, the first aspect of the present invention provides a Cas protein, the amino acid sequence of the Cas protein is an amino acid sequence selected from at least one of the following:

[0050] (1) the amino acid sequence shown in SEQ ID NO.1;

[0051] (2) An amino acid sequence derived from SEQ ID NO.1 that is at least 90% identical, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO.1, and whose enzyme activity remains unchanged.

[0052] Preferably, the Cas protein comprises a RuvC nuclease domain.

[0053] Preferably, the Cas protein is derived from a Flavobacterium branchiophilum strain.

[0054] As mentioned above, the second aspect of the present invention provides a combined protein, which comprises the Cas protein described in the first aspect and a fragment a connected to the Cas protein; the fragment a is provided by at least one selected from a His tag and a nuclear localization signal peptide.

[0055] Preferably, the His tag and / or the nuclear localization signal peptide are connected to the N-terminus and / or C-terminus of the Cas protein.

[0056] Preferably, the combined protein has an amino acid sequence selected from at least one of the following:

[0057] (1) the amino acid sequence shown in SEQ ID NO.6;

[0058] (2) An amino acid sequence derived from SEQ ID NO. 6 that is at least 90% identical, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO. 6, and whose enzyme activity remains unchanged.

[0059] As mentioned above, the third aspect of the present invention provides a gene I encoding the Cas protein described in the first aspect.

[0060] Preferably, the nucleotide sequence of the gene I is at least one nucleotide sequence selected from the following:

[0061] (1) the nucleotide sequence shown in SEQ ID NO.7;

[0062] (2) A nucleotide sequence that is at least 90% identical to SEQ ID NO.7, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO.7.

[0063] As mentioned above, the fourth aspect of the present invention provides a gene II encoding the combined protein described in the second aspect.

[0064] Preferably, the nucleotide sequence of the gene II is at least one nucleotide sequence selected from the following:

[0065] (1) the nucleotide sequence shown in SEQ ID NO.2;

[0066] (2) A nucleotide sequence that is at least 90% identical to SEQ ID NO. 2, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical.

[0067] The fifth aspect of the present invention provides a nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID NO.8 and / or SEQ ID NO.9.

[0068] Preferably, the nucleic acid molecule is RNA.

[0069] The sixth aspect of the present invention provides a ribonucleoprotein complex, which comprises a protein component and a nucleic acid component; the protein component is selected from at least one of the Cas protein described in the first aspect and the combined protein described in the second aspect; the nucleic acid component comprises a guide sequence consistent with the target sequence and a nucleic acid molecule; the nucleic acid molecule is the nucleic acid molecule described in the fifth aspect.

[0070] Preferably, the targeting sequence is linked to the 3' end of the nucleic acid molecule.

[0071] Preferably, the guide sequence is 20-28 nt in length.

[0072] Preferably, the target site PAM sequence recognized by the ribonucleoprotein complex is selected from at least one of NTTV, TTCN, TTTT, TCTV, and TGTA; wherein the V is selected from A, C or G; and the N is selected from A, C, G or T.

[0073] The PAM sequences described in the present invention are all in the order from 5' to 3'.

[0074] Preferably, the target site PAM sequence recognized by the ribonucleoprotein complex is selected from at least one of NTTV, TTCN, TTTT, and TCTV; wherein the V is selected from A, C or G; and the N is selected from A, C, G or T.

[0075] Preferably, the target site PAM sequence recognized by the ribonucleoprotein complex is TTTN, wherein N is selected from A, C, G or T.

[0076] More preferably, the target site PAM sequence recognized by the ribonucleoprotein complex is TTTV, wherein the V is selected from A, C or G.

[0077] The seventh aspect of the present invention provides a recombinant vector, which comprises the nucleic acid molecule described in the fifth aspect.

[0078] According to a preferred embodiment, the recombinant vector of the present invention comprises the nucleic acid molecule described in the fifth aspect, and comprises the gene I described in the third aspect and / or the gene II described in the fourth aspect.

[0079] The eighth aspect of the present invention provides a transgenic cell, which comprises the recombinant vector described in the seventh aspect.

[0080] Preferably, the transgenic cell is a eukaryotic cell.

[0081] More preferably, the transgenic cell is a eukaryotic plant cell.

