Construction method and application of systemic lupus erythematosus mouse model

Abstract

The invention discloses a construction method and application of a systemic lupus erythematosus mouse model, the correlation between Rasgrp1 composite heterozygous mutation (p.T214I, p.K322X) and the phenotype of systemic lupus erythematosus of a mouse is found for the first time, and on the basis of the correlation, a novel systemic lupus erythematosus mouse model carrying the Rasgrp1 composite heterozygous mutation (p.T214I, p.K322X) is constructed for the first time. A foundation is laid for research on pathogenesis and intervention strategies of systemic lupus erythematosus, and the application prospect is wide.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to a method for constructing a systemic lupus erythematosus mouse model and an application thereof. Background Art

[0002] Systemic lupus erythematosus (SLE) is a common autoimmune disease characterized by chronic inflammatory damage to organs and tissues of multiple systems. Its etiology and pathogenesis have not yet been fully elucidated. It is currently believed that it may be caused by the combined effects of genetic, inflammatory, hormonal and environmental factors, which may cause the body's immune homeostasis imbalance, regulatory disorders, antigen-antibody complexes, complement complexes deposited in blood vessels to cause immune responses and thrombosis, ultimately leading to local or systemic tissue and organ damage. Systemic lupus erythematosus can cause symptoms such as inflammation and pain in the skin, kidneys, joints, blood, heart, lungs and other parts of the human body, and may even threaten the patient's life. So far, there is no clear cause of the disease and any known cure for systemic lupus erythematosus. It can be seen that the study of the etiology and pathogenesis of systemic lupus erythematosus is crucial, and the construction of animal models is helpful for the study of the disease and is of great significance for exploring the pathogenesis and treatment methods.

[0003] At present, the systemic lupus erythematosus mouse models studied at home and abroad are mainly divided into two types, namely spontaneous mouse models and artificially induced mouse models. Spontaneous mouse models include NZB, NZB / NZW F1, MRL / lpr, MRL / n, BXSB mice, etc. Artificially induced mouse models are mice that induce lupus-like symptoms through chemical substances (such as pristane, concanavalin A, bacterial lipopolysaccharide, etc.). However, the genetic and environmental backgrounds of hybrid mice and induced mice are complex, and there are various deficiencies in research. The reason why the NZB / NZW mouse model exhibits lupus phenotypes is unknown, and the disease cycle is long (6 months), which is easily affected by environmental factors, and the experimental process is difficult to control, which brings difficulties to the study of the pathogenesis of the disease. Although the cause of the disease in the MRL / lpr mouse model is clear and is caused by the deletion of the Fas gene, the MRL / lpr mouse model does not fully conform to the characteristics of human diseases. For example, the MRL / lpr model does not show gender differences, and the mouse needs to be produced by complex mating of LG / J, AKR / J, C3H / HeDi and C57BL / 6J strains of mice to the 12th generation. The breeding process is complicated and the price is relatively expensive.

[0004] Therefore, in order to better explore the pathogenesis of systemic lupus erythematosus and develop drugs targeting systemic lupus erythematosus, there is an urgent need in this field to develop a method for constructing a systemic lupus erythematosus mouse model with a high modeling rate, short modeling time, and simple operation. Summary of the invention

[0005] In view of this, in order to overcome the deficiencies of the prior art, the object of the present invention is to provide a method for constructing a systemic lupus erythematosus mouse model and its application.

[0006] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0007] The first aspect of the present invention provides a method for constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X, wherein X in p.K322X refers to a stop mutation.

[0008] Further, the method comprises the following steps:

[0009] (1) designing sgRNA sequences that recognize the p.T214I site and the p.K322X site respectively;

[0010] (2) preparing sgRNA / Cas9 injection solutions respectively, and injecting the sgRNA / Cas9 injection solutions into mouse fertilized eggs respectively;

[0011] (3) The obtained fertilized eggs were transplanted into pseudo-pregnant female mice to obtain p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice;

[0012] (4) mating the p.T214I heterozygous mutant mice and mating the p.K322X heterozygous mutant mice to obtain p.T214I homozygous mutant mice and p.K322X homozygous mutant mice;

[0013] (5) The p.T214I homozygous mutant mice were hybridized with p.K322X homozygous mutant mice to obtain a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0014] Further, the sgRNA sequence that recognizes the p.T214I site is shown in SEQ ID NO: 1;

[0015] The sgRNA sequence that recognizes the p.K322X site is shown in SEQ ID NO:2.

