System and method for isolating mRNA

Abstract

The present disclosure provides a method of isolating mRNA molecules by a combination of magnetic particles and positive pressure affinity chromatography. The mRNA molecules can be obtained in high yield and purity from in vitro transcription by using a combination of magnetic particles and positive pressure affinity chromatography. In particular, the method can be applied to automated processes to obtain high quality mRNA molecules with high throughput and shortened workflow for downstream applications.

Description

Technical Field

[0001] The present invention relates to the field of biological purification, and in particular to a system and method for separating mRNA. Background Art

[0002] Messenger RNA (mRNA)-based therapeutics show great promise in the prevention and treatment of a variety of diseases. Compared with recombinant proteins expressed in mammalian cell lines, mRNA manufacturing is faster and more flexible because mRNA can be easily produced by in vitro transcription. However, the technical barriers faced by mRNA therapeutics are also significant. For example, the efficacy of mRNA vaccines is reduced due to poor RNA stability in solution and in vivo and limited expression of payload mRNA, which are key issues that need to be carefully optimized for preclinical and clinical applications (Sahin, U., Karikó, K. & mRNA-basedtherapeutics-developing a new class of drugs. Nat. Rev. Drug Discov. 13, 759–780 (2014); Jackson, NAC, Kester, KE, Casimiro, D., Gurunathan, S. & DeRosa, F. Thepromise of mRNA vaccines: a biotech and industrial perspective. npjVaccines 5,11(2020);Weng,Y.et al.The challenge and prospect of mRNA therapeuticslandscape.Biotechnol.Adv.40,107534(2020);Crommelin,DJA,Anchordoquy,TJ,Volkin,DB,Jiskoot,W.&Mastrobattista,E.Addressing the cold reality ofmRNAvaccine stability. J. Pharm. Sci. 110,997–1001(2021)).

[0003] To solve the above problems, it is necessary to optimize the design of mRNA molecules, including 5' capping, promoter, 5' and 3' untranslated regions (UTR), Kozak sequence and signal domain, enhancer elements, poly (A), introns and splicing sites, ribosome internal entry sites and CDS codon optimization (Guo, X., Wang, C., and Wang, TY (2020). Chromatin-modifying elements for recombinant protein production in mammalian cell systems. Crit. Rev. Biotechnol. 40, 1035–1043; Wang, TY, and Guo, X. (2020). Expression vector cassette engineering for recombinant therapeutic production in mammalian cell systems. Appl. Microbiol. Biotechnol. 104, 5673–5688; Mauro, VP (2018). Codon optimization in the production of recombinant biotherapeutics: potential risks and considerations. BioDrugs. 32, 69–81; Kawabe, Y., Inao, T., Komatsu, S., Huang, G., Ito, A., Omasa, T., and Kamihira, M. (2017). Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site. J. Biosci. Bioeng. 123, 390–397). In addition, for the same vaccine project, effective sequences need to be screened, which is a huge workload, cumbersome and changeable, and cannot be effectively completed by manpower in a short time.

[0004] In terms of technology, the modification process of in vitro transcription, the reaction process (including NTP ratio, DNA template, reaction time, Mg 2+The quality of the final mRNA stock solution is crucial, and is usually optimized using the design of experiments (DOE). Manual operations are prone to deviations due to the cumbersome changes in conditions. The use of automated systems for mRNA preparation and purification can achieve efficient and parallel controllable results.

[0005] The mRNA product obtained by enzymatic transcription will produce impurities such as truncated RNA, double-stranded (ds) RNA, and reactants, which need to be removed in the downstream purification process. A variety of technologies can be used to separate and purify mRNA, including but not limited to LiCl precipitation, chromatography, magnetic particles, etc.

[0006] LiCl is commonly used to precipitate RNA from in vitro transcription (IVT). LiCl precipitation uses high concentrations of lithium cations to selectively precipitate RNA. After the mRNA is precipitated, the supernatant containing salts, free NTPs, proteins, and DNA is discarded. In this purification method, post-transcription DNaseI treatment is optional and will ensure complete removal of the template DNA. LiCl precipitation provides a simple and rapid method for recovering RNA from in vitro transcription reactions.

[0007] The mRNA purification process also often uses Oligo (dT) affinity chromatography to capture mRNA molecules, remove process-related impurities such as enzymes, NTPs, and template DNA, and use high-resolution hydrophobic or ionic fillers for fine purification to remove product-related impurities such as fragments or dsRNA. Oligo (dT) affinity chromatography binds to the Poly (A) tail and performs affinity purification, which can remove most impurities such as NTPs, enzymes, and DNA, but cannot distinguish between dsRNA and truncated RNA. In addition, ion exchange chromatography (IEC), hydrophobic chromatography (HIC), ion pair reverse chromatography, etc. are also often used for mRNA purification.

[0008] Separating biomolecules by using magnetic particles is known in the art. For example, patent publication number WO2018122246 describes a method for separating biomolecules from cell culture, including binding biomolecules to magnetic beads, separating the magnetic beads including bound biomolecules from the rest of the cell culture by using a magnetic separator, transporting the magnetic beads including bound biomolecules as a slurry with added buffer to a separate elution unit, and eluting biomolecules from the magnetic beads in the elution unit. Magnetic particles are an effective way to purify target biomolecules directly from a crude feed unit reserve, and the technology can replace clarification tools such as centrifugation, filtration, and capture chromatography. Magnetic particles are usually functionalized with ligands that have an affinity for target biomolecules. Magnetic particles are added and mixed with crude feed for a certain period of time to specifically bind all target biomolecules in the feed. After binding, the magnetic particles are captured by a magnet, and cells and impurities are decanted. Washing buffer is added to the magnetic particles, the magnet is turned off, and the washing buffer is mixed with the magnetic particles. After mixing, the magnet is turned on to capture the magnetic particles, and the washing buffer is decanted. After several washings, elution buffer is added to the magnetic particles in the same manner as wash buffer, and several batch elution steps are used to release the target biomolecule from the magnetic particles. All washing steps and elution steps are carried out in batch mode, and owing to the need to carry out several batch elution steps to obtain high elution yields, using this technology will dilute the target more compared with column chromatography. In addition, it is more difficult to optimize the elution conditions using batch elution, because the elution buffer needs to titrate the wash buffer to reach the correct elution conditions to release the target biomolecule from the magnetic beads, and different or large-volume elution buffers are needed for each elution step. A way to overcome this point is to transfer the washed magnetic particles to the chromatographic column for the elution step, to reduce the volume of elution buffer, and use a kind of elution buffer optimized to collect the elution amalgamation. However, this requires additional equipment and column fillers, which is time-consuming.