[0082] As mentioned above, the ninth aspect of the present invention provides the use of the Cas protein described in the first aspect, the combined protein described in the second aspect, the gene I described in the third aspect, the gene II described in the fourth aspect, the nucleic acid molecule described in the fifth aspect, the ribonucleoprotein complex described in the sixth aspect, or the recombinant vector described in the seventh aspect in gene editing.

[0083] Preferably, the gene editing is gene editing in eukaryotes.

[0084] Preferably, the gene editing method is gene deletion.

[0085] The tenth aspect of the present invention provides a method for gene editing, which delivers the ribonucleoprotein complex described in the sixth aspect and / or the recombinant vector described in the seventh aspect into a cell containing a target gene; the target gene contains a target sequence.

[0086] Preferably, the cell is a eukaryotic cell, more preferably a eukaryotic plant cell.

[0087] In the gene editing method described in the present invention, the gene I encoding the Cas protein or the gene II encoding the combined protein can be present in the same vector as the nucleic acid molecule and delivered to the cell containing the target gene for gene editing, or can be present in different vectors and delivered to the cell containing the target gene for gene editing. As long as the ribonucleoprotein complex described in the present invention can exist or can be synthesized and assembled in the system for performing the gene editing, the effect of gene editing can be exerted.

[0088] According to a particularly preferred embodiment of the present invention:

[0089] The method uses bioinformatics to screen a large number of sites with CRISPR cluster repeat sequence characteristics and adjacent sequences in the bacterial genome. Through this method, the present invention identifies a site containing an interspaced CRISPR repeat sequence cluster characteristic from the genome of Flavobacterium branchiophilum bacteria, and the repeat sequence fragment of the site is SEQ ID NO.8: 5'-GTTTAAAACCACTTTAAAATTTCTACTATTGTAGAT-3'.

[0090] The repeat sequence fragment is repeated 38 times in the genome, and the specific sequence between each repeat sequence fragment (the specific sequence refers to the specific non-repeating sequence between two repeat sequences) is 28bp in length. There is an open reading frame next to the repeat sequence fragment, and its nucleotide sequence is shown in SEQ ID NO.7.

[0091] The open reading frame encodes a class II type V CRISPR protein containing a RuvC nuclease domain, i.e., a Cas protein, which is named EDG-01 or CasEDG-01 in the present invention, and its amino acid sequence is shown in SEQ ID NO.1.

[0092] The CRISPR repeat sequence fragment shown in SEQ ID NO.8 can be processed into a segment of crRNA. The processed crRNA sequence is SEQ ID NO.9: 5'-AATTTCTACTATTGTAGAT-3'. The secondary structure formed is as follows Figure 1 shown.

[0093] The amino acid sequence was aligned by the Align tool on the Uniprot official website. The highest similarity between the EDG-01 of the present invention and the CRISPR / Cas gene editing component reported in the prior art (Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.doi: 10.1016 / j.cell.2015.09.038.) was FnCas12a (also called FnCpf1), and the similarity of the entire sequence was 46.18%. The amino acid sequence alignment results are shown in FIG. Figure 2 and Figure 3 shown.

[0094] Aphafold3 was used to predict the three-dimensional structure of CasEDG-01 protein. The amino acid sequence used was SEQ ID NO.1, the nucleic acid sequence of the non-targeting chain was (UTS, SEQ ID NO.21): TTTCAAGTGATTGAAGCATACACAAGAA, and the nucleic acid sequence of the targeting chain was (TS, SEQ ID NO.22): TTCTTGTGTATGCTTCAATCACTTGAAA; the nucleic acid sequence of sgRNA-1 (SEQ ID NO.23) was: AAUUUCUACUAUUGUAGAUAAGUGAUUGAAGCAUACACAAGAA. Then we used Foldseek (URL: https: / / search.foldseek.com / search) to search for similar protein structures based on this predicted structure. In the PDB database in the Foldseek prediction results, we saw that the proteins with the highest structural similarity to CasEDG-01 include FnCas12a and AsCas12a (also called AsCpf1), etc. Then we used the Uniprot database for the domain information of proteins AsCas12a (uniprotid: U2UMQ6) and FnCas12a (uniprotid: A0Q7Q2) to annotate the domains of CasEDG-01. By aligning the domains of CasEDG-01 with those of FnCas12a and AsCas12a, the domain names and corresponding amino acid ranges of CasEDG-01 were finally obtained: wedge domain I (WEDI; 1-33); recognition domain I (RECI; 34-303); recognition domain II (RECII; 304-572); wedge domain II (WEDII; 573-640); PAM interaction domain (PI domain; 641-730); wedge domain III (WEDIII; 731-905); RuvC nuclease domain I (RuvCI; 906-965); (Bridgehelix; 966-982); RuvC nuclease domain II (RuvCII; 983-1090); nuclease domain (Nuc; 1091-1274); RuvC nuclease domain III (RuvCIII; 1275-1318). Different domains are then assigned different colors, and the final result is as follows Figure 4 shown.