[0016] Furthermore, the contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution are (8.0-15.0) ng / μL and (10-40) ng / μL, respectively.

[0017] Furthermore, the contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution are 12.5 ng / μL and 25 ng / μL, respectively.

[0018] Furthermore, the gene mutation site corresponding to the p.T214I site is c.641C>T;

[0019] The gene mutation site corresponding to the p.K322X site is c.964A>T, which forms a stop codon after mutation.

[0020] In some embodiments, the method of injecting sgRNA / Cas9 injection includes but is not limited to: microinjection, ultrasound-mediated method, electroporation, sonoporation, photoporation, magnetic transfer, heat shock, calcium phosphate method, liposome and polymer method, nanoparticle method or viral transformation method.

[0021] In some embodiments, the method of injecting sgRNA / Cas9 injection is microinjection.

[0022] In some embodiments, the microinjection method uses a glass microinjection needle with an extremely fine tip (0.1-0.5 μm) to directly inject the exogenous gene fragment into pronuclear embryos or cultured cells, and then embed the exogenous gene into the host's chromosome through the recombination (Rearrangement), deletion (Deletion), duplication (Duplication) or translocation (Translocation) that may occur in the host genome sequence.

[0023] In a specific embodiment of the present invention, the sgRNA / Cas9 injection solution is a sgRNA / Cas9 microinjection solution, and the sgRNA / Cas9 microinjection solution is prepared by the following method: sgRNA and Cas9 (Cas9 mRNA: 25 ng / μL; sgRNA: 12.5 ng / μL) are mixed using RNase-free TE-buffer.

[0024] In some embodiments, the sgRNA sequence that recognizes the p.T214I site and the sgRNA sequence that recognizes the p.K322X site are not limited to SEQ ID NO: 1 and SEQ ID NO: 2 used in the specific embodiments of the present invention. Any sgRNA that can specifically recognize the p.T214I site and any sgRNA that can specifically recognize the p.K322X site designed based on the prior art are within the protection scope of the present invention.

[0025] In some embodiments, the method for designing sgRNA can be to obtain the sequence of the target gene (Rasgrp1) through an online database (e.g., NCBI), use an online sgRNA design platform (https: / / design.synthego.com / # / ) to analyze and obtain the target sequence (20bp) of the target gene, select targets with high editing efficiency scores and low off-target scores, and then obtain the full-length sgRNA sequence by chemical synthesis.

[0026] In a specific embodiment of the present invention, the sgRNA sequence that recognizes the p.T214I site is shown as SEQ ID NO: 1; the sgRNA sequence that recognizes the p.K322X site is shown as SEQ ID NO: 2.

[0027] In a specific embodiment of the present invention, the mouse fertilized eggs are obtained by the following method: the embryo donor female mouse is superovulated (intraperitoneal injection of PMSG 20IU / mouse, and 48h later, intraperitoneal injection of HCG 30IU / mouse), and the fertilized eggs are taken out after being caged with the male mouse, thereby obtaining mouse fertilized eggs.

[0028] In the present invention, compared with the Rasgrp1 gene of wild-type mice, the Rasgrp1 mutant gene has the following mutation sites c.641C>T and c.964A>T in the Rasgrp1 gene sequence.

[0029] The present invention creatively discovered for the first time the correlation between the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) and the phenotype of systemic lupus erythematosus in mice. Therefore, the present invention is not limited to the specific construction method itself, and any construction method that uses the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) compound heterozygous mutation site to construct a mouse with a systemic lupus erythematosus phenotype will fall within the protection scope of the present invention.

