Tea tree gene CsCIP1 flowering delaying function and application thereof

Abstract

The invention belongs to the technical field of tea cultivation, and particularly relates to a flowering delaying function of a tea tree gene CsCIP1 and application of the tea tree gene CsCIP1. According to the invention, a sequence CsTGY12G0001995 homologous with the AtCIP1 gene of Arabidopsis thaliana is found in a tea tree, and the sequence CsTGY12G0001995 is named as CsCIP1. After the gene is overexpressed in arabidopsis thaliana, the flowering time of a transgenic plant is later than that of a wild plant, which proves that the gene has the function of delaying flowering and provides a candidate gene for directionally cultivating a flowering-delayed tea tree variety. The tea tree gene CsCIP1 and the flowering delaying function analysis of the tea tree gene CsCIP1 are beneficial to providing important gene resources and powerful theoretical support for improving tea tree varieties in agricultural production, and have wide application value.

Description

Technical Field

[0001] The invention belongs to the technical field of tea cultivation, and in particular relates to a function of delayed flowering of a tea tree gene CsCIP1 and an application thereof. Background Art

[0002] Tea (Camellia sinensis) is an important leaf-based economic crop, with the main purpose of picking fresh leaves. The yield and quality of tea are closely related to economic benefits, especially the quality and yield of spring tea, which will directly affect the annual tea output value. Therefore, it is necessary to inhibit reproductive growth and promote vegetative growth. As a perennial woody plant, the vegetative growth and reproductive growth of tea trees are carried out alternately. Tea trees have the characteristics of many flowers and long flowering periods. The reproductive growth of tea trees will absorb a large amount of nutrients, thereby inhibiting the vegetative growth of tea trees and affecting the yield and quality of tea. Du Sijia et al. found that a large amount of flowering will lead to changes in the content of sugar substances and delay the germination of new shoots in the next year (Du Sijia. The influence and mechanism of tea tree reproductive growth on the formation of tea quality components. Fujian Agriculture and Forestry University, 2023.). Chen Dongmei et al.'s research pointed out that the types and proportions of amino acids in tea flowers and leaves are relatively similar, and a large number of flowers will affect the amino acid content of tea to a certain extent, thereby affecting the quality of tea (Chen Dongmei, Fan Weiwei, He Jinwu. Comparative analysis of amino acid content of Hainan tea and tea flowers. Packaging and Food Machinery, 2020, 38(01): 30-32+60.). Other studies have pointed out that flower removal can effectively improve the yield and quality of spring tea (Wang Jing, Shi Yang, Zhang Yan, et al. Study on the effect of removing camellia flowers on the yield and biochemical composition of spring tea from albino tea trees. Tea Newsletter, 2022, 49(04): 464-471.). He Zhihua et al. found that reducing the consumption of nutrients by flower bud differentiation and fruit can improve the utilization rate of water and fertilizer by tea trees, thereby increasing tea yield (He Zhihua, Xia Yan, Zhang Yulong, et al. Study on the effects of different organic fertilizers on tea yield and flowering volume in organic tea gardens. Agricultural Mechanization Research, 2019, 41(01): 190-195.). Therefore, delaying the flowering time of tea trees can shorten the flowering period of tea trees, reduce the nutrient consumption caused by flowering of tea trees, and accumulate more energy for the germination of new leaf buds in spring. This is a new idea to increase the yield and quality of spring tea in a green, safe and efficient way.

[0003] The flowering of tea trees is not only regulated by internal genetic factors and hormone levels, but also by external environmental conditions such as temperature and light duration. External environmental conditions mainly regulate the flowering of tea trees by changing the physiological metabolism or hormone levels in the body to promote or inhibit the expression of flowering genes. At the molecular level, the balanced expression of flowering time and inflorescence meristem genes determines the formation of flower primordia and flowering time of tea trees. Therefore, exploring flowering genes and clarifying their flowering regulation functions provide important genetic resources and strong theoretical support for improving tea varieties. Summary of the invention

[0004] In order to overcome the deficiencies of the above-mentioned prior art, the present invention discovered a sequence in tea trees that is homologous to the Arabidopsis AtCIP1 gene and named it CsCIP1. Studies have shown that the tea tree gene CsCIP1 can delay flowering after being overexpressed in Arabidopsis, which is expected to provide important gene resources and strong theoretical support for improving tea tree varieties.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] The present invention provides an application of a CsCIP1 gene in delaying flowering. The CsCIP1 gene has a nucleotide sequence as shown in SEQ ID NO: 1.