[0095] In order to further identify the PAM sequence of the target site recognized by the EDG-01 and sgRNA complex, the present invention uses a PAM in vitro cleavage method to identify the PAM characteristics of the component cleaving the target site sequence, as follows:

[0096] ① By designing primers, a 1.3kb sequence containing PAM and target was amplified as a substrate. The target PAM used for PAM identification was set to 6 consecutive degenerate bases (N, N was selected from A, T, C, G), and the specific sequence was: 5'-NNNNNNAAGTGAAGATTGACATACACAGAA-3'.

[0097] ② Mix CasEDG-01 protein and sgRNA at a molar ratio of 1:2, and then mix and cut with 1 μg of PAM library substrate in a PCR instrument at a temperature of 37°C, and then add proteinase K to digest at 55°C for 45 minutes (termination reaction).

[0098] ③After the reaction is completed, run 2% agarose gel, cut the residual substrate with a band of 1.3kb and purify it, amplify the approximately 250bp fragment containing the 6N PAM region of the recovered product by designed primers, and then connect the product to the connector with second-generation high-throughput sequencing (illumina) through a second round of PCR.

[0099] ④ After PCR amplification, the DNA product was purified by 2% agarose gel electrophoresis. The DNA sample concentration was determined using Nanodrop, and 200 ng of the purified product was sequenced by PE150.

[0100] ⑤After sequencing is completed, data analysis is performed to determine the recognition of CasEDG-01 protein PAM (i.e. Figure 5 result).

[0101] like Figure 5 As shown, after repeated experimental verification, the PAM recognized by the EDG-01 and sgRNA complex is NTTV; TTCN and TTTT, and weakly recognizes TCTV, where V represents A, C or G; N represents A, C, G or T. Therefore, the EDG-01 identified in the present invention has a wider recognition PAM.

[0102] from Figure 5We can see that the PAM sequence recognized by CasEDG-01 is close to NNNTTN. At the same time, the 4th and 5th positions of PAM have activity with not only T base but also C base, so we list separately all the data with PAM sequence NYYN (N is selected from A, T, C, G; Y is selected from T, C) in the second-generation sequencing data, specifically ATTA, ATTG, ATTC, ATTT, GTTA, GTTG, GTTC, GTTT, CTTA, CTTG, CTTC, CTTT, TTTA, TTTG, TTTC, TTTT, ATCA, ATCG, ATCC, ATCT , GTCA, GTCG, GTCC, GTCT, CTCA, CTCG, CTCC, CTCT, TTCA, TTCG, TTCC, TTCT, ACTA, ACTG, ACTC, ACTT, GCTA, GCTG, GCTC, GCTT, CCTA, CCTG, CCTC, CCTT, TCTA, TCTG, TCTC, TCTT, ACCA, ACCG, ACCC, ACCT, GCCA, GCCG, GCCC, GCCT, CCCA, CCCG, CCCC, CCCT, TCCA, TCCG, TCCC and TCCT. We calculated the proportion of these 64 PAMs in the total sequencing data in EDG-01 and the control group (the number of reads of the 64 PAMs was divided by the total number of reads).

[0103] In order to display the sequencing data more intuitively, we divided the proportion of these 64 PAMs in the control group by the percentage of the corresponding PAMs in CasEDG-01. This ratio is called the PAM consumption index. The higher this ratio is, the more the proportion of this PAM in the CasEDG-01 sequencing data has decreased compared to the control group, which means that CasEDG-01 has a stronger ability to cut the substrate of this PAM. The final result is as follows Figure 6 shown.