[0009] At present, these technologies for isolating and purifying mRNA have certain deficiencies to a greater or lesser extent and cannot meet the requirements of large-scale platform applications to provide mRNA therapy in rapid response to sudden outbreaks. New tools and scalable workflows for the development and production of mRNA vaccines are essential for advancing this promising technology to the clinic. Therefore, there is a need in the art for improved methods for isolating mRNA molecules, including purifying high-quality mRNA molecules from feeds in a reduced method time and in a more cost-effective manner. Summary of the invention

[0010] The present disclosure achieves the above-mentioned purpose of providing an improved method for separating and purifying mRNA molecules. The present disclosure relates to a method for separating mRNA molecules by a combination of magnetic particles and positive pressure affinity chromatography. As shown herein, mRNA molecules can be obtained from in vitro transcription with high yield and purity by using a combination of magnetic particles and positive pressure affinity chromatography. In particular, the method can be adapted for automated processes to obtain high-quality mRNA molecules for downstream applications with high throughput and shortened workflows.

[0011] More specifically, the present disclosure relates to a method for isolating mRNA molecules, comprising the following steps:

[0012] (a) providing magnetic particles comprising a ligand capable of binding to an mRNA molecule;

[0013] (b) contacting a solution containing mRNA molecules with the magnetic particles to obtain magnetic particles containing bound mRNA molecules;

[0014] (c) separating the magnetic particles containing the bound mRNA molecules using a magnetic field;

[0015] (d) eluting the mRNA molecules from the separated magnetic particles to obtain a primarily purified solution containing mRNA molecules; and

[0016] (e) loading the solution containing mRNA molecules obtained in step (d) onto an affinity chromatography containing oligo(dT), eluting the mRNA molecules by positive pressure, and obtaining a secondary purified solution containing mRNA molecules.

[0017] In one embodiment, the method further comprises the step of performing in vitro transcription (IVT) on the DNA to generate a solution comprising mRNA molecules prior to step (b).

[0018] In one embodiment, the method further comprises the step of capping and / or tailing the mRNA molecules prior to step (e).

[0019] In one embodiment, the method further comprises the step of performing a LiCl method to concentrate the secondary purified solution containing the mRNA molecules after step (e).

[0020] In one embodiment, the method further comprises the step of performing a magnetic particle method to concentrate the secondary purified solution containing mRNA molecules after step (e). In one embodiment, the magnetic particle method comprises repeating steps (a)-(d).

[0021] In one embodiment, the method is performed in an automated, semi-automated or manual manner.

[0022] Specifically, the present disclosure relates to a method for isolating mRNA molecules, comprising the following steps:

[0023] (a) providing magnetic particles comprising a ligand capable of binding to an mRNA molecule;

[0024] (b) performing in vitro transcription on the DNA to generate a solution containing mRNA molecules;

[0025] (c) contacting a solution containing mRNA molecules with the magnetic particles to obtain magnetic particles containing bound mRNA molecules;

[0026] (d) separating the magnetic particles containing the bound mRNA molecules using a magnetic field;

[0027] (e) eluting the mRNA molecules from the separated magnetic particles to obtain a primary purified solution containing mRNA molecules;

[0028] (f) optionally, capping the mRNA molecules obtained in step (e) to obtain a solution containing capped mRNA molecules;

[0029] (g) loading the solution containing mRNA molecules obtained in step (e) or (f) onto an affinity chromatography containing oligo(dT), eluting the mRNA molecules under positive pressure to obtain a secondary purified solution containing mRNA molecules; and

[0030] (h) performing liquid replacement, concentration and sterilization filtration on the solution containing the mRNA molecules obtained in step (g).

[0031] In one embodiment, step (f) further comprises tailing the mRNA molecule.

[0032] In one embodiment, the concentration by fluid exchange in step (h) is performed by magnetic particle method.

[0033] In one embodiment, the method is performed in an automated fashion.

[0034] Further, the present disclosure relates to a system for isolating mRNA molecules, comprising:

[0035] A purification module 1, comprising magnetic particles, wherein the magnetic particles contain ligands capable of binding to mRNA molecules;

[0036] a purification module 2, comprising an affinity chromatography column, wherein the affinity chromatography column can be operated in a positive pressure mode; and

[0037] A fluid module, comprising a container for containing a solution containing mRNA, wherein the fluid module can be in fluid communication with purification module 1 and purification module 2.

[0038] In one embodiment, the system further comprises a feed module for providing a source of mRNA molecules, and a collection module for collecting mRNA molecules. In one embodiment, the feed module comprises a container for containing IVT reaction reagents.

[0039] In one embodiment, the fluid module further comprises a liquid transfer device. In one embodiment, the liquid transfer device is any device or means capable of transferring liquids, such as a pipette, such as a manual or automatic pipette, a pipette, a pipetting workstation, and the like.

[0040] In one embodiment, the fluid module further comprises conduits that facilitate fluid communication between purification module 1, purification module 2 and the fluid module and optionally the feed module and collection module.

[0041] In one embodiment, the purification module 1 comprises a magnetic separator. In one embodiment, the purification module 1 comprises a magnetic field.

[0042] In one embodiment, the fluid module further comprises a container for containing an elution solution for eluting mRNA from the magnetic particles, and a container for containing an elution solution for eluting mRNA from the affinity chromatography column.

[0043] In one embodiment, the fluid module further comprises a container for containing a washing solution for washing the magnetic particles, and a container for containing a washing solution for washing the affinity chromatography column.

[0044] In one embodiment, the system further comprises additional modules, including but not limited to means for performing the following operations:

[0045] The DNA is transcribed in vitro to generate a solution containing mRNA molecules;

[0046] Capping and / or tailing mRNA molecules;

[0047] replacing and concentrating the solution containing the mRNA molecule; and / or

[0048] The solution containing the mRNA molecules is sterile filtered.

[0049] In one embodiment, the liquid exchange concentration is performed by the LiCl method. In one embodiment, the liquid exchange concentration is performed by the magnetic particle method. In one embodiment, the additional module for performing liquid exchange concentration is the same as the purification module 1. In one embodiment, the additional module for performing liquid exchange concentration is different from the purification module 1.

[0050] In one embodiment, the system operates in an automated, semi-automated or manual manner. Therefore, in one embodiment, the system further comprises a control module, which is configured to control the various modules of the system to operate in an automated or semi-automated manner.

[0051] In some embodiments of the methods or systems described in the present disclosure, the mRNA molecule comprises one or more functional nucleotide analogs. Preferably, the functional nucleotide analogs are one or more selected from the group consisting of pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 An exemplary flow chart showing the method for isolating mRNA molecules according to the present invention.

[0053] Figure 2 Comparison of purification results between the LiCl method and the magnetic particle method. A, Comparative experimental scheme of the two purification methods; B, Purity results of the two purification methods after IVT reaction (before capping); C, Capping purity and capping rate results of the two purification methods after IVT.

[0054] Figure 3 The results of the impurity analysis introduced by the magnetic bead method are shown. A, IFN-β analysis results of mRNA stock solution in BJ cells; B, activity analysis results of mRNA stock solution in BJ cells; C, cytotoxicity analysis results of magnetic beads in BC2C12 mouse muscle cells.

[0055] Figure 4 Shown are the results of hematological and blood biochemical analyses of mice injected with magnetic beads via the tail vein.

[0056] Figure 5 The yield results for isolating mRNA molecules by negative pressure affinity chromatography are shown.

[0057] Figure 6 Flowcharts showing various methods for isolating mRNA molecules, wherein Scheme 3 exemplifies a method according to the present invention.