[0007] Preferably, the primers for cloning the CsCIP1 gene from tea plant are shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0008] The present invention also provides the use of biological materials containing CsCIP1 gene in delaying flowering, wherein the CsCIP1 gene has a nucleotide sequence as shown in SEQ ID NO: 1; the biological materials containing CsCIP1 gene include recombinant plasmids containing CsCIP1 gene, and of course, other recombinant vectors containing CsCIP1 gene are also included.

[0009] The present invention also provides a method for delaying plant flowering, which specifically comprises: firstly constructing a recombinant expression vector driving the CsCIP1 gene with a 35S promoter through a gateway system, transforming and extracting the plasmid, then transducing it into an Agrobacterium competent state, and finally obtaining a transgenic plant through infection.

[0010] Preferably, the plant includes (but is not limited to) Arabidopsis thaliana.

[0011] Preferably, the infection is an Agrobacterium-mediated floral dip infection method.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention finds a sequence CsTGY12G0001995 homologous to the Arabidopsis AtCIP1 gene in tea trees, and names it CsCIP1. After the gene is overexpressed in Arabidopsis, the flowering time of the transgenic plant is later than that of the wild type, proving that the gene has the function of delaying flowering, and provides a candidate gene for the directional breeding of delayed flowering tea varieties. The tea gene CsCIP1 and its delayed flowering function analysis are helpful to provide important gene resources and strong theoretical support for improving tea varieties in agricultural production, and have wide application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the homology alignment between the tea plant CsTGY14G0000594 and the Arabidopsis gene;

[0015] Figure 2 PCR identification of 35S:CsCIP1:GFP transgenic positive plants (lanes 1-10 are 10 different 35S:CsCIP1:GFP overexpression positive plants);

[0016] Figure 3 To detect the expression of CsCIP1 in Arabidopsis 35S:CsCIP1:GFP overexpressing transgenic positive plants (only the lines OX-CsCIP1-3 and OX-CsCIP-4 with high CsCIP1 expression levels are listed);

[0017] Figure 4 The flowering inhibition phenotype of tea plant 35S:CsCIP1:GFP transgenic positive plants: (A) flowering time statistics; (B) flowering phenotype observation. DETAILED DESCRIPTION

[0018] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0019] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0020] Example: Isolation and identification of tea gene CsCIP1 and its function in regulating flowering

[0021] 1.1. Source and identification of genes:

[0022] We commissioned Biomarker Biotechnology Co., Ltd. to use RNA-Seq technology to conduct transcriptome differential analysis of two tea varieties with different flowering times. Using the published tea genome (Zhang X, Chen S, Shi L, et al. Haplotype-resolved genome assembly provides insights into evolutionary history of the tea plant[J]. Nature Genetics[2024-09-24]. DOI:10.1038 / s41588-021-00895-y.) as the reference genome, we screened out the important differentially expressed gene CsTGY12G0001995 (SEQ ID NO.1), and used specific primers (F1:ATGGATCAGCAAGTTGTTTTTTC, SEQ ID NO.2; R1:TTAGAACACTTTGCTATTGATAG, SEQ ID NO.3; IDNO.3) to clone the coding sequence of the gene, the reaction system was 20 μL (F1: 0.5 μL, R1: 0.5 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH 2 O: 8 μL), the reaction conditions were: 98℃30s, 58℃1.5min, 72℃5min, 30 cycles, 72℃ extension 10min. Then, the tea tree CsTGY12G0001995 was homologously aligned with the Arabidopsis gene (AT5G41790) by NCBI-BLAST ( Figure 1 ), and found that CsTGY12G0001995 was homologous to Arabidopsis AtCIP1, so it was named CsCIP1.