[0104] In order to further verify the substrate cleavage ability of EDG-01 for different PAMs, the present invention further determined its PAM preference through in vitro cleavage experiments. EDG-01 constructed on the pET28a vector was expressed in the prokaryotic expression strain BL21, and sgRNA-1 was obtained by in vitro transcription and purification using T7 transcriptase. In order to purify the EDG-01 protein expressed in the cell, a 6xHis tag amino acid sequence was added to the N-terminus of its sequence. The final amino acid sequence is SEQ ID NO.6 (where " HHHHHH ” is a 6xHis tag):

[0105]

[0106]

[0107] The CasEDG-01 recombinant protein was purified by nickel column affinity chromatography, heparin column chromatography and Superdex 200Increase 10 / 300 GL molecular sieve, and finally stored in Buffer (20mM Tris-HCl, pH7.5, 150mM KCl, 1mM MgCl2, 50% glycerol, 0.5mM TCEP). The protein concentration was determined by Nanodrop, the protein supernatant was obtained by high-speed centrifugation, and then quick-frozen with liquid nitrogen. Finally, the CasEDG-01 protein solution was stored at -80°C for future use.

[0108] Based on the PAM consumption index of CasEDG-01, the present invention further verifies in vitro whether CasEDG-01 has NTTN and TTCN activity and weak TCTV activity. The CasEDG-01 protein and sgRNA were mixed at a molar ratio of 1:2 to obtain a CasEDG-01-sgRNA complex, and the complex was mixed with a cutting buffer (10*buffer component is 500mM tris pH 8.01M NaCl 100mM MgCl2) and nuclease-free water. After incubation on ice for 30 minutes, 100ng of DNA substrate (containing 24 PAMs: NTTN, TTCN and TCTN) was added to make the final CasEDG-01: sgRNA: substrate = 10: 20: 1. After sufficient mixing, incubate at 37°C for 45 minutes, then add 1μL of proteinase K, digest at 55°C for 45 minutes, run 2% agarose gel, and the final gel image result is as follows Figure 7 As shown, M (DNA Marker) indicates bands of 200bp, 1000bp, 750bp, 500bp, 250bp, and 100bp in size; P in the figure indicates two bands after the in vitro fragments were cut. Compared with the control (Ctrl) that does not contain EDG-01 and sgRNA complex, the double-stranded DNA was cut by EDG-01 and sgRNA complex to produce two short DNA chains. Moreover, the in vitro cutting results of these 24 PAMs can be seen to be similar to the PAM depletion index of CasEDG-01, that is, CasEDG-01 has strong NTTV, TTTT and TTCN activities and weak TCTV activity. Among them, TTTN has the strongest activity.

[0109] In order to compare the cleavage activity of CasEDG-01, the present invention compared CasEDG-01 with Fncpf1, which has the highest similarity and has been studied more. First, the difference in their PAM consumption index was compared. The results are as follows: Figure 8As shown in the figure, it can be seen that both CasEDG-01 and Fncpf1 can recognize the PAM of NTTV, but CasEDG-01 has TTCT and TTTT cleavage activity compared to Fncpf1, while Fncpf1 has no or very weak cleavage activity. So further in vitro cleavage verification was performed, and the results are as follows Fig. 9 As shown, it can be seen from the figure that the in vitro cleavage results are consistent with the PAM consumption index results.

[0110] At the same time, the present invention also verifies the inactivation site of CasEDG-01. By mutating the aspartic acid (D929) at position 929 or the glutamic acid (E1018) at position 1018 in SEQ ID NO.1 to alanine separately or simultaneously (the three mutations of D929A, E1018A and D929A / E1018A are represented by 929, 1018 and DD in the figure), CasEDG-01 can be completely inactivated. The results are shown in FIG. Fig.10 As shown, the cutting substrate on the left is PAM with TTTC, the cutting substrate on the right is PAM with TTTN, and M (DNA Marker) represents bands of sizes of 200bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0111] The present invention provides a gene editing system for eukaryotes, further constructs a plurality of gene editing vectors in eukaryotes (as described in the embodiments), verifies the gene editing activity of the EDG-01 and crRNA complex, and finds that the complex has high gene editing activity in eukaryotes. Taking plant cells as an example, the editing efficiency is 74% to 79%.