[0058] Figure 7 A comparison of the FA purity analysis results of Scheme 1, Scheme 2, and Scheme 3 is shown.

[0059] Figure 8 A comparison of the capping rate results for Process 1, Process 2, and Process 3 is shown.

[0060] Fig. 9 A comparison of the protein residue test results of Process 1, Process 2, and Process 3 is shown.

[0061] Fig.10A comparison of the in vitro expression results of Process 1, Process 2, and Process 3 is shown.

[0062] Fig.11 A comparison of the protein residue detection results of Process 1 and Process 4 is shown.

[0063] Fig.12 The comparison of mRNA purity, capping rate, residual DNA, residual dsRNA and in vitro protein expression results between Process 3 and Process 5 is shown. DETAILED DESCRIPTION

[0064] The specific embodiments of the present invention will be described in detail below.

[0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide those of skill in the art with general definitions of many of the terms used in the present invention: Dictionary of Biochemistry and Molecular Biology, (2nd Edition) J. Stenesh (Ed.), Wiley-Interscience (1989); Dictionary of Microbiology and Molecular Biology (3rd Edition), P. Singleton and D. Sainsbury (Eds.), Wiley-Interscience (2007); Chambers Dictionary of Science and Technology (2nd Edition), P. Walker (Ed.), Chambers (2007); Glossary of Genetics (5th Edition), R. Rieger et al. (Eds.), Springer-Verlag (1991); and The HarperCollins Dictionary of Biology, WG Hall and JP Margham (Eds.), HarperCollins (1991).

[0066] The terms "one" or "an" used herein do not indicate a limitation of quantity, but rather indicate the presence of at least one of the related items. The terms "or" and "alternatively" do not mean exclusive, but rather refer to the presence of at least one of the mentioned items (e.g., components), and include situations where a combination of the mentioned items may exist. "Include," "comprises," "comprising," "having," or "containing," and similar words used in this application mean that in addition to the items listed thereafter and their equivalents, other items may also be within the scope.

[0067] Approximate terms in this application are used to modify quantity, indicating that the present invention is not limited to the specific quantity, and also include the correction part that is close to the quantity, acceptable, and will not cause the change of the relevant basic function. Accordingly, a numerical value is modified with "about", "approximately" and "about", meaning that the present invention is not limited to the exact value. In certain embodiments, the approximate terms may correspond to the precision of the instrument measuring the numerical value. The numerical range in the present invention can be merged and / or interchanged, and unless otherwise clearly stated, the numerical range includes the sub-range of all numerical values ​​it covers.

[0068] The term "messenger ribonucleic acid", also known as "messenger RNA" or "mRNA", is a type of single-stranded ribonucleic acid transcribed from a strand of DNA as a template, which carries genetic information and can guide protein synthesis. mRNA vaccines are mRNAs containing encoded antigenic proteins introduced into the human body, directly translated to form corresponding antigenic proteins, thereby inducing the body to produce specific immune responses and achieve the effect of preventive immunity. In this article, unless otherwise indicated, RNA molecules, mRNA molecules or mRNA vaccines have the same meaning. In some embodiments, "messenger ribonucleic acid", "messenger RNA" or "mRNA" includes functional nucleotide analogs. In some embodiments, functional nucleotide analogs include non-standard nucleobases. In some embodiments, standard nucleobases (e.g., adenine, guanine, uracil, thymine and cytosine) in nucleotides can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including but not limited to alkyl, aryl, halogen, oxo, hydroxyl, alkoxy and / or thio substitutions; one or more fused or opened rings, oxidations and / or reductions.

[0069] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), 4-thio-uracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho5U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromouracil), 3-methyluracil ... uracil (m3U), 5-methoxyuracil (mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyl uracil (mcm5U), 5-methoxycarbonylmethyl-2-thiouracil (mcm5s2U), 5-aminomethyl-2-thiouracil (nm5s2U), 5-methylaminomethyl-2-uracil (mnm5U), 5-methylaminomethyl-2-thiouracil (mnm5s2U), 5-methylaminomethyl-2-selenouracil (mnm5se2U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyluracil (cmnm5U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm5s2U) , 5-propynyl uracil, 1-propynyl-pseudouracil, 5-taurine methyl uracil (τm5U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thiouracil (τm5s2U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uracil (m5U, i.e., with the nucleobase deoxythymine), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (Et1ψ) and 5-methyl-2-thio-uracil (m5s2U). In some embodiments, the non-standard nucleobase of the functional nucleotide analog can independently be purine, pyrimidine, purine or pyrimidine analogs. For example, in some embodiments, the non-standard nucleobase can be a modified adenine, cytosine, guanine, uracil or hypoxanthine.In other embodiments, non-canonical nucleobases can also include, for example, naturally occurring and synthetic derivatives of bases, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-Thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogen, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5-triazine, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine and 1,3,5-triazine.

[0070] As described herein, 0% to 100% of all nucleotides of one type (e.g., all purine-containing nucleotides of one type in a payload nucleic acid molecule, or all pyrimidine-containing nucleotides of one type, or all A, G, C, T, or U) can be functional nucleotide analogs as described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10%% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70% , about 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100% or about 95% to about 100% are functional nucleotide analogs as described herein. In any of these embodiments, functional nucleotide analogs can be present in any position of a nucleic acid molecule, including 5'-end, 3'-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule may include different sugar modifications, different core base modifications and / or different types of nucleoside bonds (such as backbone structures).

[0071] The term "isolated" or "purified" refers to a substance that is substantially or essentially free of components that normally accompany the substance in its natural or original state. Thus, isolated mRNA molecules according to the present disclosure are preferably free of substances that are normally associated with the mRNA molecules in their natural or original environment. A compound or entity is considered isolated or purified when it is removed from substantially all other compounds or entities, i.e., preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% pure. In some embodiments, the mRNA molecules isolated by the methods of the present disclosure include less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1% of impurities other than full-length mRNA molecules. Impurities include IVT contaminants, such as proteins, enzymes, free nucleotides and / or short polymers. In some embodiments, mRNA molecules prepared according to the present invention are substantially free of short polymers or abortive transcripts.

[0072] Any method known in the art can be used to detect and quantify the full length or invalid transcripts of mRNA. In some embodiments, the mRNA molecules separated are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectrum, ultraviolet (UV) or UPLC or its combination. Other detection methods known in the art are included in the present invention. In some embodiments, mRNA molecules are detected by capillary electrophoresis separation using UV absorption spectroscopy. In some embodiments, before gel electrophoresis ("glyoxal gel electrophoresis"), mRNA is denatured by glyoxal dye. In some embodiments, the synthesized mRNA is characterized before capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.

[0073] The term "plasmid" refers to a genetic construct consisting of genetic material (i.e., nucleic acid). Typically, a plasmid contains a replication origin that is functional in a bacterial host cell, such as E. coli, and a selectable marker for detecting a bacterial host cell containing the plasmid. In the present disclosure, a plasmid may include one or more genetic elements that are configured so that an inserted coding sequence can be transcribed and translated in a suitable expression cell. In addition, the plasmid may include one or more nucleic acid segments, genes, promoters, enhancers, activators, multiple cloning regions, or any combination thereof, including segments obtained or derived from one or more natural and / or artificial sources.