[0030] The second aspect of the present invention provides use of the systemic lupus erythematosus mouse model constructed according to the method of the first aspect of the present invention in screening drugs for treating and / or preventing systemic lupus erythematosus.

[0031] The present invention has found through phenotypic verification that the systemic lupus erythematosus mouse model constructed according to the method described in the first aspect of the present invention has a typical systemic lupus erythematosus phenotype. Therefore, the systemic lupus erythematosus mouse model can be used for the effective screening of candidate preventive and therapeutic drugs for systemic lupus erythematosus.

[0032] In the present invention, the treatment and / or prevention include treatment and prevention. Among them, treatment refers to reducing or eliminating the severity of the symptoms of the disease systemic lupus erythematosus, the frequency of such symptoms, or both. The term includes such effects that occur when the patient suffers from the disease systemic lupus erythematosus or related conditions, that is, reducing the severity of one or more symptoms or effects of systemic lupus erythematosus-related symptoms. Prevention refers to completely or partially preventing or inhibiting the symptoms of the disease or the frequency of such symptoms, or reducing the risk of acquiring a given symptom of the disease. In a specific embodiment of the present invention, the disease is systemic lupus erythematosus, and prevention includes inhibiting and / or preventing the symptoms related to systemic lupus erythematosus, reducing the severity of symptoms related to systemic lupus erythematosus, or improving signs and symptoms related to systemic lupus erythematosus. Prevention includes inhibiting, preventing or reducing the severity of symptoms related to systemic lupus erythematosus. The term includes such effects that occur before the patient begins to suffer from systemic lupus erythematosus or related conditions, that is, delaying the onset of symptoms related to systemic lupus erythematosus, and / or inhibiting or reducing the severity of symptoms related to systemic lupus erythematosus.

[0033] The third aspect of the present invention provides a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0034] Furthermore, the mouse model is a mouse model constructed using the method described in the first aspect of the present invention.

[0035] A fourth aspect of the present invention provides a CRISPR / Cas9 system for Rasgrp1 gene editing.

[0036] Furthermore, the system comprises Cas9 mRNA and the sgRNA described in the first aspect of the present invention.

[0037] The CRISPR / Cas system is the most widely used genome editing technology. It consists of a Cas protein with endonuclease function and a single-stranded guide RNA (sgRNA) of an artificially recombined target gene. The sgRNA can guide the Cas protein to knock out, insert, and mutate the target gene. Among them, the CRISPR / Cas9 system is the most intensively studied and most maturely applied efficient gene editing tool, mainly composed of Cas9 and sgRNA. As a new generation of gene editing technology, CRISPR / Cas9 has broad application prospects in model animal construction, gene function research, gene therapy, etc. due to its convenient, simple, and efficient operation.

[0038] In addition, the present invention also provides a kit for screening a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0039] Furthermore, the kit comprises primers for specifically detecting the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0040] Furthermore, the sequences of primers for detecting the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X are shown in SEQ ID NOs: 3-4 and 5-6, respectively.

[0041] In some embodiments, the kit for screening a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X refers to a kit comprising liquid or powdered primers that specifically recognize Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0042] In some embodiments, the kit may also include other reagents required for PCR, such as buffer, dNTP, polymerase; and may also include reagents and consumables required for recovering PCR products, such as sol, collection tube, washing solution, etc. In addition, the kit also includes instructions, which record how to detect the sample to be tested and how to judge whether it contains Rasgrp1 compound heterozygous mutations p.T214I and p.K322X according to the test results. The kit and instructions for screening the systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X are used to detect using the DNA of the sample to be tested as a template, which is easy to operate and can quickly identify a large number of samples.

[0043] The fifth aspect of the present invention provides the use of the system described in the fourth aspect of the present invention in constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0044] The sixth aspect of the present invention provides the use of the mutation sites p.T214I and p.K322X on the Rasgrp1 gene in constructing a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0045] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0046] (1) The present invention is the first to discover the correlation between Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X) and the phenotype of systemic lupus erythematosus in mice. Based on this, the present invention is the first to construct a new systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X), laying a foundation for the study of the pathogenesis and intervention strategies of systemic lupus erythematosus.