[0112] The recognition target sequence of the present invention is preferably 24 nt, and sgRNA is formed by designing a guide sequence consistent with the target sequence and connecting it to the crRNA nucleotide sequence. The specific sequence is shown as follows:

[0113] 5'-AATTTCTACTATTGTAGATNNNNNNNNNNNNNNNNNNNNNNNN-3', wherein 24nt of N is the target sequence and N is selected from A, T, C, and G.

[0114] After the sequence is transcribed, the generated sgRNA forms a ribonucleoprotein complex with EDG-01, which can specifically cut the target sequence with a PAM type of TTTV. The mutations produced after the cutting are mainly base deletions.

[0115] The present invention identifies a class II type V CRISPR / Cas effector protein with gene editing effect in the Flavobacterium branchiophilum strain, that is, the Cas protein of the present invention, named EDG-01 or CasEDG-01; the EDG-01 can perform gene editing on the genomic DNA of prokaryotes and eukaryotes at a fixed point under the mediation of sgRNA. The present invention provides a new efficient and stable gene editing system, which uses EDG-01 to edit the target sequence and generate the insertion or deletion of the DNA sequence.

[0116] The present invention will be described in detail below by way of examples. In the following examples, unless otherwise specified, the raw materials are all commercially available.

[0117] Example 1

[0118] The rice variety "Zhonghua 11" used in the present invention is provided by Wuhan Aidijing Biotechnology Co., Ltd. According to the study of the EDG-01 gene editing tool enzyme, the crRNA of EDG-01 is the nucleotide sequence shown in SEQ ID NO.9, the target design length is about 24nt, and the PAM site is "TTTV" with cutting activity. A control gene editing tool enzyme LbCpf1 is established. The enzyme has been a mature gene editing tool enzyme, and has relatively efficient editing activity in animals, plants, and microorganisms. The nucleotide sequence of LbCpf1 crRNA is SEQ ID NO.10: 5'-AATTTCTACTAAGTGTAGAT-3', the target design length is about 24nt, and the PAM site is "TTTN" with cutting activity. Gene editing experiments are carried out in eukaryotic organisms (especially plants) using EDG-01, and rice OsBEL (LOC_Os03g55240) is selected as the target gene.

[0119] The detailed process is as follows:

[0120] 1. Target design;

[0121] According to the gene sequence of the above-mentioned test gene OsBEL retrieved from the National Center for Biotechnology Information (NCBI) database, the target sequence of EDG-01 was designed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ). The present invention tests the editing efficiency of EDG-01 nuclease, and the test PAM sequence is "TTTC".

[0122] The target sequence (SEQ ID NO.11) is as follows:

[0123] >OsBEL

[0124] TTTCATCTCCTTCTAGAAGCACAAGCGC

[0125] 2. Design and assembly of EDG-01 expression vector:

[0126] According to the amino acid sequence of EDG-01 (as shown in SEQ ID NO.1), the nucleotide codons of rice were optimized, and a nucleotide sequence encoding a nuclear localization signal peptide was added to each end of the optimized nucleotide sequence. The obtained nucleotide sequence is shown in SEQ ID NO.2. The Golden Gate method was used to perform restriction enzyme ligation and cloning into a plant expression vector, and assembled into a pEGEDG-01Pubi-H expression vector (nucleotide sequence as shown in SEQ ID NO.3) for the next step of target assembly. The present invention uses the pEGLbCpf1Pubi-H expression vector (provided by Wuhan Aidijing Biotechnology Co., Ltd.) as a control group vector, and the two expression vector structures are as shown in Fig.11 shown.

[0127] 3. Construction of EDG-01 editing vector:

[0128] The pEGEDG-01Pubi-H vector designed and constructed by the present invention is characterized in that the EDG-01 gene is started by using the maize ubiquitin constitutive promoter UBI promoter, and the target point is assembled by using the rice OsU6a small RNA promoter commonly used in the plant multi-gene editing system to drive crRNA. At the same time, the editing efficiency of EDG-01 and LbCpf1 in the rice protoplast gene editing system is compared.