[0074] The term "LiCl method", also known as "LiCl precipitation", refers to a method of selectively precipitating RNA using high concentrations of lithium cations. Synthesized RNA is usually added to a high concentration LiCl solution and incubated at -20°C, and then centrifuged at 4°C at high speed, such as 12000-15000g, to precipitate mRNA for purification. The LiCl method is a conventional method in the art for purifying mRNA.

[0075] The term "magnetic particles" is defined herein as particles that can be attracted by a magnetic field. At the same time, the magnetic particles used in the method of the present disclosure should not aggregate in the absence of a magnetic field. In other words, the behavior of the magnetic particles should be similar to that of superparamagnetic particles. The magnetic particles can have any symmetrical shape, such as a sphere or a cube, or any asymmetric shape. Spherical magnetic particles are generally referred to as magnetic beads. It should be understood that the terms "magnetic particles" and "magnetic beads" are used interchangeably herein without limiting the scope to magnetic particles with a spherical shape. The volume-weighted median diameter (d50,v) of the magnetic particles suitable for the method of the present disclosure can be in the range of 10nm-100μm, such as 10nm, 20nm, 100nm, 1μm, 2μm, 10μm, 15μm, 20μm, 25μm, 30μm, 35μm, 50μm, 60μm, 70μm, 80μm, 90μm, 95μm or 100μm. Preferably, the volume weighted median diameter (d50,v) of the magnetic particles or the particle size of the magnetic beads is between 20 nm and 5 μm. Generally, the smaller the diameter of the magnetic particles, the larger the overall contact surface area. It should be understood that the diameter of the magnetic particles is not limited to this range, which depends on factors such as the type, concentration, volume of the biomolecules to be separated and the separation system.

[0076] The magnetic particles contain ligands that can bind to biomolecules. The ligands can be covalently coupled to the surface or the interior of the magnetic particles. It should be understood that the type of ligand and its affinity constant k for the biomolecule off / k on Select based on the type of biomolecule to be separated. In one embodiment, the ligand is a carboxyl group. In addition, it should be understood that the concentration of one or more ligands of each magnetic particle depends on the concentration of the biomolecule to be separated, the size of the magnetic particles and / or the total volume of the magnetic particles added to the magnetic separator. In a preferred embodiment of the present disclosure, the magnetic particles used in the method for separating mRNA molecules are carboxyl magnetic beads.

[0077] The terms "magnetic bead method" and "magnetic particle method" used herein are used interchangeably and refer to a method of purifying biological molecules, such as mRNA molecules, using magnetic particles or magnetic beads.

[0078] The term "magnetic separator" has its conventional meaning in the field of separation methods and refers to a device for separating magnetic particles from a fluid. In a preferred embodiment of the present disclosure, the magnetic separator used in the method for separating biomolecules is a high gradient magnetic separator, or a high gradient magnetic separation system (HGMS). The magnetic separator is configured to separate the magnetic particles with bound mRNA molecules from the rest of the feed. The magnetic separator contains a component of magnetic or magnetizable material inside that attracts the magnetic particles when a magnetic field is applied.

[0079] The term "affinity chromatography" is a chromatographic method that uses the binding properties of a stationary phase to separate molecules. Molecules that have a certain binding ability to the substance to be separated are connected to the affinity chromatography filler, and their binding is reversible. The two can be separated from each other when the mobile phase conditions are changed. The most notable structural feature of eukaryotic mRNA is that it has a cap at the 5' end and a Poly (A) tail at the 3' end. This structure provides an extremely convenient selection marker for the purification of eukaryotic mRNA. Affinity chromatography for separating mRNA usually uses oligo (dT) to complement the Poly (A) tail to capture mRNA. In a preferred embodiment of the present disclosure, the affinity chromatography used in the method for separating mRNA molecules uses Oligo (dT) 25 Affinity filler.

[0080] In one embodiment, the affinity chromatography used in the method for isolating mRNA molecules is operated in a positive pressure mode. The so-called "positive pressure" or "negative pressure" refers to the pressure state in the closed container of the chromatography system. The state when the pressure in the closed container is greater than the atmospheric pressure is called positive pressure, and the state when the pressure is less than the atmospheric pressure is called negative pressure. Positive pressure is the use of pressurized gas (compressed air or nitrogen) to allow the solution to enter the solid phase extraction column at a controllable flow rate for related operations; negative pressure is to use a pump to extract air from the instrument and allow the solution to flow through the solid phase extraction column for related operations.

[0081] The term "in vitro transcription", also known as "IVT", refers to the process of generating RNA in an in vitro cell-free system using DNA as a template to mimic the in vivo transcription process. In vitro transcription usually uses DNA containing T7, T3 or SP6 promoter sequences as a template, and synthesizes RNA complementary to one strand of the template DNA with NTP or modified bases as substrates in the presence of T7, T3 or SP6 RNA polymerase, respectively, to generate a large number of RNA molecules in a cell-free environment. Prior to in vitro transcription, the DNA template is usually obtained through 1) Escherichia coli fermentation to amplify the DNA, purify the DNA, and linearize the plasmid DNA, or 2) enzymatic amplification and purification of the DNA transcription region fragment.

[0082] During or after in vitro transcription, the resulting mRNA molecule may optionally be subjected to 5' capping and / or 3' tailing. The presence of a cap can provide resistance to nucleases found in most eukaryotic cells. The presence of a "tail" can be used to protect mRNA from exonuclease degradation and / or to regulate protein expression levels. Capping and tailing techniques are well known to those skilled in the art. In some embodiments, mRNA is purified before capping and tailing. In some embodiments, mRNA is purified after capping and tailing. In some embodiments, mRNA is purified before and after capping and tailing. In some embodiments, mRNA is purified before or after or before and after capping and tailing by the LiCl method. In some embodiments, mRNA is purified before or after or before and after capping and tailing by a magnetic particle method. In some embodiments, mRNA is purified before or after or before and after capping and tailing by chromatography.

[0083] In some embodiments, capping and / or tailing is performed simultaneously with transcription. Therefore, the mRNA can also be purified after the IVT step is completed, and the purification method is as described above. In some embodiments, the mRNA molecules are purified after tailing. In some embodiments, the mRNA molecules are purified before capping. In some embodiments, the mRNA is purified after in vitro transcription.

[0084] The term "module" refers to a hardware or software unit composed of one or more basic functional units, which may also be referred to as a device or program. Modules are usually named after their function or purpose, and include any hardware or software necessary to achieve the desired function. For example, a purification module is composed of one or more devices for achieving the purpose of purification, while a control module contains a control program and hardware configured to execute the program, such as a processor, storage, memory, disk, etc. It should be understood that those skilled in the art are familiar with the meaning and components of "module" and can easily configure the various modules used in the methods and systems of the present invention after reading the contents of this disclosure. Exemplary configurations of modules are described in more detail below.