[0023] Sequence of CsCIP1-CsTGY12G0001995 (SEQ ID NO. 1):

[0024]

[0025] 1.2. Cloning of the CsCIP1 gene from tea tree:

[0026] RNA from Yinghong No. 9 tea tree flowers at different stages was extracted using Tiangen RNA extraction kit (DP452), and reverse transcribed into cDNA using Takara's reverse transcription kit (RR047A). Using this as a template, specific primers with sticky ends were designed according to the sequence of the target gene (F2: ggccgcccccttcacc ATGGATCAGCAAGTTGTTTTTTC, SEQ ID NO.4; R2: cggcgcgcccaccctt TTAGAACACTTTGCTATTGATAG, SEQ ID NO.5, where lowercase letters are sticky ends) for PCR amplification and cloning of the CsCIP1 gene. The PCR reaction system was 20 μL (F2: 0.5 μL, R2: 0.5 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH 2 O: 8 μL), the reaction conditions were: 98°C for 30 s, 58°C for 1.5 min, 72°C for 5 min, 30 cycles, and extension at 72°C for 10 min.

[0027] 1.3. Connection conversion:

[0028] Influsion ligase (Takara, 638949) was used to connect the linear target gene fragment with sticky ends and the linear entry vector pENTR (the construction method of the vector refers to the literature "Zhang M, Liu Y, Li Z, et al. The bZIP transcription factor GmbZIP15 facilitates resistance against Sclerotiniasclerotiorum and Phytophthora sojae infection in soybean.[J].iScience,2021,24(6):102642."), obtain the circular entry vector containing the target gene, add the ligation product to 100 μL of E.coli DH5α competent cells, let it stand on ice for 30 minutes, bathe in 42°C water for 45 seconds, immediately put it back on ice for 2 minutes, transfer it to the clean bench, add 600 μL of blank LB liquid culture medium, culture it in a 37°C shaker for 0.5-1h, collect the bacteria, centrifuge it at 3000g for 1min, remove the supernatant solution in the clean bench, spread the collected precipitate on the LB solid culture medium containing the corresponding resistance, seal it, and place it upside down in a 37°C incubator for overnight culture.

[0029] 1.4. Screening and identification of transformants:

[0030] In the clean bench, use a sterile pipette to pick up a single colony on the culture medium, inoculate it into LB liquid culture medium, and culture it in a shaking incubator at 37°C for 5 hours. Then perform PCR identification (identification system, procedure and primers are the same as those in Part 1.1), send it to Sangon Biotech Co., Ltd. for sequencing, and select the correct transformant as the recombinant plasmid for the next step.

[0031] 1.5. Construction of recombinant expression vector:

[0032] The recombinant plasmid was extracted and the Gateway technology, i.e., the phage site recombination system (attB*attP-attL*attR), was used to connect the plasmid to the final vector 35S:605:GFP using LR enzyme (Thermo Fisher, 11791020) (the vector construction method refers to the literature "Zhang M, Liu Y, Li Z, et al. The bZIP transcription factor GmbZIP15 facilitates resistance against Sclerotinia sclerotiorum and Phytophthorasojae infection in soybean. [J]. iScience, 2021, 24 (6): 102642."), and then the E. coli DH5α competent cells were transformed for a second time to screen and identify the transformants (primers at one end of the vector and the gene itself attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT, SEQ ID NO.6; R1: TTAGAACACTTTGCTATTGATAG, SEQ ID NO.6). IDNO.3, PCR procedure and system are the same as 1.1), and then the plasmid is extracted.

[0033] 1.6 Transduction and identification:

[0034] 3 μL of the plasmid to be transformed was added to the competent GV3101 strain for transformation. The competent strain with the added plasmid was placed on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Then 600 μL of blank LB was added, and the culture was placed in a 28°C shaker for 2-3 hours to collect the bacteria. After centrifugation at 3000g for 1 minute, the supernatant solution was removed in a clean bench, and the collected precipitate was spread on the LB solid culture medium containing the corresponding resistance, sealed, and inverted in a 28°C incubator for 2-3 days; a single colony was picked, inoculated into the LB liquid culture medium, and cultured overnight at 28°C in a shaker, followed by PCR identification (identification system, procedure and primers are the same as 1.5) to select the correctly transformed Agrobacterium.

