Rice g1-1437 gene mutant, molecular marker and application thereof

Abstract

The present application relates to the technical field of genetic engineering, in particular to a rice G1 gene mutant g1-1437, its molecular marker and application. The rice G1 gene mutant g1-1437 provided by the present application takes rice G1 gene as reference sequence, the nucleotide sequence of the rice G1 gene is shown as SEQ ID NO. 8; the gene mutant g1-1437 comprises a mutation site that base C at the 112th position is mutated into base T. The mutation causes the chaff homologous transformation of rice into glume shell substances, which can be used as a phenotype screening marker of transgenic rice. The present application further provides a molecular marker identification method of the mutant, which has a good application prospect in the transference of new germplasm.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a rice G1 gene mutant g1-1437 and its molecular markers and applications. Background Technology

[0002] Rice is a major food crop worldwide, and its yield is crucial for food security. Spikelet development is a key yield trait. Unlike dicotyledons, rice spikelets possess a unique floret structure, thus being considered a model crop for monocotyledons. A rice spikelet consists of three florets, with the terminal floret being a complete flower, while the two lower florets are reduced to short, small glumes. Spikelet formation is finely regulated by a series of genes, with the "ABCDE" regulatory model of dicotyledons being the most clearly understood. Although significant differences exist between monocotyledons and dicotyledons, multiple studies have shown that monocotyledons possess a similar "ABCDE" regulatory model. Five classes of genes have been cloned in rice, most of which are MADS-box genes. For example, the class A genes RAP1B (OsMADS14) and RAP1A (OsMADS15), which determine the characteristics of floral meristems, are homologous to the Arabidopsis AP1 gene and belong to the FUL type. Mutations in OsMADS14 can shorten the flowering period, while mutations in OsMADS15 cause elongation of the inner and outer glumes. In class B genes, rice's OsMADS2 and OsMADS4 are homologous to Arabidopsis PI (PSEUDOGENE), and OsMADS16 (SPW1) is homologous to AP3; all of them control the development of sclerotia and stamens. Class C genes are involved in the formation of stamens and carpels. Among them, OsMADS3 and OsMADS58 are homologous to Arabidopsis AG, while DROOPING LEAF (DL) is homologous to CRC. Only OsMADS13 has been identified in class D genes, which mainly participates in the formation of carpels and ovules. There are many types of E-class genes, such as OsMADS7 (OsMADS45) and OsMADS8 (OsMADS24), which are homologous to Arabidopsis SEP; OsMADS5 (OsM5) and OsMADS34, which are homologous to AGL6; and OsMADS1 / LEAFY HULL STERILE 1 (LHS1), which is homologous to LOFSEP. These five classes of genes work together to regulate the development of floral organs, laying the foundation for elucidating the mechanism of floral organ development in rice. Mutations in these genes have also created rice seeds with various appearance phenotypes.

[0003] The lemma is a unique floral organ in rice, generally considered a degenerated floret. Due to the difficulty in obtaining mutants, there are few reports on this topic. Currently, the cloned genes related to lemma development mainly include G1 / ELE, OsMADS34, and OsEG1. OsMADS34 and OsEG1 are pleiotropic genes; their mutants exhibit homologous transformation of the lemma into an elongated lemma-like structure, and also change the panicle type. G1, on the other hand, is a monotropic gene; its mutants show significantly longer lemmas, but other agronomic traits remain normal, with no impact on yield or quality. Therefore, G1 is a good phenotypic marker. Utilizing these traits that do not affect yield but exhibit significant phenotypic differences, rice can be used for seed sorting, assisted breeding, and gene linkage markers. Therefore, discovering mutant materials for various floral organs is of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a rice G1 gene mutant g1-1437, its molecular identification method, and its application.

[0005] This invention first discovered a naturally occurring floral organ mutant in the field, whose floret structure differed significantly from the wild type, mainly in that the glumes were elongated and level with the palea and lemma. F1 plants were obtained through self-pollination, and morphological, histochemical, and genetic identification was performed on the F1 plants. Then, the corresponding mutant gene was obtained through map-based cloning and DNA sequencing.

