Specific probes, primers, kits and methods for detecting nucleic acid samples

Abstract

This invention provides a probe and primer combination, a standard, a detection kit, a real-time PCR detection method, and its application in detecting nucleic acid samples.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a probe and primer combination, standard, real-time PCR detection kit, and detection method for detecting nucleic acid samples. Background Technology

[0002] The maize transformant MN85N-E6 is an insect-resistant and glufosinate-tolerant transgenic maize material (Chinese Patent Application No. 2024119361109). It exhibits excellent resistance to lepidopteran pests such as the fall armyworm and corn borer, and good tolerance to glufosinate. This transformant can be used to breed insect-resistant and herbicide-resistant maize varieties. Establishing a transformant-specific detection method can provide an effective means for the identification and regulation of transgenic organisms, and provide technical support for the safety management of agricultural genetically modified organisms.

[0003] Transformant-specific detection mainly utilizes conventional PCR methods, but its drawbacks include low sensitivity, inability to monitor the PCR process in real time, and lack of quantification capabilities. With the development of molecular biology techniques, Real-time PCR (quantitative real-time PCR) has been widely used for transgenic detection. Compared to conventional PCR, it offers advantages such as shorter processing time, simpler operation, higher specificity, and higher sensitivity. The process can be monitored in real time, and the results can be directly observed and quantitatively detected.

[0004] Real-time PCR methods can be divided into two types: dye-based and probe-based methods. In dye-based real-time PCR, the fluorescent dye binds to double-stranded DNA and emits fluorescence. However, this binding is non-specific; primer dimers, DNA template, and other components in the system will also bind to it, resulting in low specificity. In contrast, the probe in the probe-based method specifically binds to the template, and its amplification curve reflects the accumulation of specific products, eliminating non-specific amplification components. Its sensitivity is 10 times higher than that of the dye-based method. Furthermore, the dye-based method only supports single-channel reactions. For multi-channel experiments or detecting different targets from the same sample, the probe-based method is the most commonly used. Summary of the Invention

[0005] Therefore, this invention provides probe and primer combinations, standards, detection kits, and real-time PCR detection methods for detecting nucleic acid samples. The aforementioned nucleic acid samples can be genomic DNA of the maize MN85N-E6 transformant, genomic DNA of MN85N-E6 transformant-derived lines, genomic DNA of mixed maize material containing the MN85N-E6 transformant, or nucleic acid samples containing MN85N-E6 identification information isolated from the above samples by methods such as PCR amplification. Since the sequence shown in SEQ ID NO. 1 is a specific sequence for confirming the identification information of the MN85N-E6 transformant, any sample containing nucleic acid molecules with the sequence shown in SEQ ID NO. 1 can be detected using the method provided by this invention.

[0006] This invention, through the design of highly sensitive and specific probe and primer pairs, can accurately identify the maize MN85N-E6 transformant, distinguishing it from conventional maize lacking MN85N-E6 and other transgenic maize materials. This detection method offers advantages such as high specificity, sensitivity, and ease of operation, overcoming the drawbacks of conventional PCR methods, such as cumbersome procedures and low detection sensitivity.

[0007] The present invention provides a probe, characterized in that: the nucleotide sequence of the probe is 5'-CAACTTTAGCTTGAGGCCGGCCCA-3'.

[0008] In some implementations, the probe is labeled with a fluorescent group at its 5' end and a quencher group at its 3' end. When the probe is in a free state, the fluorescence emitted by the fluorescent group is absorbed by the quencher group. During PCR amplification, the fluorescent group at the 5' end of the probe, which is tightly bound to the template, is cleaved by Taq polymerase, thereby moving away from the quencher group at the 3' end. The fluorescence emitted by the fluorescent group can then be received by the instrument, and the generated fluorescence signal is proportional to the amount of amplified product in the sample.

[0009] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB.

[0010] In some embodiments, the combination of the fluorescent group / quencher group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2;

[0011] In randomized tests using fluorescent and quencher groups, probes labeled with both fluorescent and quencher groups yielded specific detection results. Furthermore, probes labeled with FAM at the 5' end and BHQ1 at the 3' end had the lowest labeling cost and can be considered the optimal probe labeling scheme.