[0129] The target primer synthesis is shown in Table 2:

[0130] Table 2

[0131]

[0132]

[0133] Using the above primers, overlapping PCR was used to amplify the crRNA expression cassette OsU6a-crRNA-BEL-T of EDG-01 and LbCpf1. The crRNA expression cassette amplification system is as follows:

[0134] (1) In the first round of PCR amplification of OsU6a promoter and crRNA, the amplification systems shown in Table 3 and Table 4 were all carried out using the reaction conditions described in Table 5.

[0135] Table 3: pOsU6a amplification system

[0136]

[0137] Table 4: crRNA amplification system

[0138] 2XPfu MIX 5μL RNA-R Primers 0.2μL BEL-CrT1 primers 0.2μL pcrRNA plasmid template 0.1μL <![CDATA[ddH2o]]> Add to 10 μL

[0139] Table 5: PCR reaction parameters

[0140]

[0141] (2) The second round of PCR amplification of the crRNA expression cassette, the amplification system shown in Table 6 was carried out using the reaction conditions described in Table 7.

[0142] Table 6: crRNA expression cassette amplification system

[0143]

[0144]

[0145] Table 7: PCR reaction parameters

[0146]

[0147] The expression cassette fragments were recovered using a gel recovery kit and digested and ligated using the GoldenGate method: 100 ng of the enzyme ligation system pEGEDG-01Pubi-H or pEGLbCpf1Pubi-H vector, 30 ng of the first group of crRNA expression cassette fragments or the second group of crRNA expression cassette fragments, 1.5 μl 10×CutSmart Buffer, 35 U of T4 DNA ligase, 10 U of Bsa I restriction endonuclease, and sterile water were used to form a mixed system of 15 μL, which was reacted in a PCR amplification instrument at 37°C, 5 min / 20°C, 5 min for 10 cycles. The ligated mixed solution was transformed into DH5α Escherichia coli peptide-sensitive cells, and then subjected to bacterial inspection and sequencing confirmation to finally form the pEGEDG-01Pubi-H-BEL-T (nucleotide sequence as shown in SEQ ID NO.4) and pEGLbCpf1Pubi-H-BEL-T (nucleotide sequence as shown in SEQ ID NO.5) editing vectors, as shown in the map. Fig.12 shown.

[0148] 4. Rice protoplast transformation:

[0149] The two gene editing vectors pEGEDG-01Pubi-H-BEL-T and pEGLbCpf1Pubi-H-BEL-T constructed above were introduced into the protoplasts of Zhonghua 11 material using the PEG-mediated rice protoplast transformation method to enable them to function. The rice variety "Zhonghua 11" was provided by Wuhan Aidijing Biotechnology Co., Ltd., and the rice protoplast transformation process was completed by Wuhan Aidijing Biotechnology Co., Ltd.

[0150] The detailed process of rice protoplast transformation is as follows:

[0151] (1) Preparation of protoplasts;

[0152] Select yellowing rice seedlings that have been cultured in the dark at 28°C for about one week, take out the stems, and remove the outermost leaf sheaths; cut the stems into pieces with a length of about 0.5 mm on a clean plastic board and put them into a 50 ml conical flask; add 5-10 ml of an enzymatic solution composed of cellulase and mesenchyme to completely immerse the tissue, evacuate with a vacuum pump, wrap with sealing film, and place at 28°C in the dark for 4 hours with slow shaking for enzymatic hydrolysis.

[0153] The protoplasts after the above enzymatic hydrolysis were filtered through a 40 μm filter into a 2 ml EP tube, and the middle part of the filtrate was retained and centrifuged at 600 rpm in a 4°C refrigerated centrifuge for 5 min; the supernatant was then aspirated with a pipette tip, discarded, and washed twice with 1 ml of pre-cooled W5 solution, each time centrifuged at 500 rpm in a 4°C refrigerated centrifuge for 5 min; finally, 1 ml of W5 solution was added to gently suspend the suspension, and it was allowed to stand on ice for 30 min; the suspension was centrifuged at 500 rpm for 5 min after standing, the supernatant was discarded, and MMG solution was added to resuspend it as needed, and it was allowed to stand for 8-10 min. After the protoplast quality was tested to be qualified, it was used in the next step.