[0085] The term "automation" refers to the process of manipulating a device in a production operation in an automatic control or automatic adjustment mode according to a predetermined pattern. As the name implies, the term "semi-automation" refers to an automated mode of automatically performing a work cycle under human intervention. Automation, semi-automation or manual methods are choices made based on a comprehensive consideration of factors such as operating conditions and cost-benefit ratio, and are within the expected scope of the present invention. For example, by the method and system of the present invention, 168 mRNA samples (mg level) can be processed within 24h in an automated manner, while by manual means, 1 manual person can process 24 mRNA samples (mg level) in 5 days. In a preferred embodiment, the method or system according to the present invention is operated in an automated manner.

[0086] Figure 1 An exemplary flow chart of a method for isolating mRNA molecules according to the present invention is shown. First, an in vitro transcription (IVT) reaction is performed on a linearized DNA template. The transcription template is usually obtained by 1) Escherichia coli fermentation to amplify DNA, DNA purification, linearization of plasmid DNA, or 2) enzymatic amplification and purification of DNA transcription region fragments. In addition to the DNA template, the in vitro transcription system also includes reagents such as nucleoside triphosphate (NTP) substrates, RNA polymerase, inorganic pyrophosphatase, RNase inhibitors, etc. Optionally, the IVT reagent also includes one or more of 5'-cap analogs, capping enzymes, Poly (A) polymerases, DNases, proteinase K, etc. 5' capping and / or 3' tailing can be performed in the IVT reaction or as a separate step after transcription. Strict control of DNA residues is required during the mRNA production process. DNase treatment can hydrolyze the DNA template, and proteinase K treatment can degrade proteins, thereby facilitating subsequent purification. Depending on the reaction volume, IVT can be performed in any suitable container, such as a 24-well plate, a 96-well plate, a microcentrifuge tube, etc.

[0087] After the IVT incubation reaction, primary purification is performed by magnetic bead method. Magnetic beads containing ligands capable of binding to mRNA molecules are provided, preferably carboxyl magnetic beads. The magnetic beads bind to mRNA by means of salt bridges, and adsorb RNA by forming an ion bridge of RNA-salt ions-carboxyl groups in a purification buffer system containing PEG, high salt ions, etc. This binding is reversible, and the ion bridge is released in a TE buffer without PEG and salt ions, thereby eluting RNA molecules.

[0088] The IVT-incubated solution is brought into contact with the magnetic beads to obtain magnetic beads containing bound mRNA molecules, and the magnetic beads are separated using a magnetic field; the mRNA molecules are eluted from the separated magnetic beads to obtain a primary purified mRNA solution.

[0089] The primary purified mRNA solution after the IVT reaction is quantified. Any method known in the art can be used to detect and quantify mRNA molecules. Preferably, a commercially available RNA quantification kit is used, such as the Agilent RNA 6000 Nano Kit (#5067-1511). Based on the quantitative results, a capping and / or tailing solution is prepared and further incubated. After this step, the full-length product of the mRNA is obtained, including the 5' cap structure and the 3' poly (A) tail.

[0090] Next, secondary purification is performed by affinity chromatography. Since intact mRNA contains a 3' poly(A) tail, an affinity filler (e.g., POROS TM Oligo(dT) 25 Affinity filler, etc.) captures mRNA by complementary pairing with the Poly(A) tail, thereby purifying the mRNA. In this step, affinity chromatography is performed in a positive pressure mode to elute the mRNA molecules and obtain a secondary purified mRNA solution.

[0091] If IVT uses a co-transcription method, that is, the transcription directly obtains a full-length mRNA product, which includes a 5' cap structure and a 3' poly (A) tail, the full-length mRNA transcript can be directly obtained by primary purification after the IVT incubation reaction is completed, and then secondary purification is performed by affinity chromatography. In an optional embodiment, the DNA template is directly secondary purified by affinity chromatography after IVT co-transcription.

[0092] The mRNA solution at this time has reached a fairly high purity, and the main purpose of replacing the solution and concentrating it is to adjust the mRNA concentration in the stock solution and replace the buffer system. The solution replacement and concentration can be carried out by the LiCl method or the magnetic bead method. For the magnetic bead method, the same or different system or device as the primary purification can be used. In order to save equipment or procedures, it is preferably carried out using the same magnetic bead separation device as the primary purification.

[0093] The concentrated mRNA after liquid exchange is formulated into a formula stock solution suitable for cryopreservation, and then sterilized and filtered and aseptically packaged into containers suitable for cryopreservation.

[0094] It should be understood that the process schemes described above are merely exemplary. Not all processes and devices are necessary for the method and system of the present invention. The scope of protection of the present invention is defined by the appended claims. The following examples are included to provide additional guidance to those of ordinary skill in the art for implementing the claimed invention. These examples do not limit the invention defined in the appended claims.

[0095] Example

[0096] Example 1: Experimental Materials and Methods

[0097] 1.1 DNA linearization

[0098] The DNA plasmid template was linearized using restriction enzyme digestion. Each 10 μg of plasmid was mixed with 10UEsp3I / BsmBI and incubated at 37°C for 4 hours to ensure complete linearization. 1 / 10 volume of 3M sodium acetate (pH 5.5) and 2.5 volumes of ethanol were added to terminate the reaction, mixed thoroughly and cooled at -20°C for 1h. At 4°C, the linearized DNA was precipitated by centrifugation at 13800g for 15 minutes, washed twice with 70% ethanol, and resuspended in nuclease-free water.

[0099] 1.2IVT

[0100] System for 20 μL reaction mixture:

[0101]

[0102]

[0103] The reaction mixture was incubated at 37°C for 6 hours, and then 1 μL of DNaseI (RNase-free, 1 U / μL) was added to remove the DNA template and incubated at 37°C for 30 minutes.

[0104] 1.3 LiCl method

[0105] The synthesized RNA was purified by adding 0.5 volumes of 7.5 M LiCl, 50 mM EDTA and incubating at -20 °C for 45 min, followed by centrifugation at 13800 g for 15 min at 4 °C to precipitate the mRNA. The supernatant was then removed, and the precipitate was rinsed twice with pre-cooled 70% ethanol, and the mRNA was resuspended in nuclease-free H2O and stored at -20 °C.

[0106] 1.4 Capping

[0107] Each 10 μg of uncapped mRNA was heated at 65°C for 10 min, placed on ice for 5 min, and then mixed with 10U Capcinia capping enzyme, 50U mRNA Cap2'-O-methyltransferase, 0.2mM SAM, 0.5mM GTP, and 1U RNase inhibitor and incubated at 37°C for 60 min to generate cap1 modified structures.

[0108] 1.5 Affinity chromatography

[0109] Using Oligo(dT) 25Affinity filler, purified by solid phase extraction instrument (positive or negative pressure). Equilibration / loading buffer: 10mM Tris-HCl, 500mM NaCl, 1mM EDTA, pH 7.4. Washing buffer: 10mM Tris-HCl, 100-300mM NaCl, 1mM EDTA, pH 7.4. Elution buffer: 10mM Tris-HCl, 1mM EDTA, pH 7.4 or directly eluted with water.