[0006] Based on the above findings, the present invention provides the following technical solution:

[0007] The present invention provides a rice G1 gene mutant g1-1437, which uses the rice G1 gene as a reference sequence. The nucleotide sequence of the rice G1 gene is shown in SEQ ID NO.8. The gene mutant g1-1437 contains a mutation site in which the C base at position 112 is mutated to the T base.

[0008] This mutant replaces a C base at position 112 of the G1 gene coding region with a T base, resulting in the codon CAG encoding glutamine being changed to the stop codon TAG. The mutated G1 gene was named g1-1437.

[0009] Specifically, the gene mutant g1-1437 contains a nucleotide sequence as shown in SEQ ID NO.1.

[0010] The rice G1 gene mutant g1-1437 provided by the present invention is a rice G1 gene mutant in which a C base at position 112 is replaced by a T base. The mutation site is located in the coding region of gene LOC_Os07g04670, and its nucleotide sequence is shown in SEQ ID No.1.

[0011] The present invention also provides biological materials containing the gene mutant g1-1437, the biological materials including expression cassettes, vectors or host cells.

[0012] The aforementioned expression cassette can be a DNA fragment obtained by linking the gene mutant with elements that regulate its transcription or expression.

[0013] The aforementioned vectors can be cloning vectors or expression vectors.

[0014] The host cells mentioned above can be microbial cells or non-reproductive plant cells.

[0015] This invention also provides the use of the above-mentioned gene mutant g1-1437 or the above-mentioned biological material in any of the following aspects:

[0016] (1) Application in the homologous transformation of rice glumes into glume-like organs;

[0017] (2) Application in the preparation of transgenic rice; such as its application in the preparation of transgenic rice with recessive abnormal glumes;

[0018] (3) Application in rice improvement breeding and seed production;

[0019] (4) Application as a phenotypic screening marker for transgenic rice;

[0020] (5) Application in elongating the glumes in the floret structure of rice panicles.

[0021] The present invention also provides a molecular marker for detecting the above-mentioned gene mutant g1-1437, wherein the molecular marker is a nucleotide sequence containing a polymorphism of C / T at position 112 of the sequence shown in SEQ ID NO.1.

[0022] The present invention also provides primers for detecting the above-mentioned molecular markers, which comprise the primers shown in SEQ ID NO.2-3.

[0023] This invention provides a molecular marker for detecting the rice G1 gene mutant g1-1437, which can detect a mutation in which a C base at position 112 of the G1 gene is replaced by a T base. Preferably, this molecular marker can be obtained by PCR amplification and SnaBI restriction enzyme digestion using the following primer pair, the nucleotide sequences of which are:

[0024] Upstream primer 1437_F: GGGACTGGCAGACCTTTACG (as shown in SEQ ID NO.2),

[0025] Downstream primer 1437_R: GTCTTGCCGAAGCGGTCGAGGT (as shown in SEQ ID NO.3).

[0026] The present invention also provides reagents or kits containing the above primers.

[0027] And the application of the above molecular markers or primers or reagents or kits in detecting the gene mutant g1-1437 or abnormal glume development in rice.

[0028] The present invention further provides a method for identifying the above-mentioned gene mutant g1-1437 or abnormal rice glume development, comprising:

[0029] The steps are as follows: amplify the G1 gene fragment of the rice to be tested using the above primers, reagents or kits, and cut the amplified fragment with SnaBI restriction enzyme.

[0030] In the method of this invention, if the length of the amplified fragment after cutting is 118 bp, then the rice to be tested does not contain the gene mutant g1-1437 and the rice glumes develop normally; if the length of the amplified fragment after cutting is 99 bp, then the rice to be tested contains the gene mutant g1-1437 and the rice glumes develop abnormally. That is, if, after amplification with the above primers, the product is 19 bp shorter than the fragment of wild-type 1437 under SnaBI enzyme digestion, it indicates that the tested plant contains the rice G1 gene mutant g1-1437.