[0012] The present invention also provides a probe and primer combination, characterized in that: it includes the above-mentioned probe and two primers, wherein the nucleotide sequences of the primers are 5'-CGTTTCCCGCCTTCAGTTTA-3' and 5'-CCCTTCCATGGCTGAAATAGTG-3';

[0013] The probe and primer combination described above was selected through software design and experimental screening and verification, and is located at the downstream boundary of the in vitro insertion sequence of the MN85N-E6 transformant.

[0014] The present invention also provides a standard, characterized in that: the standard is one or more nucleic acid samples with a concentration of not less than 60 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0015] In some implementations, the standard comprises five samples with concentrations of 6.0 × 10⁻⁶. 5 Copy / μL, 6.0×10 4 Copy / μL, 6.0×10 3 Copy / μL, 6.0×10 2 MN85N-E6 genomic DNA at 6.0 × 10 copies / μL and 6.0 × 10 copies / μL; the DNA sample contained the nucleic acid molecule shown in SEQ ID NO. 1;

[0016] In some embodiments, the preparation method of the standard is as follows: take an MN85N-E6 genomic DNA sample with a concentration of 1.5 μg / μL, and dilute it sequentially by 1-fold, 10-fold, and 10-fold. 2 times, 10 3 Multiplied by 10 4 times.

[0017] The present invention also provides a detection kit, characterized in that: the detection kit includes the above-described probe and primer combination and the above-described standard;

[0018] In some implementations, the test kit includes:

[0019] The probe has the sequence 5'-CAACTTTAGCTTGAGGCCGGCCCA-3';

[0020] Primer 1 has the sequence 5'-CGTTTCCCGCCTTCAGTTTA-3';

[0021] Primer 2 has the sequence 5'-CCCTTCCATGGCTGAAATAGTG-3';

[0022] The standard consisted of five samples with concentrations of 6.0 × 10⁻⁶. 5 Copy / μL, 6.0×10 4 Copy / μL, 6.0×10 3 Copy / μL, 6.0×10 2 MN85N-E6 genomic DNA samples of 6.0 × 10 copies / μL and 6.0 × 10 copies / μL; the nucleic acid samples contained nucleic acid molecules with the sequence shown in SEQ ID NO. 1;

[0023] The probe is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end.

[0024] The present invention also provides a Real-time PCR detection method, characterized in that: the above-mentioned detection kit is used for Real-time PCR detection, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.6 μM, and the final concentration of the probe is 0.3 μM.

[0025] The present invention also provides the application of the above-mentioned probe and primer combination, standard, detection kit, and detection method in the quantitative detection of nucleic acid samples; wherein the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.

[0026] The beneficial effects of this invention are as follows: Through software design and multiple experimental screenings, a combination of one probe and two primers was obtained from a large number of probe / primer combinations. Based on this, a Real-time PCR detection method was established and optimized using standards with appropriate concentration gradients. Using the above-mentioned probe and primer combination, standards, detection kit, and Real-time PCR detection method, nucleic acid samples containing SEQ ID NO. 1 with a concentration of not less than 60 copies / μL can be specifically detected, and MN85N-E6 material can be effectively distinguished from other maize materials that do not contain MN85N-E6, exhibiting extremely high sensitivity and specificity. Attached Figure Description

[0027] Other features, objects, and advantages of this application will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0028] Figure 1 Sensitivity test curve. Where 1: 6.0 × 10⁻⁶ 5 Copy / μL; 2: 6.0 × 10 4Copy / μL; 3: 6.0 × 10 5 Copy / μL; 4: 6.0 × 10 2 Copy / μL; 5: 6.0 × 10 1 6: 6.0 copies / μL; 6: 6.0 copies / μL.

[0029] Figure 2 Standard curve and linear equation.

[0030] Figure 3 Specific sample detection test. Among them, 1: a mixture of B104 and MN85N-E6 (sample 1); 2: a mixture of B104 and MN85N-E1 (sample 2). Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings. The following examples are only used to illustrate the present invention and do not limit the scope of the present invention.

[0032] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and intact plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.

[0033] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into recipient cells through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."

[0034] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction sites also exist in transformed organisms, where two DNA segments are joined together in a manner found in natural organisms. "Junction DNA" refers to DNA containing junction sites.

[0035] The MN85N-E6 transformant is a plant and seed comprising transgenic maize MN85N-E6 and its plant cells or renewable parts thereof, wherein the plant parts of MN85N-E6 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, filaments, inflorescences, ear-like clusters, leaves, and products derived from maize plant MN85N-E6, such as maize stalks, maize flour, maize oil, and biomass remaining in the maize crop field.