[0110] 1.6 Quantitative detection

[0111] Aglient's Bioanalyzer RNA Kit and Reagents (Agilent RNA 6000 Nano Kit, #5067-1511) or Fragment Analyzer System RNA Kit (RNA Kit (15NT), #DNF-471-0500) were used.

[0112] 1.7 Capping Rate Detection

[0113] The capping rate was detected using RNase H enzyme, streptavidin magnetic beads and LC-MS. A biotin-TEG labeled probe was designed at the 5' end of the mRNA. After RNase H enzyme cleavage and magnetic bead treatment, a short 5' end nucleotide fragment with or without a cap structure was obtained. LC-MS was used for detection and quantitative analysis of the proportion of each component to obtain the capping rate.

[0114] 1.8 Magnetic bead purification

[0115] Use carboxyl magnetic beads for purification, bind the sample to the carboxyl magnetic beads, transfer the beads using a magnetic rack, wash with 50% to 80% ethanol, and finally add nuclease-free water for elution.

[0116] 1.9 Physical and chemical properties testing

[0117] The mRNA samples were tested for DNA residue using a plasmid DNA residue detection kit (PCR-fluorescent probe method). The mRNA samples were tested for total protein residue using a Nano OrangeTM kit. The mRNA samples were tested for dsRNA residue using a Double-stranded-RNA (dsRNA) kit.

[0118] 1.10 In vitro testing

[0119] 1.10.1 In vitro IFN-β detection

[0120] BJ fibroblasts were purchased from ATCC. L-glutamine and 10% heat-inactivated fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) were added to EMEM medium. Cells were seeded in 96-well flat-bottom cell culture plates (Corning) at 20,000 cells per well and transfected 24 hours later. mRNA was transfected using Lipofectamine 2000 (Thermo Fisher Scientific). Cell culture supernatants were collected 48 hours after transfection and the expression of IFN-β was analyzed using an ELISA kit (R&D System).

[0121] 1.10.2 Cellular activity

[0122] BJ fibroblasts were purchased from ATCC. L-glutamine and 10% heat-inactivated fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) were added to EMEM medium. 20,000 cells were seeded per well in a 96-well flat-bottom cell culture plate (Corning) and transfected 24 hours later. mRNA was transfected using Lipofectamine 2000 (Thermo Fisher Scientific). 100 ul Cell Titer- Luminescent cell viability reagent (Promega), and chemiluminescent signals were detected using a microplate reader (MD).

[0123] 1.10.3 Cytotoxicity assay

[0124] C2C12 mouse muscle cells (C2C12) were purchased from ATCC. 10% heat-inactivated fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to DMEM medium. 5000-10000 cells were seeded in 96-well flat-bottom cell culture plates (Corning) per well and cultured for 24 hours. 50ul of magnetic beads of different dilutions and magnetic beads of different dilutions containing Lipofectamine 2000 (Thermo Fisher Scientific) were added. At the same time, non-transfected cells were used as controls. After 72 hours of culture, 100ul Cell Luminescent cell viability reagent (Promega), chemiluminescent signal was detected using an ELISA reader (MD). Inhibition rate (%) = 100%*[(control well reading - experimental well reading) / (control well reading - blank well reading)].

[0125] 1.10.4 In vitro expression detection - HEK293T analysis

[0126] Human embryonic kidney cells (HEK293T) were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai. 10% fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to the DMEM medium. The cells were seeded in a 96-well flat-bottom cell culture plate (Corning) at 20,000 cells per well and transfected 24 hours later. Lipofectamine 2000 (Thermo Fisher Scientific) was used to mix with mRNA encoding green fluorescent protein (eGFP) and then transfected into the cells. After 24 hours of transfection, the expression of eGFP protein was analyzed using a microplate reader.

[0127] Human embryonic kidney cells (HEK293T) were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai. 10% fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to the DMEM medium. The cells were seeded in a 96-well flat-bottom cell culture plate (Corning) at 20,000 cells per well and transfected 24 hours later. HEK293T cells were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) and mRNA encoding luciferase (Luc). After 24 hours of transfection, 100ul of luciferase reporter gene detection reagent (Novagen) was added and the expression of Luc protein was analyzed using a microplate reader.

[0128] Human embryonic kidney cells (HEK293T) were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai. 10% heat-inactivated fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to the DMEM medium. The cells were seeded in a 6-well flat-bottom cell culture plate (Corning) at 80,000 cells per well and transfected 24 hours later. HEK293T cells were transfected with mRNA encoding the SARS-CoV-2 spike protein receptor binding domain (S-RBD) using Lipofectamine 2000 (ThermoFisher Scientific). Cell culture supernatants were collected 18 to 24 hours after transfection, and the expression of RBD protein was analyzed using an ELISA kit (Sino-Bio).

[0129] Human embryonic kidney cells (HEK293T) were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai. 10% heat-inactivated fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to the DMEM medium. After the cells grew to ≥80% confluence, mRNA encoding influenza virus H1N1HA or H3N2HA protein was transfected into HEK293T cells using Lipofectamine Messenger MAX reagent (ThermoFisherScientific). Cell culture supernatants were collected 18 to 24 hours after transfection and treated with H1N1HA primary antibody working solution (Sino Biological, #11055-MM04T) or H3N2HA primary antibody working solution (Sino Biological, #11055-MM03) and secondary antibody working solution (Jackson immune Research, #115-095-164), and then analyzed on a flow cytometer (BD, LSRFortessa).

[0130] 1.10.5 In vitro expression detection - A549 analysis

[0131] Human lung cancer cells (A549) were purchased from ATCC and supplemented with 10% fetal bovine serum (Gibco-FBS) (Life Technologies, Thermo Fisher). The cells were seeded in 96-well flat-bottom cell culture plates (Corning) at 20,000 cells per well and transfected 24 hours later. Lipofectamine 2000 (Thermo Fisher Scientific) was used to mix with mRNA encoding green fluorescent protein (eGFP) and transfect the cells. After 24 hours of transfection, the expression of eGFP protein was analyzed using a microplate reader.

[0132] Human lung cancer cells (A549) were purchased from ATCC and supplemented with 10% fetal bovine serum (Gibco-FBS) (Life Technologies, Thermo Fisher) in F-12K medium. The cells were seeded in 96-well flat-bottom cell culture plates (Corning) at 20,000 cells per well and transfected 24 hours later. Lipofectamine 2000 (Thermo Fisher Scientific) was used to mix with mRNA encoding luciferase (Luc) and transfect the cells. After 24 hours of transfection, 100ul of luciferase reporter gene detection reagent (Novagen) was added and the expression of Luc protein was analyzed using a microplate reader.

[0133] Human lung cancer cells (A549) were purchased from ATCC, and 10% fetal bovine serum (Gibco-FBS) (Life Technologies, Thermofisher) was added to F-12K medium. The cells were seeded in 96-well flat-bottom cell culture plates (Corning) at 20,000 cells per well and transfected 24 hours later. The cells were transfected by mixing with mRNA encoding the SARS-CoV-2 spike protein receptor binding domain (S-RBD) using Lipofectamine 2000 (Thermo Fisher Scientific). The cell culture supernatant was collected 18 to 24 hours after transfection, and the expression of RBD protein was analyzed using an ELISA kit (Sino-Bio).