[0031] Specifically, in the method of the present invention, the amplified fragment is digested with SnaBI restriction enzyme at 37°C, and the digested product is finally detected with 6% polyacrylamide gel.

[0032] The beneficial effects of this invention are as follows:

[0033] The rice G1 gene mutant provided by this invention is a naturally occurring variant found in the field, in which a C base at position 112 of the coding region is replaced by a T base. This mutation causes significant elongation of the rice glume without affecting quality or yield, and can be used for rice seed sorting, assisted breeding, and gene linkage markers. This invention also provides a molecular marker identification method for this mutant, which has promising applications in the development of new germplasm. Attached Figure Description

[0034] Figure 1 This is a comparison diagram of plant type and ear type between wild-type plants and g1-1437 mutant in Example 1; A in the diagram is a comparison diagram of plant type, and B in the diagram is a comparison diagram of ear type.

[0035] Figure 2 These are images of the glumes (A in the image), stamens (B in the image), and pistils (C in the image) of the g1-1437 mutant in Example 1.

[0036] Figure 3 This is a diagram showing the results of iodine staining of pollen from the g1-1437 mutant.

[0037] Figure 4 This is a schematic diagram of the mutation sites of the G1 gene in the g1-1437 mutant in Example 1.

[0038] Figure 5 This is a comparison diagram of the G1 gene protein sequences of the wild type and the g1-1437 mutant in Example 1. The different amino acid residue sequences are shown in black.

[0039] Figure 6 This is an electrophoresis image of the SnaBI enzyme digestion products after PCR of the G1 gene mutation sites of wild-type 1437, g1-1437, and 31 randomly selected conventional rice varieties in Example 2. Lanes 1-33 are, in order: g1-1437, wild-type 1437, Zhonghua 11, Nongxiang 32, Huazhan, Zhongxiang Huangzhan, Huanghuazhan, Yuzhenxiang, Wushansimiao, Lüyinzhan, Yujingruanzhan, Hefengsimiao, Yuehangxinzhan, Wushansimiao, Yuenongsimiao, Xiangyaxiangzhan, Meixiangzhan 2, Nihonbashi, Lianjing 7, Liannuo 1, Zhenghan 10, Yuejingyouzhan, Guangjingsimiao, Guangjinglizhan, Wufeng B, Nongken 58, Daohuaxiang 2, Gufengzhan, Heliyouzhan, Guinongzhan, Nanguizhan, Chanxiangzhan, Jinnongsimiao.

[0040] Figure 7 This is the technical roadmap for hybridization and conversion in Example 3. Detailed Implementation

[0041] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0042] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the embodiments are all commercially available.

[0043] Example 1: Obtaining and identifying the rice G1 gene mutant g1-1437

[0044] 1. Obtaining the g1-1437 mutant

[0045] In the summer of 2019, a naturally mutated plant was discovered among the offspring of a cross between Huazhan (number 1437) and Taifeng B. This plant was bagged and self-pollinated to obtain F1 strains. In July of the following year, 300 F1 plants were planted in fields in Luoniushan, Hainan. After transplanting, careful observation was conducted during the tillering, heading, flowering, and grain-filling stages. Phenotypic stable lines were selected for self-pollination, and individual plants were harvested and preserved.

[0046] 2. Phenotypic and genetic analysis of small flowers

[0047] Field observations of the g1-1437 mutant showed no difference from the wild type in plant height, ear length, and leaf color. Figure 1 The length of the floret guarding is longer than that of the wild type (see Table 1 for specific data), and most of them are level with the palea and lemma. Figure 2 Flowering florets were collected from the field. Anthers were removed with tweezers and gently squeezed into an iodine-potassium iodide solution (0.6% KI, 0.3% I2, w / w). The anthers were then dropped onto a glass slide, covered with a coverslip, and the pollen iodine staining was observed and photographed under a microscope. Both wild-type and mutant pollen stained blue-black, indicating that male fertility was not affected. Figure 3 The mutant underwent self-pollination with bagging, and the seed setting rate was statistically analyzed. The results showed that the seed setting rate of the mutant was 85.6%, which was not significantly different from the wild type's 86.2%, indicating that the female function of the mutant was normal. The number of grains per ear, number of tillers, and yield per plant were statistically analyzed for the wild type and the g1-1437 mutant (see Table 1 for specific data). The results showed that there were no significant differences between the two in the three agronomic traits, indicating that their yields were not affected.