[0036] The term "probe" refers to a segment of isolated nucleic acid molecule bound with a conventionally detectable marker or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one DNA strand from the genome of transgenic maize MN85N-E6, regardless of whether the genomic DNA originates from transgenic maize MN85N-E6 or its seeds, from plants or seeds of transgenic maize MN85N-E6 and other derived lines, or from nucleic acid molecules containing MN85N-E6 identification information isolated from MN85N-E6. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0037] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this invention relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0038] Example 1: Design and screening of specific probe and primer combinations

[0039] Specific detection methods for transformants require the design of probes and primers at the boundary sequences upstream and downstream of the insertion site, and the PCR amplification products need to include both the exogenous sequence and the maize genome sequence. Therefore, the probes and primers must first be designed based on the boundary sequence of the maize MN85N-E6 insertion site.

[0040] 1. Design probe and primer combinations

[0041] A portion (100-600 bp) of the upstream or downstream boundary sequence is input as a template into the software (such as ABI PrimerExpress 3.0). The template sequence must contain both the maize genome sequence (at least 50 bp in length) and the exogenous insertion sequence (at least 50 bp in length). The two template sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0042] After setting the relevant parameters in the software according to the following requirements, a large number of probe and primer combinations were obtained. Each combination contains 2 primers and 1 probe.

[0043] The probe and primers must meet all of the following requirements:

[0044] ① The primer length is between 18 and 25 bp, and the probe length is between 18 and 30 bp;

[0045] ② The Tm value of the primers is 58~60℃, and the Tm value of the probe is 8-10℃ higher than that of the primers;

[0046] ③ Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primer, or between the probe and primer;

[0047] ④ The first base at the 5' end of the probe is not G;

[0048] ⑤ The two primers are located in the maize genome and the vector insertion sequence, respectively.

[0049] ⑥ The length of the PCR product is between 80-300 bp.

[0050] Finally, six probe and primer combinations with high software scores were selected as candidate combinations for further screening. The probe and primer sequences of candidate combinations A1 to A6 are shown in Table 1.

[0051] Table 1. Six candidate probes and primers with high software design scores.

[0052] combination Primer 1 Primer 2 probe P A1 CGTTTCCCGCCTTCAGTTTA CCCTTCCATGGCTGAAATAGTG CAACTTTAGCTTGAGGCCGGCCCA A2 TCAGTGTTTGACAGGACCCAACT CTCCATCTCAAGTGAAACATGGTT AGGCCGGCCCATCTTCACTATTTCA A3 TTGACAGGACCCAACTTTAGCTT CTCCATCTCAAGTGAAACATGGTT AGGCCGGCCCATCTTCACTATTTCA A4 CGTTTCCCGCCTTCAGTTTA TCCAGGTCGCCCTTCCAT CAACTTTAGCTTGAGGCCGGCCCA A5 AGCTTGGATCAGATTGTCGTTT CCCTTCCATGGCTGAAATAGTG CAACTTTAGCTTGAGGCCGGCCCA A6 CGTCCGCAATGTGTTATTAAGTTG GCGCAAGATTTGGTGTATTGG TCATGCCAGCTATTGGTGATTCAGCCA

[0053] 2. Primer synthesis and screening

[0054] The six primer sets shown in Table 1 were synthesized, and specific primers were screened. The screening process is as follows:

[0055] (1) Primers 1 and 2 of the six candidate combinations were tested using conventional PCR. The electrophoresis results are shown in Table 2. The results showed that combination A3 failed to amplify and produced no band; while combinations A2, A4, and A5 amplified two bands, indicating non-specific amplification; only combinations A1 and A6 amplified single specific bands of the expected size. Therefore, primers 1 and 2 for combinations A1 and A6 met the requirements and were further tested; the other combinations were eliminated.

[0056] Table 2. Specific primers for routine PCR screening

[0057] combination Number of amplified bands Band size (bp) Does it meet the requirements? A1 1 Approximately 100 yes A2 2 Approximately 100, 100-250 no A3 0 - no A4 2 Approximately 100, 100-250 no A5 2 Approximately 100, 100-250 no A6 1 Approximately 100 yes

[0058] (2) Primers 1 and 2 of combinations A1 and A6 were detected by Real-time PCR using the SYBR Green dye method. The results of the Real-time PCR reaction are shown in Table 3. The results showed that combination A6 failed to amplify, with no steadily rising amplification curve and no Ct value; combination A1 had a normal amplification curve, and the Ct value was <35, with a single peak in the melting curve. Therefore, primers 1 and 2 of combination A1 met the requirements and could be further tested. Combination A6 was eliminated.