[0154] (2) Introduction of vector:

[0155] The above-mentioned pEGEDG-01Pubi-H-BEL-T and pEGLbCpf1Pubi-H-BEL-T test plasmids were added with 10 μg each and repeated 3 times in each group, for a total of 6 tubes, and 100 μL of protoplasts and an equal volume of 40% PEG4000 solution were added to each tube; after slowly inverting to mix, the tube was placed in a 24.5°C water bath for 15 minutes; 1 ml of W5 solution was added to dilute the protoplasts and mixed to terminate the reaction; centrifuged at 500 rpm in a 4°C refrigerated centrifuge for 5 minutes, and the supernatant was discarded with a pipette tip; 1 ml of W5 solution was added to wash and centrifuged twice; finally, 1 ml of W5 solution was added, mixed slowly, and cultured in the dark at 28°C for 48 hours.

[0156] (3) Extraction of protoplast DNA:

[0157] After the protoplasts in step (2) were cultured for 48 hours, they were centrifuged at 500 rpm for 5 minutes in a 4°C refrigerated centrifuge, the supernatant was removed by a pipette tip, and 500 μL of 2XCTAB buffer was added, and the mixture was fully shaken on a vortex shaker to break the protoplasts and fully extract the DNA and dissolve it in the buffer. The protoplast genomic DNA of the above two groups of experiments was extracted according to the CTAB genomic DNA extraction method.

[0158] 5. Detection of mutation type of rice BEL gene:

[0159] The efficiency and type of gene editing mutations detected by the present invention refer to the higher throughput, more flexible and easy-to-use detection means and analysis software HiDecode system based on second-generation sequencing in the prior art CN112322704A. The detection method is based on Illumina sequencing PCR library construction. First, a pair of specific primers are designed to amplify the bands of 200-250bp before and after the target point, and a bridge sequence is added to the 5' end of the primer to amplify the first round and amplify the target sequence; the second round uses the bridge sequence of the first round, and uses the universal library construction adapter forward / reverse primer pos-N / plate-N (N=digital number); pos-N contains a 6-nt position-barcode (well barcode sequence) indicating the 96 well positions (A1~H12) on the PCR plate corresponding to each sample, a total of 96; plate-N contains a 6-nt plate-barcode (plate barcode sequence) indicating the PCR plate number; use universal amplification primers 2P-F / 2P-R: 2P-R contains an 8-nt marker for marking its own library sample barcode (library marker barcode sequence); to distinguish the library you built, inform the sequencing company, and let them split their own library data according to the barcode; finally, through HiDecode software analysis, you can obtain the mutation type of each target sequence of each sample.

[0160] The first round amplification primers are as follows:

[0161] BEL-seqF (SEQ ID NO.19): CTCGGAGTGATCGCACGCCTGGATTGTCTCCGCAA

[0162] BEL-seqR (SEQ ID NO.20): CTGAGAGGCTGGATGGCCGAGGAGGTAGTAGTGGA

[0163] The second round of PCR and subsequent library construction and analysis were performed according to the HiDecode operating method. After the library was sequenced, it was filtered with a threshold of 0.01 to reduce nonspecific amplification and fragments with large differences. The results of the editing efficiency analysis are shown in Table 8 and Fig.13, the types of base mutations produced after editing are as follows Fig.14 shown.

[0164] Table 8: Number of reads sequenced by NGS and their editing efficiency:

[0165] Test No. Number of edited reads Number of wild-type reads Editing efficiency LbCpf1-1 18309 7068 72.15％ LbCpf1-2 33680 7222 82.34％ LbCpf1-3 48915 16927 74.29％ EDG01-1 24348 8120 74.99％ EDG01-2 52531 17602 74.90％ EDG01-3 29073 7364 79.79％

[0166] The number of reads refers to the number of DNA sequence fragments read during high-throughput sequencing.

[0167] From the above results, it can be seen that the editing efficiency of the Cas protein EDG-01 provided by the present invention is comparable to that of the known LbCpf1 nuclease, both of which are around 76%. Cas12a nucleases cleave genomic DNA mostly with sticky ends, and the mutation type is mainly fragment deletion. Therefore, the mutation types of all the above mutation samples of EDG-01 were analyzed, such as Fig.15 As shown, deletions within 20bp accounted for 10.27%, deletions within 21-40bp accounted for 40.30%, deletions within 41-60bp accounted for 23.62%, deletions within 61-80bp accounted for 25.81%, and deletions above 80bp did not occur. This may be due to the small number of samples or the limited amplification length of the PCR library, which was filtered out during the library construction process. The results show that in the application of plant gene editing, the most common mutation type of EDG-01 is deletion within 50bp.