[0048] F2 generation plants were planted, and the abnormality of floral organs was observed. Among them, 419 plants had normal flower development, while 144 plants had abnormal floral organs (the length of the glumes of the florets was longer than that of the wild type), which met the 3:1 segregation, indicating that the abnormal floral spike trait was controlled by a single recessive gene.

[0049] Table 1 Comparison of agronomic traits between g1-1437 mutant and wild type

[0050] wild type g1-1437 Length of the scapula (cm) 0.13±0.43 0.73±0.2 Number of grains per ear (grains) 179.0±12 181.6±8.6 Tillers (number) 11.3±2.3 9.6±2.4 Yield per plant (grams) 48.90±5.75 46.95±6.58

[0051] 3. Leaf sampling and DNA extraction

[0052] Rice genomic DNA was extracted using the CTAB method. The specific steps are as follows: A 3cm long rice leaf was taken and ground in 800μL extraction buffer [1.5% (w / v) CTAB, 1.05mol / L NaCl, 75mmol / L Tris-HCl (pH 8.0), 15mmol / L EDTA (pH 8.0)], and collected into a 1.5mL centrifuge tube. The tube was incubated at 65℃ for 30min, occasionally inverting to mix. 800μL of chloroform:isoamyl alcohol (24:1 v / v) was added, and the mixture was inverted for 15min. The tube was centrifuged at 12000rpm for 10min at room temperature. 450μL of the supernatant was aspirated and transferred to a new 1.5mL centrifuge tube. Two volumes of 95% ethanol were added, and the mixture was mixed and precipitated at -20℃ for 30min. The tube was then centrifuged at 12000rpm for 15min. The 95% ethanol was discarded, and the precipitate was washed with 75% ethanol. Discard the 75% ethanol, dry the product, and then add 100 μL of sterile ddH2O to dissolve the DNA.

[0053] 4. PCR reaction and product recovery

[0054] Primers were designed based on the genomic sequence of the G1 gene to amplify the DNA of wild-type 1437 and g1-1437 mutants.

[0055] The primer pairs used to amplify G1 are shown in Table 2 below.

[0056] Table 2 Primer pair sequences used for G1 amplification

[0057]

[0058] The PCR reaction system consisted of: 1 μL 10× reaction buffer, 0.25 μL 10 mM dNTPs, 0.25 μL 10 μM forward primer and 0.25 μL 10 μM reverse primer, 0.5 U Taq enzyme, 1 μL 10 ng / μL template DNA, and ultrapure water to bring the total volume to 10 μL. The PCR reaction program was: denaturation at 94℃ for 5 min, followed by the following cycles: denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for 30 cycles. After each cycle, an extension at 72℃ for 5 min was performed to terminate the reaction. A 1.5% agarose gel was prepared and electrophoresed at 5 V / cm for 30 min. The PCR products were recovered using a commercially available DNA gel extraction kit.

[0059] 5. DNA and amino acid sequence analysis

[0060] The recovered PCR product DNA from the wild-type and mutant rice was sequenced using an ABI 3730 sequencer. The forward and reverse primers listed in Table 2 were used for sequencing. The bidirectional sequencing results were assembled using the common DNA sequence analysis software DNAman 6.0. The mutant gene of the rice G1 gene was named g1-1437. The full-length nucleotide sequence of the g1-1437 mutant G1 gene is shown in SEQ ID NO.1, consisting of 959 bases. Comparison of the wild-type and mutant sequences revealed that a C base at position 112 of the G1 gene genome sequence was replaced by a T base. This mutation site is located in the coding region (see...). Figure 4 Protein sequence analysis showed that this mutation caused premature termination of translation, resulting in protein truncation and loss of activity (see [link]). Figure 5 (The amino acid sequence differences between the g1-1437 mutant and the wild-type G1 protein are shown in black).