[0047] (2) Compared with the commercialized MRL / lpr systemic lupus erythematosus mouse model, the novel systemic lupus erythematosus mouse model provided by the present invention is simpler to breed. Compared with the artificially induced systemic lupus erythematosus mouse model and the NZB / NZW systemic lupus erythematosus mouse model, the novel systemic lupus erythematosus mouse model provided by the present invention has a single pathogenic factor and is more conducive to studying the pathogenesis of systemic lupus erythematosus.

[0048] (3) The novel systemic lupus erythematosus mouse model provided by the present invention has the advantages of stable inheritance, high modeling rate, short modeling time, and simple operation. Experimental verification of the constructed systemic lupus erythematosus mouse model found that the mouse model has the pathological characteristics and phenotype of systemic lupus erythematosus and can be used for the screening of therapeutic drugs for systemic lupus erythematosus.

[0049] (4) The novel systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X) constructed by the construction method provided by the present invention provides a good visual animal model for in-depth exploration of the pathogenic mechanism of systemic lupus erythematosus, high-throughput screening of systemic lupus erythematosus prevention and treatment drugs, exploration of gene therapy methods and feasibility, and screening of candidate drugs for the treatment and / or prevention of systemic lupus erythematosus. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Sanger sequencing results were used to identify the genotype of mice with compound heterozygous mutations in Rasgrp1 (p.T214I, p.K322X);

[0051] Figure 2 The results of antinuclear antibody (ANA) detection, wherein, Figure A: Elisa detection of ANA concentration; Figure B: Hep2 cell detection of ANA; the ANA antibody concentration of compound heterozygous mutant mice is higher than that of wild type, indicating autoimmunity, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0052] Figure 3 is the result of anti-ds-DNA antibody detection. The concentration of ds-DNA antibodies in compound heterozygous mutant mice is higher than that in wild type, indicating autoimmunity, wherein CHE refers to compound heterozygous mutant mice constructed by the present invention;

[0053] Figure 4 is the result of urine protein concentration measurement. The urine protein concentration of compound heterozygous mutant mice is higher than that of wild type, indicating kidney damage, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0054] Figure 5 is the result of spleen morphology observation, the spleen of compound heterozygous mutant mice is significantly larger than that of wild type, indicating autoimmunity, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0055] Figure 6 is the result of spleen histological observation. The spleen of normal mice has clear structure, no hyperplasia and germinal center formation, while the spleen white pulp of compound heterozygous mutant mice has diffuse hyperplasia, fibrous thickening of the central artery wall, and germinal center formation, indicating autoimmunity, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0056] Figure 7 The result diagram corresponding to the immune complex deposition in the kidneys shows that normal mice have no immune complex deposition, while mutant mice have a large amount of immune complex deposition, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention. DETAILED DESCRIPTION

[0057] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0058] The reagents and raw materials used in the present invention are easily obtained by ordinary technicians in the field and can be obtained from commercial channels unless otherwise specified. The experimental methods in the present invention that do not specify specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not limit the scope of the present invention in any way.

[0059] Example 1 Preparation of mice with compound heterozygous mutations of Rasgrp1 (p.T214I, p.K322X)

[0060] 1. Experimental Materials

[0061] C57BL / 6J mice: Saiye Biotechnology Co., Ltd.; Cas9 mRNA: Thermo Fisher, USA (A29378).

[0062] 2. Experimental methods

[0063] (1) Preparation of sgRNA and Cas mRNA: Obtain the sequence of the target gene through an online database (such as NCBI). The online sgRNA design platform (https: / / design.synthego.com / # / ) can be used to analyze the target sequence (20bp) of the target gene, and select targets with high editing efficiency scores and low off-target scores. Obtain the full-length sequence of sgRNA by chemical synthesis, and purchase Cas9 mRNA from the company;

[0064] p.T214I site sgRNA sequence: GAAGGACTTGAACTCAAGGTAGG (SEQ ID NO: 1);

[0065] p.K322X site sgRNA sequence: TGTCCCACATGAGATCAATAAGG (SEQ ID NO: 2).