[0059] Table 3. Specific primers for screening by SYBR Green dye-based real-time PCR

[0060] combination Amplification curve Ct value Dissolution curve Does it meet the requirements? A1 have 29.10 Single peak yes A6 none - - no

[0061] 3. Probe synthesis and screening

[0062] The probe of the synthetic combination A1 was modified with the fluorescent labeling group FAM at the 5' end and the fluorescent quenching group BHQ1 at the 3' end.

[0063] The probe and primers for combination A1 were detected using real-time PCR, and the results are shown in Table 4. The results indicate that combination A1 was successfully amplified, with a Ct value of 30.01.

[0064] Therefore, combination A1 was selected as the probe and primer for quantitative detection of maize transformant MN85N-E6.

[0065] Table 4. Specific primer and probe combinations for Real-time PCR screening using the probe method.

[0066] combination Amplification curve Ct value Filtering results A1 have 30.01 √

[0067] The probe and primers for combination A1 are located downstream of the exogenous insert sequence. The specific sequences and positions are shown below (lowercase letters represent vector sequences, uppercase letters represent genomic sequences, bold parts indicate primer positions, and underlined parts indicate probe positions):

[0068] cgtttcccgccttcagtttaaactatcagtgtttgacaggaCC CAACTTTAGCTTGAGGCCGGCCCA TCTTCACTATTTCAGCCATGGAAGGG

[0069] The probe and primer sequences are as follows:

[0070] Probe P: FAM-CAACTTTAGCTTGAGGCCGGCCCA-BHQ1;

[0071] Primer 1: 5'-CGTTTCCCGCCTTCAGTTTA-3';

[0072] Primer 2: 5'-CCCTTCCATGGCTGAAATAGTG-3'.

[0073] Example 2 Preparation of Standards

[0074] To quantify the initial template amount in a sample using real-time PCR, a standard curve needs to be constructed using standards with known copy numbers. Then, the Ct value of the sample to be tested is obtained through PCR, and finally, the copy number of the sample is calculated from the standard curve. Therefore, suitable standards must first be prepared, and the preparation method is as follows:

[0075] I. Genomic DNA Extraction from Maize MN85N-E6

[0076] Extraction was performed using the CTAB method, and the specific steps are as follows:

[0077] 1) Take 0.1 g of corn MN85N-E6 sample leaves, grind them into powder, add 500-800 μL of CTAB, and incubate at 65℃ for 0.5 h;

[0078] 2) Add 700 μL of chloroform or chloroform:isoamyl alcohol (24:1), shake slowly, centrifuge at 12000 rpm for 15 min, and take 400-700 μL of the supernatant;

[0079] 3) Add 1 mL of pre-cooled anhydrous ethanol or isopropanol, mix thoroughly, centrifuge at 12000 rpm for 10 min, and discard the supernatant;

[0080] 4) Wash the precipitate with 75% alcohol, centrifuge at 12000 rpm for 5 min, discard the alcohol, and invert to absorb water and dry.

[0081] 5) Dissolve the DNA in 50 μL ddH2O, take 5 μL for electrophoresis, and then use a UV spectrophotometer to determine the DNA concentration as 1.5 μg / μL.

[0082] II. Preparation of Standards with Concentration Gradients

[0083] When performing Real-time PCR, the concentration of standard templates should be expressed in "copies / μL".

[0084] Calculation formula:

[0085] Template concentration (copies / μL) = Avogadro's constant × number of template moles, where Avogadro's constant = 6.02 × 10⁻⁶. 23 Copy / mol, template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).

[0086] According to the above formula, a 1.5 μg / μL MN85N-E6 genomic DNA solution is 6.02 × 10⁻⁶. 23 copies / mol × (1.5 × 10⁻⁶) -6 g / μL) / (2300*10 6 ×660 g / mol), which is 6.0×10 5 Copy / μL

[0087] Take 1 μL of the above solution and perform serial dilutions of 10-fold to obtain concentrations of 6.0 × 10⁻⁶. 5 Copy / μL, 6.0×10 4 Copy / μL, 6.0×10 3 Copy / μL, 6.0×10 2 Standards at concentrations of 6.0 × 10 copies / μL, 6.0 × 10 copies / μL, and 6.0 copies / μL. Store the standards at -20°C for later use.