[0061] Example 2: Primer design for mutation site detection and genotype-mutation site verification

[0062] Gene-specific primers were designed based on the sequences flanking the mutation site obtained in Example 1:

[0063] Upstream primer 1437_F: GGGACTGGCAGACCTTTACG (as shown in SEQ ID NO.2)

[0064] Downstream primer 1437_R: GTCTTGCCGAAGCGGTCGAGGT (as shown in SEQ ID NO.3).

[0065] If, after amplification using the above primers and digestion with SnaBI, the product is 19 bp shorter than the fragment of wild-type 1437, it indicates the presence of the rice G1 gene mutant g1-1437 in the tested plant. Leaf DNA was extracted from 31 common rice varieties and the 1437 mutant g1-1437 and wild-type 1437, using the same method as in Example 1. The DNA of these plants was amplified using 1437_F and 1437_R. The PCR reaction system and procedure were the same as in Example 1.

[0066] The amplification products were digested with SnaBI enzyme as follows: 10 μL of PCR amplification product, 18 μL of nuclease-free water, 2 μL of 10×Buffer R, and 1-2 μL of SnaBI were mixed. The mixture was microcentrifuged for a few seconds and incubated at 37°C for 1-2 hours. The reaction was then terminated at 80°C for 20 minutes. The digested products were separated by electrophoresis on a 6% polyacrylamide gel. The polyacrylamide gel electrophoresis method is as follows:

[0067] (1) Preparation of polyacrylamide glue: 80 mL of 6% PA glue, 250 μL (winter) / 125 μL (summer) of 10% ammonium persulfate, and 80 μL of tetramethylethylenediamine (TEMED). Shake well and pour the glue. Clean the glass plates repeatedly with detergent, wipe with alcohol, and let them dry. In a fume hood, apply 2% Repel Silane to the concave plate, then wipe with alcohol and let it dry. Apply 1.5 mL of 0.5% Bingding Silane to another plate (add 7.5 μL of Bingding Silane and 7.5 μL of glacial acetic acid to a 1.5 mL centrifuge tube, and add 95% ethanol to a final volume of 1.5 mL). During the operation, prevent the two glass plates from contaminating each other. After thorough drying, assemble the glass plates and pour the glue.

[0068] (2) Pre-electrophoresis: After the gel solidifies, remove the comb and wash away the gel on top, paying particular attention to cleaning the seams. First, fill the lower tank (cathode) of the electrophoresis tank with 1×TBE electrode buffer, place the polymerized gel plate into the electrophoresis tank, and inject 0.5×TBE electrode buffer into the upper tank. Maintain a constant power of 40W-65W and perform pre-electrophoresis for approximately 30 minutes. Use a pipette to remove any urea and air bubbles deposited on the gel surface, and insert the comb.

[0069] (3) Electrophoresis: Add 5 μl of 5× Loading Buffer to the amplified product, mix, denature at 95℃ for 5 minutes, immediately transfer to ice to cool, and add 1.5-3 μl to the sample well; perform electrophoresis at a constant power of 40W-65W until bromophenol blue reaches the bottom of the electrophoresis tank. Adjust the electrophoresis time according to the molecular weight of the SSR amplified product and the distinguishability of the differential bands.

[0070] (4) Silver staining development: Place a glass plate with the gel in 10% glacial acetic acid fixative and shake at 65 r / min for about 30 min until all xylenenitrile is decolorized; rinse twice with distilled water for 5 min each time; place the rinsed gel plate in freshly prepared staining solution (2 g silver nitrate and 3 mL 37% formaldehyde in 2 L water) and shake at 65 r / min for 30 min; rinse the stained gel plate in distilled water for 5 s and immediately remove it for development; quickly transfer the gel plate to pre-cooled developing solution at 4℃ (30 g sodium hydroxide and 10 mL 37% formaldehyde in 2 L water) and gently shake until bands appear; rinse twice with distilled water for 2 min each time; allow it to air dry at room temperature and then photograph and save the image.