[0066] (2) Prepare sgRNA / Cas9 microinjection solution (prepare sgRNA / Cas9 microinjection solution for p.T214I site and sgRNA / Cas9 microinjection solution for p.K322X site respectively): Use RNase-free TE-buffer to mix sgRNA and Cas9 (Cas9: 25 ng / μL; sgRNA: 12.5 ng / μL).

[0067] (3) Obtaining fertilized eggs: The embryo donor female mice were superovulated (intraperitoneal injection of PMSG 20 IU / mouse, followed by intraperitoneal injection of HCG 30 IU / mouse 48 hours later) and then placed in cages with male mice to obtain fertilized eggs.

[0068] (4) Prepare pseudo-pregnant female mice: Select healthy female mice and place them in a cage with sterilized male mice.

[0069] (5) Microinjection of sgRNA / Cas9 microinjection solution into fertilized eggs: Inject sgRNA / Cas9 microinjection solution targeting p.T214I site and sgRNA / Cas9 microinjection solution targeting p.K322X site into different fertilized eggs respectively.

[0070] (6) The fertilized eggs were transplanted into pseudo-pregnant female mice to obtain offspring: The two different fertilized eggs obtained above were transplanted into pseudo-pregnant female mice to obtain offspring p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice, respectively.

[0071] (7) Mouse genotype identification:

[0072] 1) Design of PCR primers

[0073] p.T214I site primer

[0074] Forward primer (F1): 5'-ACTGACTCTTGTTTTCTTCTCCCTT-3' (SEQ ID NO: 3);

[0075] Reverse primer (R1): 5'-CCATAGCTTGATAGGCTGAGTGAAT-3' (SEQ ID NO: 4).

[0076] p.K322X site primers

[0077] Forward primer (F1): 5'-TCTGCTGTCGTCTGTCCTATGTAT-3' (SEQ ID NO: 5);

[0078] Reverse primer (R1): 5'-TCTAAAGTGAGGAGAGCTGGGTA-3' (SEQ ID NO: 6).

[0079] 2) PCR amplification

[0080] 3) Sanger sequencing

[0081] (8) The p.T214I heterozygous mutant mice are mated with males and females, and the p.K322X heterozygous mutant mice are mated with males and females to obtain p.T214I homozygous mutant mice and p.K322X homozygous mutant mice.

[0082] (9) The p.T214I homozygous mutant mice were crossed with the p.K322X homozygous mutant mice, and all the offspring were double-mutant mice.

[0083] 3. Experimental results

[0084] The genotype identification of mice with compound heterozygous Rasgrp1 mutation (p.T214I, p.K322X) Sanger sequencing results are as follows Figure 1 As shown, p.T214I corresponds to c.641C>T, and p.K322X corresponds to c.964A>T. The results show that Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mice were successfully constructed.

[0085] Example 2 Identification of lupus phenotype in the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mouse model constructed in Example 1

[0086] 1. Experimental Materials

[0087] ANA test: Shanghai ELISA Cat#ml002245;

[0088] Urine protein test: Jiangcai Biotechnology Cat# JL-T0030;

[0089] 4% paraformaldehyde: Biyuntian P0099;

[0090] Hematoxylin and eosin staining kit: Biotech C0105S.

[0091] 2. Experimental methods

[0092] (1) Elisa method for ANA detection

[0093] 1) The kit should be taken out of the refrigerated environment and equilibrated at room temperature for 15-30 minutes, and the standard wells and sample wells should be designed.

[0094] Before use, mix all reagents thoroughly. Do not allow the liquid to produce a large amount of foam, so as to avoid adding a large number of bubbles when adding samples, resulting in errors in adding samples.

[0095] 2) Adding samples to standard, sample and blank wells: add 50 μL of standard of different concentrations to each standard well; blank wells (blank control wells do not add samples and enzyme-labeled reagents, and the rest of the steps are the same); wells for samples to be tested: dilute the sample with specimen diluent 1:5 and add 50 μL to the reaction wells.