[0035] 1.7. Infection of Arabidopsis thaliana:

[0036] The wild-type Arabidopsis buds to be opened were immersed in the infection solution of Agrobacterium (GV3101) containing 35S:CsCIP1:GFP (OD=0.8) by the floral dipping method for 1 minute, and then cultured in a greenhouse (22°C, 16h light / 8h dark).

[0037] 1.8. Screening of transgenic plants:

[0038] BASTA herbicide (10% glufosinate, CB2471, Coolab) was diluted 1:500 and sprayed on one-week-old Arabidopsis seedlings to screen positive plants (plants resistant to herbicides) and further PCR identification (identification system, procedure and primers are the same as 1.5). The leaf DNA of the plants was extracted by CTAB method, polymerase chain reaction was performed, and agarose gel electrophoresis was used to analyze whether the CsCIP1 gene was transferred. Figure 2 It can be seen that the 35S:CsCIP1:GFP overexpression transgenic positive plant seedlings have bands, while the wild type (WT) has no bands, confirming that the transgenic plants have been successfully obtained.

[0039] 1.9. Expression level detection:

[0040] Positive plant leaves were collected, and RNA from each plant leaf was extracted using the Tiangen RNA extraction kit (DP452), and reverse transcribed into cDNA using the TAKARA reverse transcription kit (RR047A). qPCR primers (q-CsCIP1-F: GAGGAAGACTACGGCTACTTTG, SEQ ID NO.7; q-CsCIP1-R: CCACCTGCTCTTCCAATTCT, SEQ ID NO.8) were designed and analyzed by qPCR (reaction system: F: 0.4 μL, R: 0.4 μL, template cDNA: 1 μL, 2× DNA polymerase: 10 μL, ddH 2 O: 8.2 μL, reaction conditions: 95°C 30S, (95°C 10S, 68°C 10S) × 40 cycles) to detect the relative expression of CsCIP1 in each positive plant. Figure 3 It can be seen that compared with the wild type (WT), the CsCIP1 expression level of the 35S:CsCIP1:GFP overexpression transgenic positive plants was significantly increased. Finally, the strains with high expression levels (OX-CsCIP1-3, OX-CsCIP-4) were randomly selected for subsequent phenotypic observation.

[0041] 1.10 Phenotypic observation:

[0042] Wild-type (WT) and 35S:CsCIP1:GFP-positive plants were grown under the same greenhouse culture conditions (22°C, 16 h light / 8 h dark), and the flowering time of the plants was observed. Figure 4 By counting the flowering time of the plants, it was found that the flowering time of the 35S:CsCIP1:GFP overexpressing transgenic positive plants was about one week later than that of the wild type, indicating that overexpression of CsCIP1 can delay flowering.

[0043] In summary, the CsCIP1 gene has the function of delaying flowering, which provides a candidate gene for the targeted breeding of delayed-flowering tea varieties, provides important genetic resources and strong theoretical support for improving tea varieties, and has broad application value.

[0044] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. The use of CsCIP1 gene in delaying flowering, characterized in that: The CsCIP1 gene has a nucleotide sequence as shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The primers for cloning the CsCIP1 gene from tea plant are shown in SEQ ID NO: 2 and SEQ ID NO:

3.

3. Use of a biological material containing the CsCIP1 gene in delaying flowering, characterized in that: The CsCIP1 gene has a nucleotide sequence as shown in SEQ ID NO: 1; the biological material containing the CsCIP1 gene includes a recombinant plasmid containing the CsCIP1 gene.

4. A method for delaying flowering of a plant, characterized in that: First, a recombinant expression vector of the CsCIP1 gene driven by the 35S promoter was constructed through the gateway system. After transformation and extraction of the plasmid, it was transduced into the competent state of Agrobacterium, and finally transgenic plants were obtained through infection.

5. A method for delaying plant flowering according to claim 4, characterized in that: The plants include Arabidopsis thaliana.

Images