[0071] Electrophoresis results are shown Figure 6 In all rice varieties with normal glumes, after amplification and enzyme digestion, the electrophoretic bands of the products were all 118 bp, except for the mutant g1-1437, which showed a 99 bp band. This result indicates that the mutation site described in Example 1 (the C base at position 112 of the coding sequence of the G1 gene is replaced by a T base) truly exists and is associated with the long glume phenotype. This result, combined with the mutant phenotype, mutation site, and known phenotypic descriptions, suggests that the abnormal spikelet phenotype of the g1-1437 mutant is caused by the mutation described in Example 1.

[0072] Example 3: Hybridization and Transformation of Mutant Genes

[0073] according to Figure 7 The steps involved transferring the abnormal spikelet gene G1 from the g1-1437 mutant into other rice genetic backgrounds through hybridization:

[0074] ① Hybridization: Using g1-1437 as the female parent and the recipient rice material (RP) as the male parent, F1 seeds were obtained by hybridization;

[0075] ② First round of intercourse:

[0076] F1 plants were obtained after sowing F1 seeds. F1 plants were then crossed with recurrent parents to obtain BC1 seeds.

[0077] ③ Selection of abnormal BC1 spikelet genes (foreground selection):

[0078] Sow BC1 seeds to obtain no less than 500 seedlings. Collect leaves from each seedling during the seedling stage and extract DNA using the method described in Example 1. Amplify, digest and electrophore the DNA using the primer pairs (1437_F and 1437_R) listed in Example 2. Select heterozygous seedlings for further planting and discard homozygous wild-type seedlings.

[0079] ④ BC1 background selection:

[0080] A set of molecular markers (e.g., 100 or 200) that are polymorphic between the g1-1437 mutant and the recurrent parent and are evenly distributed on the genome (can be, but is not limited to, SSR, SNP, EST, RFLP, AFLP, RAPD, SCAR, etc.) are used to identify the single plants selected in step ③. Materials with high similarity to the recurrent parent (e.g., greater than 88% similarity, or 2% selection rate) are selected.

[0081] ⑤ Second round of cross: Use the single plant selected in step ④ as the male parent to pollinate the recurrent parent to obtain BC2 seeds;

[0082] ⑥ BC2 foreground and background selection: Repeat steps ③ to ④ for the selected materials, and select BC2 generation plants with a similarity to the recurrent parent that is higher than the selection criteria (such as similarity greater than 98%, or 2% selection rate, etc.).

[0083] ⑦ Self-pollination to obtain BC2F2 seeds: Self-pollinate the BC2 plants selected in step ⑥ to obtain BC2F2 seeds;

[0084] ⑧ BC2F2 foreground selection: Sow the BC2F2 seeds obtained in step ⑦ to obtain more than 500 seedlings. Collect leaves during the seedling stage, extract DNA using the method described in Example 1, and amplify and electrophore using the primer pairs (1437_F and 1437_R) listed in Example 2. Select single plants with homozygous mutant and heterozygous banding patterns for continued cultivation, and discard single plants with homozygous wild type.

[0085] ⑨ Background selection and application of BC2F2: The single plants selected in step ⑧ are subjected to background screening according to the method in step ④, and single plants with 100% background homozygosity are selected. If the 1437_F / 1437_R primer pair amplification and enzyme digestion banding of the selected single plant are homozygous mutants, then the single plant is the final target material, which can be further hybridized with recurrent parents to preserve the material, or hybridized with other rice materials. If the selected single plant is heterozygous, it can be directly used to preserve germplasm, or abnormal spikelet plants can be obtained through self-pollination.