[0134] 1.11 Hematology and blood biochemistry tests

[0135] Hematology: Hematology samples were measured using a whole blood automatic analyzer (Sysmex xs-800i) and its supporting reagents.

[0136]

[0137] Blood biochemistry was measured using a fully automatic biochemical detector (Hitachi 7060).

[0138]

[0139] Example 2: Comparison of LiCl method and magnetic bead method

[0140] Using sample 1, Figure 2 The experimental scheme shown in sub-figure A in the figure is used for the LiCl method and the magnetic bead method respectively. The purity test results of the IVT reaction solution after LiCl and magnetic bead purification before capping are shown in Figure 2 As shown in sub-figure B in the figure, the purity of the two methods is basically the same, and the yield of magnetic bead purification is 88.4% of LiCl.

[0141] The IVT samples purified by LiCl and magnetic beads were capped (same magnitude) respectively. The capping purity was basically the same, but the capping rate of magnetic bead purification was higher than that of LiCl method. Figure 2 As shown in sub-figure C in Figure 1, this shows that the magnetic bead method has certain advantages over the LiCl method.

[0142] Example 3: Analysis of impurities introduced by magnetic bead method

[0143] After positive pressure affinity chromatography, sample 2 was concentrated and replaced by magnetic beads. IVT, LiCl purification, capping and positive pressure affinity chromatography were performed. After affinity chromatography, magnetic beads were used for concentration and replacement, and bottom suction was increased to remove residual magnetic beads. The sample was then filtered with a 0.22 μm membrane. The sterilization filtration also played a secondary role in removing magnetic beads (process 3). Processes 1 and 2 were also performed for comparison. ICP-MS was used to detect the Fe element to evaluate the residual magnetic beads, and cell activity and in vitro innate immunity were detected. At the same time, the cytotoxicity of magnetic beads was detected in BC2C12 mouse muscle cells. The specific test results are shown in Tables 1 and Figure 3 .

[0144] Process 1: Same as process 3, except that ultrafiltration is used instead of magnetic beads for liquid concentration.

[0145] Process 2: Add 0.02 mg of magnetic beads to the sample obtained in process 1 (magnetic bead concentration 0.01 mg / mL)

[0146] Process 3: Positive pressure affinity chromatography followed by magnetic bead-based concentration

[0147] Table 1: Fe elements detected by ICP-MS

[0148]

[0149] According to the results of Fe element, the magnetic beads were concentrated by changing the liquid after positive pressure affinity chromatography, and the residual magnetic beads were less than 0.01mg / ml. Cytotoxicity test of magnetic beads in BC2C12 mouse muscle cells (see Figure 3 Sub-figure C) in the figure shows that the current residual amount of magnetic beads is basically non-toxic to cells.

[0150] At the same time, in order to investigate whether the introduced impurities have any effect on the mice, a certain amount of magnetic beads (200 μL) was injected into the mice through the tail vein, and blood was collected one day later. A group of mice (0.05 μg) was retained until the 8th day for a second blood collection to test hematology and blood biochemistry. The results are as follows Figure 4 Subgraphs A and B in .

[0151] The results showed that even the highest dose of 0.5 μg had low toxicity to animals. On the 8th day (0.05 μg), all indicators were found to have recovered.

[0152] Example 4: Negative pressure affinity chromatography

[0153] When affinity chromatography was performed under negative pressure, it was found that the chromatography filler was deformed due to the instantaneous force of negative pressure, and the yield was lower than that of positive pressure affinity chromatography. Figure 5 shown.

[0154] Example 5: Comparative Experiment

[0155] Samples 3, 4, 1 and 5 were selected, and two linearized plasmids with / without Poly(A) were prepared respectively. The linearized plasmids were composed in a ratio of 8:2 for IVT. The LiCl method and the magnetic bead method were selected for purification 1. The uncapped product was capped and purified by the LiCl method, the magnetic bead method and the positive pressure affinity chromatography + magnetic bead method 2. The specific process was as follows Figure 6 The samples were tested for mRNA purity (FA purity) based on Agilent Fragment Analyzer, and the capping rate, protein residue, etc. were tested. Samples 3 and 4 were selected for in vitro expression in HEK293T cells, and samples 3, 4, 1, and 5 were tested for in vitro expression in A549 cells. The results are as follows:

[0156] For FA purity, Scheme 3 is higher than Scheme 1 and Scheme 2, such as Figure 7 As shown in the figure, the capping rates are similar, all above 99%. Figure 8 The protein detection results show that process 2 is significantly higher than process 1 and process 3, and process 3 is the lowest, as shown in Fig. 9 shown.

[0157] The in vitro expression results showed that process 3 was superior to process 1 and process 2. Fig.10 shown.

[0158] Sample 6 was used to prepare mRNA. After IVT, the LiCl method was selected for purification 1. The uncapped product was capped and purified by the LiCl method and affinity chromatography 2. Affinity chromatography used a gravity column, which used gravity to make the sample and buffer drip naturally without applying additional pressure. After affinity chromatography, the ultrafiltration tube was replaced. The specific process was as follows Figure 6 The samples were tested for protein residues and it was found that compared with process 1, process 4 had a poor protein removal effect, see Fig.11 .

[0159] Samples 7, 8 and 9 were used to conduct a comparative experiment of processes 3 and 5, where samples 7-1, 8-1 and 9-1 were prepared according to process 5, and samples 7-2, 8-2 and 9-2 were prepared according to process 3 (automated process). The obtained mRNA stock solution was subjected to relevant tests (including purity, capping rate, DNA residue, dsRNA residue), innate immunity (INF-β) and in vitro protein expression. The results are as follows Fig.12 and Table 2.

[0160] Table 2: Physicochemical properties (purity, capping rate, residual DNA, residual dsRNA) and innate immunity (INF-β) results of the three samples

[0161]

[0162] The test results showed that the purity, capping rate, DNA residue and dsRNA residue of mRNA were basically consistent, with no significant difference. The DNA and dsRNA residues in process 3 were relatively lower. Fig.12 As shown in sub-figure A. The innate immunity (INF-β) was below the detection line, as shown in Table 2. The in vitro expression of the three samples was not much different, and there was no significant difference, as shown in Fig.12 As shown in sub-figures B, C and D of

[0163] Although the present invention has been described in conjunction with specific embodiments, it will be appreciated by those skilled in the art that many modifications and variations may be made to the present invention. Therefore, it will be appreciated that the intent of the claims is to cover all such modifications and variations within the true concept and scope of the present invention.