[0096] 3) Add the sample to the bottom of the ELISA plate well, try not to touch the well wall, and shake gently to mix.

[0097] 4) Immediately add 50 μL of biotin-labeled antibody, cover the plate, gently shake to mix, and incubate at 37°C for 1 hour.

[0098] 5) Washing: Carefully peel off the sealing film, discard the liquid, spin dry, fill each well with washing solution, shake for 30 seconds and then spin dry, repeat 3-5 times and pat dry.

[0099] 6) Add 50 μL of substrate A and B to each well, gently shake to mix, and incubate at 37°C in the dark for 15 minutes.

[0100] 7) Termination: Add 50 μL of stop solution to each well to terminate the reaction (the blue color immediately turns yellow). The results should be measured immediately after adding the stop solution.

[0101] 8) Measurement: Use the blank well as zero setting, and measure the absorbance (OD value) of each well in sequence at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.

[0102] (2) Hep2 detection of ANA

[0103] 1) Preparation: Take out the Hep2 antigen slice and wait for it to return to the ambient temperature of 18℃-25℃ before cutting open the package. Dissolve one bag of PBS powder for washing into 1L with purified water, add one bottle of Tween, mix well and use for washing and specimen dilution.

[0104] 2) Dilution: Dilute the serum to be tested 1:100 with washing buffer.

[0105] 3) Sample addition: Add diluted serum or positive and negative controls into the reaction wells of the inverted plate, 25 μL / well, and avoid generating bubbles when adding samples.

[0106] 4) Incubation: Cover the antigen sheet in the corresponding groove of the inverted plate and incubate at an ambient temperature of 18°C ​​to 25°C for 30 minutes to ensure that each specimen can contact the antigen matrix and the specimens do not contact each other.

[0107] 5) Washing: Take out the antigen piece, gently rinse off the reaction solution from one side with washing solution, soak it in washing solution, let it stand for 5 minutes, and then rinse it once with purified water.

[0108] 6) Sample addition: Add ANA fluorescent secondary antibody to the reaction wells of the inverted plate, 25 μL / well, and avoid creating bubbles when adding samples.

[0109] 7) Incubation: After wiping off excess liquid around and on the back of the antigen piece with paper, cover the antigen piece in the corresponding groove and incubate at an ambient temperature of 18°C-25°C for 30 minutes to ensure that each specimen can contact the antigen matrix and the specimens do not contact each other.

[0110] 8) Washing: Repeat the above step 5).

[0111] 9) Sealing: After wiping the excess liquid around and on the back of the antigen piece with paper, add sealing agent to the reaction well of the antigen piece, place the cover slip on the antigen piece to complete the sealing.

[0112] 10) Observation of results: The results were photographed under a confocal microscope.

[0113] (3) Elisa method for dsDNA detection

[0114] 1) Equilibrate all reagents to room temperature for at least 30 min.

[0115] 2) Prepare working wash solution: dilute the stock solution 100 times with ddH2O.

[0116] 3) Prepare working sample diluent (WSD): dilute the stock solution 20 times with ddH2O.

[0117] 4) Prepare anti-mouse Ig-HRP conjugate: dilute 100 times with WSD solution and use it immediately.

[0118] 5) Prepare serum and dilute it 1:100 with Low NSB Sample Diluent (LNSD). All samples must be diluted in the same diluent for proper comparison.

[0119] 6) Add 200 μL of working wash solution to the well plate and let it sit for 5 minutes. Before adding the sample, spin off the liquid and pat dry on a paper towel.

[0120] 7) Design the sample addition and set the blank well for sample washing solution, Blank OD < 0.3.

[0121] 8) First incubation: Add 100 μL of standard, sample, and blank wells of sample wash solution to the pre-set wells of the plate. Tap the plate to mix the reagents and incubate for 60 minutes. Wash the plate 4 times and pat dry with a fresh paper towel.

[0122] 9) Second incubation: Add 100 μL of diluted anti-mouse Ig HRP to each well, incubate for 30 min, and wash the plate 5 times.