[0168] In the present invention, the nucleotide sequence of SEQ ID NO.2 is as follows (the underlined bold mark is the nuclear localization signal sequence):

[0169]

[0170]

[0171] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A Cas protein, characterized in that The amino acid sequence of the Cas protein is at least one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) An amino acid sequence derived from SEQ ID NO.1 that is at least 90% identical, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO.1, and whose enzyme activity remains unchanged.

2. The Cas protein according to claim 1, characterized in that The Cas protein comprises a RuvC nuclease domain.

3. The Cas protein according to claim 1 or 2, characterized in that The Cas protein is derived from the Flavobacterium branchiophilum strain.

4. A combined protein, characterized in that The combined protein comprises the Cas protein according to any one of claims 1 to 3 and a fragment a connected to the Cas protein; the fragment a is provided by at least one selected from a His tag and a nuclear localization signal peptide; Preferably, the His tag and / or the nuclear localization signal peptide are connected to the N-terminus and / or C-terminus of the Cas protein.

5. The combined protein according to claim 4, characterized in that The combined protein has an amino acid sequence selected from at least one of the following: (1) the amino acid sequence shown in SEQ ID NO.6; (2) An amino acid sequence derived from SEQ ID NO. 6 that is at least 90% identical, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO. 6, and whose enzyme activity remains unchanged.

6. A gene I encoding the Cas protein according to any one of claims 1 to 3; Preferably, the nucleotide sequence of the gene I is at least one nucleotide sequence selected from the following: (1) the nucleotide sequence shown in SEQ ID NO.7; (2) A nucleotide sequence that is at least 90% identical to SEQ ID NO.7, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO.

7.

7. A gene II encoding the combined protein according to claim 4 or 5; Preferably, the nucleotide sequence of the gene II is at least one nucleotide sequence selected from the following: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence that is at least 90% identical to SEQ ID NO. 2, preferably at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical.

8. A nucleic acid molecule, characterized in that The nucleic acid molecule contains the nucleotide sequence shown in SEQ ID NO.8 and / or SEQ ID NO.9; Preferably, the nucleic acid molecule is RNA.

9. A ribonucleoprotein complex, characterized in that The ribonucleoprotein complex comprises a protein component and a nucleic acid component; The protein component is selected from at least one of the Cas protein according to any one of claims 1 to 3 and the combined protein according to claim 4 or 5; The nucleic acid component comprises a guide sequence consistent with a target sequence and a nucleic acid molecule; the nucleic acid molecule is the nucleic acid molecule according to claim 8.

10. The ribonucleoprotein complex according to claim 9, characterized in that The guide sequence is connected to the 3' end of the nucleic acid molecule; Preferably, the guide sequence is 20-28 nt in length.

11. The ribonucleoprotein complex according to claim 9 or 10, characterized in that The target site PAM sequence recognized by the ribonucleoprotein complex is selected from at least one of NTTV, TTCN, TTTT, TCTV, and TGTA; wherein the N is selected from A, C, G, or T, and the V is selected from A, C, or G; Preferably, the target site PAM sequence recognized by the ribonucleoprotein complex is TTTV, wherein the V is selected from A, C or G.

12. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid molecule according to claim 8.

13. A transgenic cell, characterized in that: The transgenic cell comprises the recombinant vector of claim 12; Preferably, the transgenic cell is a eukaryotic cell.

14. Use of the Cas protein according to any one of claims 1 to 3, the combined protein according to claim 4 or 5, the gene I according to claim 6, the gene II according to claim 7, the nucleic acid molecule according to claim 8, the ribonucleoprotein complex according to any one of claims 9 to 11, or the recombinant vector according to claim 12 in gene editing; Preferably, the gene editing is gene editing in eukaryotes; Preferably, the gene editing method is gene deletion.

15. A method for gene editing, characterized in that: Delivering the ribonucleoprotein complex according to any one of claims 9 to 11 and / or the recombinant vector according to claim 12 into a cell comprising a target gene; the target gene comprises a target sequence; Preferably, the cell is a eukaryotic cell.

Images