[0164] Sequence information:

[0165] Sample 1 (coding protein: COVID-19 delta variant RBD): SEQ ID NO: 1

[0166]

[0167] Sample 2 (coding protein: Epo): SEQ ID NO: 2

[0168] GGGGGGAUCCGAGGACAGGGCCAGAGCCAUCUAUGUCAUACAUUUGCUUACUGACACAACUGUGUUCACUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACCAUGGGGGUGCACGAAUGUCCUGCUUCCUUCCUUGGCCUCCUCUGGGCCUCCACUUGGGCGCCCACCACGCCUCAUCUGUGGACAUCCUCUUGGACAGCGAGGGUACCUCUUGGAGAUGGCCAAGGGGCUGUCUGAACCAUGCACUUGGAAUAUCACUGUCAUGGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAGGUGGCGGCAGCCAGGCCGUAGACCUUGCUCGCUUGCGGAAGCUCUGCCGGGGCCAGGCCCUUGCUUGCUCGGAAGCUCUGCGGGCCCUGCUUGCUCGGAAGCUGCCGGGGCCCUGCUUGCUUGCAGUUGGAAUAAAGCCGUCAGUG GCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGAUGAUAAAAAUCGCUCGCUUUCUCUGCCAAUUUUUAAUAAGGUUC CUUUGUCCCCUAAGUCCAACUACUAACUGGGGGAUAUAUGAAGGGCCUUGAGCAUCUGGAUCUGCCUAAUAAAAAAACAUUUAUUUUCAUUGCAUGUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0169] Sample 3 (encoding protein: eGFP): SEQ ID NO: 3

[0170]

[0171] Sample 4 (coding protein: Luc): SEQ ID NO: 4

[0172]

[0173] Sample 5 (coding protein: SARS-CoV-2 RBD): SEQ ID NO: 5

[0174]

[0175] Sample 6 (encoding protein: mouse IL-12): SEQ ID NO: 6

[0176]

[0177] Sample 7 (encoding protein: H1N1HA, U100% in the sequence is modified with N1-methylpseudouridine (M1ψ)): SEQ ID NO: 7

[0178]

[0179] Sample 8 (encoding protein: H3N2HA, U100% in the sequence is modified with N1-methylpseudouridine (M1ψ)): SEQ ID NO: 8

[0180]

[0181] Sample 9 (encoding protein: SARS-CoV-2 BA.4 / 5RBD, U100% in the sequence is modified with N1-methylpseudouridine (M1ψ)): SEQ ID NO: 9

[0182]

Claims

1. A method for isolating mRNA molecules, comprising the following steps: (a) providing magnetic particles comprising a ligand capable of binding to an mRNA molecule; (b) contacting a solution containing mRNA molecules with the magnetic particles to obtain magnetic particles containing bound mRNA molecules; (c) separating the magnetic particles containing the bound mRNA molecules using a magnetic field; (d) eluting the mRNA molecules from the separated magnetic particles to obtain a primarily purified solution containing mRNA molecules; and (e) loading the solution containing mRNA molecules obtained in step (d) onto an affinity chromatography containing oligo(dT), eluting the mRNA molecules by positive pressure, and obtaining a secondary purified solution containing mRNA molecules.

2. The method according to claim 1, further comprising the step of in vitro transcribing the DNA to generate a solution containing mRNA molecules before step (b).

3. The method according to claim 1, further comprising the step of capping and / or tailing the mRNA molecule before step (e).

4. The method according to claim 1, further comprising the step of replacing the secondary purified solution containing the mRNA molecule with a concentrated solution after step (e). The method according to claim 4 , wherein the step of replacing the solution and concentrating the solution is performed by a LiCl method or a magnetic particle method.

6. The method of claim 5, wherein the magnetic particle method comprises repeating steps (a)-(d).

7. The method according to any one of claims 1 to 6, wherein the method is performed in an automated, semi-automated or manual manner.

8. A method for isolating mRNA molecules, comprising the steps of: (a) providing magnetic particles comprising a ligand capable of binding to an mRNA molecule; (b) performing in vitro transcription on the DNA to generate a solution containing mRNA molecules; (c) contacting a solution containing mRNA molecules with the magnetic particles to obtain magnetic particles containing bound mRNA molecules; (d) separating the magnetic particles containing the bound mRNA molecules using a magnetic field; (e) eluting the mRNA molecules from the separated magnetic particles to obtain a primary purified solution containing mRNA molecules; (f) optionally, capping the mRNA molecules obtained in step (e) to obtain a solution containing capped mRNA molecules; (g) loading the solution containing mRNA molecules obtained in step (e) or (f) onto an affinity chromatography containing oligo(dT), eluting the mRNA molecules under positive pressure to obtain a secondary purified solution containing mRNA molecules; and (h) performing liquid replacement, concentration and sterilization filtration on the solution containing the mRNA molecules obtained in step (g).

9. The method of claim 8, wherein step (f) further comprises tailing the mRNA molecule.

10. The method according to claim 8, wherein the liquid exchange concentration in step (h) is performed by a magnetic particle method.

11. The method according to any one of claims 8 to 10, wherein the method is performed in an automated manner.

12. The method according to any one of claims 1-11, wherein the mRNA molecule comprises one or more functional nucleotide analogs.

13. The method according to claim 12, wherein the functional nucleotide analogues are one or more selected from the group consisting of pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine.

14. A system for isolating mRNA molecules, comprising: A purification module 1, comprising magnetic particles, wherein the magnetic particles contain ligands capable of binding to mRNA molecules; A purification module 2, comprising an affinity chromatography column, wherein the affinity chromatography column can be operated in a positive pressure mode; and A fluid module, comprising a container for containing a solution containing mRNA, wherein the fluid module can be in fluid communication with purification module 1 and purification module 2.

15. The system according to claim 14, further comprising a feeding module for providing a source of mRNA molecules, and a collecting module for collecting mRNA molecules.

16. The system of claim 14, wherein the fluid module further comprises a liquid transfer device.

17. The system of claim 16, wherein the liquid transfer device is a pipette, a transfer pipette, or a mobile workstation.

18. The system of claim 14, wherein the fluid module further comprises a conduit that facilitates fluid communication among purification module 1, purification module 2, and the fluid module.

19. The system according to claim 14, wherein the purification module 1 comprises a magnetic separator.

20. The system of claim 14, wherein the purification module 1 comprises a magnetic field.

21. The system of claim 14, wherein the fluid module further comprises a container for containing an elution solution for eluting mRNA from the magnetic particles, and a container for containing an elution solution for eluting mRNA from the affinity chromatography column.

22. The system of claim 14, wherein the fluid module further comprises a container for containing a washing solution for washing the magnetic particles, and a container for containing a washing solution for washing the affinity chromatography column.

23. The system of claim 14, further comprising additional modules, including but not limited to means for: The DNA is transcribed in vitro to generate a solution containing mRNA molecules; Capping and / or tailing mRNA molecules; replacing and concentrating the solution containing the mRNA molecule; and / or The solution containing the mRNA molecules is sterile filtered.

24. The system of claim 23, wherein the fluid exchange concentration is performed by a LiCl method or a magnetic particle method.

25. The system according to claim 24, wherein the module for performing liquid exchange concentration is the same as or different from the purification module 1.

26. The system of any one of claims 14-25, wherein the system operates in an automated, semi-automated, or manual manner.

27. The system according to claim 26, wherein the system further comprises a control module configured to control the various modules of the system to operate in an automated or semi-automated manner.

28. The system of any one of claims 14-27, wherein the mRNA molecule comprises one or more functional nucleotide analogs.

29. The system of claim 28, wherein the functional nucleotide analogs are one or more selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.

Images