[0123] 10) Incubate substrate: Add 100 μL TMB substrate and incubate for 15 min (If the optical density (OD) recorded by the microplate reader is not higher than 2.0, please shorten the incubation time or read the OD at 405-410 nm (results are valid).

[0124] 11) Stop reaction: Add 100 μL of stop solution to each well and tap gently to mix. The enzyme reaction will stop and the liquid in the well will turn yellow.

[0125] 12) Within 30 minutes, detect the absorbance at a wavelength of 450 nm.

[0126] (4) Urine protein test

[0127] 1) Preparation of CBB application solution: CBB reagent is prepared in a ratio of 1:4, i.e. 5 times dilution.

[0128] 2) Add 500 μL of sample, standard distilled water and 3 mL of CBB application solution to the sample group, standard group and blank group respectively.

[0129] 3) Mix thoroughly, let stand for 5 minutes, and measure the absorbance of each tube at a wavelength of 595 nm and a light path of 1 cm. Adjust the zero value with double water.

[0130] (5) HE staining of kidney and spleen

[0131] 1) The mice were killed by cervical dislocation, and spleen tissues were obtained and fixed in 4% paraformaldehyde at 4°C for 48 hours.

[0132] 2) The tissue was removed and fixed, and dehydrated with 30% sucrose solution at 4°C for 12 hours until the tissue sank.

[0133] 3) Embedded in paraffin and cut into sections with a thickness of 4 μm using a paraffin slicer.

[0134] 4) Dewax the paraffin sections and put them into water: xylene I and II for 15 min each → 100% alcohol I and II → 95% alcohol I and II → 80% alcohol → 70% alcohol → 50% alcohol for 1-2 min each.

[0135] 5) Washing: Wash twice with ordinary water and once with distilled water.

[0136] 6) Stain with hematoxylin for 10 min and wash with tap water for 10 min.

[0137] 7) Hydrochloric acid-ethanol color separation: Separate for 10-30 seconds and check the degree of color separation under a microscope at any time. When the nucleus is dark blue and the cytoplasm is colorless or light gray, wash with tap water for 10 minutes.

[0138] 8) Bluing with ammonia water for 2-3 minutes, and washing with tap water for 10 minutes.

[0139] 9) Dehydration: 70% and 80% alcohol for 1-2 minutes each.

[0140] 10) Stain with eosin for 1-3 minutes, observe under the microscope at any time, and wash with distilled water for 5 minutes.

[0141] 11) Dehydration and transparency: 95% alcohol I and II for 1-2 min each → 100% alcohol I and II for 15 min each → xylene I and II for 15 min each.

[0142] 12) Seal the slides with neutral gum and collect images under an optical microscope.

[0143] (6) Kidney immune complex deposition

[0144] 1) Take fresh kidney tissue from mice, immerse it in PBS and place it on ice.

[0145] 2) Fix with 2 mL 4% PFA at 4°C for 24 hours.

[0146] 3) Dehydrate with 1-2 mL of 30% sucrose solution at 4°C for 12-16 hours until the tissue sinks.

[0147] 4) Drain the water, place the tissue in a suitable container, and add OCT embedding medium.

[0148] 5) Place the embedding box in liquid nitrogen for quick freezing and store the embedded tissue block in a -80°C refrigerator.

[0149] 6) Adjust the temperature of the cryostat to -15°C.

[0150] 7) Take the tissue block out from -80°C and equilibrate it in the cabinet for 30 minutes.

[0151] 8) Take out the specimen tray and place it at room temperature, and fix the tissue block in the specimen tray with OCT.

[0152] 9) The slice thickness was 6 μm and the slices were adsorbed on a glass slide at room temperature.

[0153] 10) Rinse the OCT with PBS.

[0154] 11) Add 4% PFA for fixation at room temperature for 15 min, and rinse with PBS three times.

[0155] 12) Allow to dry for 15-30 minutes and circle the tissue with a tissue pen.

[0156] 13) Block with 0.5% BSA at 20-22°C for 1 hour.