[0088] Example 3: Establishment and optimization of probe-based real-time PCR reaction system

[0089] The present invention obtained a usable probe and primer combination through the operation of Example 1, and obtained a series of concentration gradient standards through Example 2. However, whether the specific Real-time PCR reaction system can achieve better results is also affected by factors such as probe and primer concentration. Therefore, in order to obtain efficient and accurate quantitative results, further optimization of the PCR reaction system is required.

[0090] I. Establishing a preliminary Real-time PCR reaction system

[0091] The probe and primer combination A1 screened in Example 1 was diluted, and deionized water was added to dilute it to a working solution of 10 μM. Real-time PCR amplification using the probe method was then performed to establish the reaction system.

[0092] The PCR reaction mixture consisted of: 10 μL 2×qPCR Mix, 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 0.25 μL 10 μM probe, 1 μL template DNA, and ddH2O to a total volume of 20 μL. MN85N-E6 genomic DNA was used as the template, and ddH2O served as a blank control.

[0093] The real-time PCR reaction program is as follows: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 40 s (collect fluorescence signal), for a total of 40-45 cycles.

[0094] II. Optimize the Real-time PCR Reaction System

[0095] Five concentration gradients were set for the primers: 0.1, 0.2, 0.4, 0.6, and 0.8 μM, corresponding to probe concentrations that were half the primer concentrations. The Real-time PCR results for each treatment are shown in Table 5.

[0096] Table 5. Testing with different probe and primer concentrations

[0097] Final primer concentration (μM) Final probe concentration (μM) Ct 0.1 0.05 31.14 0.2 0.1 30.55 0.4 0.2 28.65 0.6 0.3 27.47 0.8 0.4 30.19

[0098] The results showed that the PCR reaction system with a primer concentration of 0.6 μM and a probe concentration of 0.3 μM had the lowest Ct value and the highest fluorescence signal value. Therefore, the final primer concentration for subsequent experiments was determined to be 0.6 µM and the probe concentration to be 0.3 µM.

[0099] The optimized reaction system is as follows:

[0100] 10 μL of 2×qPCR Mix, 1.2 μL of 10 μM forward primer, 1.2 μL of 10 μM reverse primer, 0.6 μL of 10 μM probe, 1 μL of template DNA, and ddH2O to a total volume of 20 μL. MN85N-E6 genomic DNA was used as the template, and ddH2O served as a blank control.

[0101] Example 4 Sensitivity Test

[0102] Sensitivity refers to the lowest copy number of a sample that a PCR amplification reaction can detect, i.e., the limit of detection. When using real-time PCR to detect standards of different concentrations, if a standard of a certain concentration can form an amplification curve but the Ct value is >35, then the standard concentration is considered to have exceeded the limit of detection of the PCR system.

[0103] Using the probe and primer combination A1 described in Example 1, the reaction system optimized in Example 3, and the standard from Example 2 (concentration 6.0 × 10⁻⁶), the reaction was carried out. 5 Using ~6.0 copies / μL as template (each concentration was tested in triplicate), and ddH2O as a blank control, real-time PCR amplification was performed to determine the limit of detection of the detection method of this invention. Amplification curves were obtained based on the fluorescence signals detected by the instrument, and the results are shown below. Figure 1 See Table 6. The results show that when the standard concentration is <60 copies / μL, the amplification curve Ct > 35. Therefore, the detection limit for Real-time PCR is 60 copies / μL.

[0104] The above sensitivity test results indicate that when a sample does not show a typical amplification curve or the Ct value is greater than 35, that is, the concentration of the transformant in the sample is less than 60 copies / μL, the MN85N-E6 transformant is considered not to be detected in the sample, and the test result is negative.