[0157] 14) Add FITC-anti-mouse IgG diluted 1:500 in PBS, just enough to cover the tissue (usually 25–50 μL). Incubate in a humidified chamber at room temperature in the dark for 30 min.

[0158] 15) Wash three times with PBS.

[0159] 16) Add 2 drops of mounting medium to the edge of the tissue, cover the slide, remove bubbles and excess liquid, and dry at room temperature.

[0160] 3. Experimental results

[0161] Antinuclear antibody (ANA) test results Figure 2 As shown, the results showed that the ANA antibody concentration of the compound heterozygous mutant mice constructed in Example 1 of the present invention was higher than that of the wild type, indicating autoimmunity.

[0162] Anti-ds-DNA antibody test results Figure 3 As shown, the results showed that the ds-DNA antibody concentration of the composite heterozygous mutant mice constructed in Example 1 of the present invention was higher than that of the wild type, indicating autoimmunity.

[0163] Urine protein concentration test results Figure 4 As shown, the results showed that the urine protein concentration of the compound heterozygous mutant mice constructed in Example 1 of the present invention was higher than that of the wild type, indicating kidney damage.

[0164] The morphological observation results of spleen Figure 5 As shown, the results showed that the spleen of the compound heterozygous mutant mouse constructed in Example 1 of the present invention was significantly larger than that of the wild type, indicating autoimmunity.

[0165] The results of spleen histological observation were as follows Figure 6 As shown, the results showed that the spleen of normal mice had a clear structure, without hyperplasia and germinal center formation, while the spleen white pulp of the compound heterozygous mutant mice constructed in Example 1 of the present invention had diffuse hyperplasia, fibrous thickening of the central artery wall, and germinal center formation, suggesting autoimmunity.

[0166] Kidney immune complex deposition results such as Figure 7 As shown, the results showed that normal mice had no immune complex deposition, while the compound heterozygous mutant mice constructed in Example 1 of the present invention had a large amount of immune complex deposition.

[0167] The above results prove that the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mouse model constructed in Example 1 of the present invention is a systemic lupus erythematosus mouse model.

[0168] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as falling within the protection scope of the present invention.

Claims

1. A method for constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X, characterized in that: The method comprises the following steps: (1) designing sgRNA sequences that recognize the p.T214I site and the p.K322X site respectively; (2) preparing sgRNA / Cas9 injection solutions respectively, and injecting the sgRNA / Cas9 injection solutions into mouse fertilized eggs respectively; (3) The obtained fertilized eggs were transplanted into pseudo-pregnant female mice to obtain p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice; (4) mating the p.T214I heterozygous mutant mice and mating the p.K322X heterozygous mutant mice to obtain p.T214I homozygous mutant mice and p.K322X homozygous mutant mice; (5) The p.T214I homozygous mutant mice were hybridized with p.K322X homozygous mutant mice to obtain a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

2. The method according to claim 1, characterized in that The sgRNA sequence that recognizes the p.T214I site is shown in SEQ ID NO: 1; The sgRNA sequence that recognizes the p.K322X site is shown in SEQ ID NO:

2.

3. The method according to claim 1, characterized in that The contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution are (8.0-15.0) ng / μL and (10-40) ng / μL, respectively.

4. The method according to claim 3, characterized in that The contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution were 12.5 ng / μL and 25 ng / μL, respectively.

5. The method according to claim 1, characterized in that The gene mutation site corresponding to the p.T214I site is c.641C>T; The gene mutation site corresponding to the p.K322X site is c.964A>T.

6. Use of the systemic lupus erythematosus mouse model constructed according to the method of any one of claims 1 to 5 in screening drugs for treating and / or preventing systemic lupus erythematosus.

7. A systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X, characterized in that: The mouse model is a mouse model constructed by the method according to any one of claims 1 to 5.

8. A CRISPR / Cas9 system for Rasgrp1 gene editing, characterized in that: The system comprises Cas9 mRNA and the sgRNA described in claim 1.

9. Use of the system according to claim 8 in constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

10. Application of the mutation sites p.T214I and p.K322X on the Rasgrp1 gene in constructing a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

Images