[0105] Table 6 Sensitivity Test Results

[0106] sample 1 2 3 4 5 6 Template concentration (copies / μL) <![CDATA[6.0×10 5 ]]> <![CDATA[6.0×10 4 ]]> <![CDATA[6.0×10 3 ]]> <![CDATA[6.0×10 2 ]]> 6.0×10 6.0 Ct 22.66 24.74 27.09 30.01 33.22 36.49

[0107] Example 5: Plotting a Standard Curve

[0108] Real-time PCR was performed using multiple standards at gradient concentrations as templates, and Ct values ​​were recorded. A standard curve was plotted based on the initial template amount (logarithm of copy number) and Ct values ​​to obtain the standard equation. When it is necessary to quantify the initial template of the test sample, only the amplification curve and Ct value need to be obtained, and the initial template amount of the test sample can be calculated by substituting them into the standard equation.

[0109] Using the standard from Example 2 (concentration 6.0 × 10⁻⁶) 5 Using ~6.0×10 copies / μL) as template (three parallel experiments for each concentration), ddH2O as blank control, Real-time PCR amplification was performed using the probe and primer combination A1 from Example 1 and the reaction system optimized in Example 3.

[0110] Plot a standard curve with the logarithm of the standard concentration on the x-axis and the Ct value on the y-axis, see [reference]. Figure 2The standard curve equation of this invention is y = -2.6537x + 37.583 (y represents the Ct value, and x is the logarithm of the copy number). The standard curve exhibits a good linear relationship, with R² = 0.9805 and a high correlation coefficient, meeting the requirements for Real-time PCR quantitative detection.

[0111] Example 6 Detection Kit

[0112] Prepare a kit for detecting maize MN85N-E6 according to the following composition: 2×qPCR Mix, 10 μM forward primer, 10 μM reverse primer, 10 μM probe, and standard from Example 2 (concentration 6.0×10⁻⁶). 5 Copies / μL ~6.0×10 2 (Copy / μL) and ddH2O.

[0113] The primers and probes are the combination A1 described in Example 1.

[0114] The reaction system for this kit can be: 10 μL of 2×qPCR Mix, 1.2 μL of 10 μM forward primer, 1.2 μL of 10 μM reverse primer, 0.6 μL of 10 μM probe, 1 μL of template DNA, 6 μL of ddH2O, and a total reaction volume of 20 μL.

[0115] The reaction program for Real-time PCR using this kit is as follows: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 40 s (collect fluorescence signal), for a total of 40-45 cycles.

[0116] When using this kit to detect samples, the amplification curve is obtained from the fluorescence signal detected by the instrument, and the sample copy number is calculated based on the standard equation established by the standard and the Ct value of the sample to be tested.

[0117] Example 7: Specificity Tests and Sample Detection

[0118] Genomic DNA was extracted from maize transformant MN85N-E6, recipient control B104, and other transformant material MN85N-E1 using the DNA extraction method (CTAB method) described in Example 2. Genomic DNA from B104 and MN85N-E6 was mixed as Sample 1, and genomic DNA from B104 and MN85N-E1 was mixed as Sample 2. ddH2O served as a blank control. Real-time PCR amplification was performed using the kit described in Example 6 and the reaction system optimized in Example 3 for specificity testing. Amplification curves were obtained based on the fluorescence signals detected by the instrument, as shown below. Figure 3 As shown.

[0119] The copy number of each sample was calculated based on the Ct value in the amplification curve, and the results are shown in Table 7: The Ct value of sample 1 was 23.97, and the copy number was 1.3 × 10⁻⁶. 5 The test result for sample 1 was positive; the amplification curve Ct value for sample 2 was greater than 35, and the copy number was lower than the limit of detection (60 copies / μL), therefore, the test result was negative. This demonstrates that the detection system established in this invention has excellent specificity.

[0120] Table 7 Results of Specificity Tests on Test Samples

[0121] sample Ct Copy number 1 23.97 <![CDATA[1.3×10 5 ]]> 2 38.61 0.4 <![CDATA[ddH2O]]> - -

[0122] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A probe and primer combination, characterized in that, The nucleotide sequence of the probe is 5'-CAACTTTAGCTTGAGGCCGGCCCA-3', and the nucleotide sequences of the primers are 5'-CGTTTCCCGCCTTCAGTTTA-3' and 5'-CCCTTCCATGGCTGAAATAGTG-3'.

2. The probe and primer combination according to claim 1, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end; The fluorescent group is any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group is any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB.

3. The probe and primer combination according to claim 2, characterized in that, The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2.

4. The probe and primer combination according to claim 3, characterized in that, The fluorescent group is FAM; the quenching group is BHQ1.

Images