[0086] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Hainan Bolian Rice Gene Technology Co., Ltd. <120> A rice G1 gene mutant g1-1437 and its molecular markers and applications <130> KHP211123247.3 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 959 <212> DNA <213> Artificial Sequence <400> 1 atgtcgtcgt cgtccgctgc cgcgctgggc tccgacgacg gctgctcgcc ggcggagctg 60 cggccgagcc ggtacgagtc gcagaagcgc cgggactggc agaccttcac gtagtacctc 120 gccgcgcacc gcccgccgct cgagctccgc cgctgcagcg gcgcccacgt cctcgagttc 180 ctccgctacc tcgaccgctt cggcaagacg cgcgtccacg agccgccgtg cccgtcgtac 240 ggcggccgct cgccgtccgc cgccggcccg gtcgccgccg ccgccgccgc atgccagtgc 300 ccgctgcgcc aggcgtgggg cagcctcgac gcgctcgtcg gccgcctccg cgccgcctac 360 gacgagcgcc acggccgcgc cggggagccc gacgccggcg cgggcgccgg cgcggtcgcc 420 accgacagta cctcctcctc ctccgccgcc gccgccaacc ccttcgccgc gcgcgccgtg 480 aggctgtacc tgcgcgacgt ccgcgacgcg caggccatgg cgcgcggcat ctcctaccac 540 aagaagaaga agcgcagggg cggcaacagg aacggcgccc gcggcggcgg tggcggcggc 600 gcgcgcgcgg gagtgaacga cggcgacgcg acggcgccgc cggtggcggt gaccccgggg 660 ctgcctctgc cgccgctgcc accgtgcctc aacggtgtgc cgttcgagta ctgcgacttc 720 gggagcgtcc tcgggggagc acatggcgcc catggcggcc atggcggcgg cggcggcggc 780 ttctacggcg ccggcgtcta cttgccattt ctgtacaaca ccttcagtta gttagctagc 840 tagctagttc gtcgtgtatt tgtctgtgct tctcactgtg gttgcttcag tgtactagct 900 agctacatgt gtgatgtgtc tgcatcttgt gatcatcttg atctgtgctt tgatgctga 959 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gggactggca gacctttacg 20 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 gtcttgccga agcggtcgag gt 22 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 aatctaaact gttaggaagc ggag 24 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <400> 5 gcgcaggtac agcctcacg 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 tcgccaccga cagtacctc 19 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <400> 7 gcacgaacat aacgcaatcg ac 22 <210> 8 <211> 1039 <212> DNA <213> Artificial Sequence <400> 8 atgtcgtcgt cgtccgctgc cgcgctgggc tccgacgacg gctgctcgcc ggcggagctg 60 cggccgagcc ggtacgagtc gcagaagcgc cgggactggc agaccttcac gcagtacctc 120 gccgcgcacc gcccgccgct cgagctccgc cgctgcagcg gcgcccacgt cctcgagttc 180 ctccgctacc tcgaccgctt cggcaagacg cgcgtccacg agccgccgtg cccgtcgtac 240 ggcggccgct cgccgtccgc cgccggcccg gtcgccgccg ccgccgccgc atgccagtgc 300 ccgctgcgcc aggcgtgggg cagcctcgac gcgctcgtcg gccgcctccg cgccgcctac 360 gacgagcgcc acggccgcgc cggggagccc gacgccggcg cgggcgccgg cgcggtcgcc 420 accgacagta cctcctcctc ctccgccgcc gccgccaacc ccttcgccgc gcgcgccgtg 480 aggctgtacc tgcgcgacgt ccgcgacgcg caggccatgg cgcgcggcat ctcctaccac 540 aagaagaaga agcgcagggg cggcaacagg aacggcgccc gcggcggcgg tggcggcggc 600 gcgcgcgcgg gagtgaacga cggcgacgcg acggcgccgc cggtggcggt gaccccgggg 660 ctgcctctgc cgccgctgcc accgtgcctc aacggtgtgc cgttcgagta ctgcgacttc 720 gggagcgtcc tcgggggagc acatggcgcc catggcggcc atggcggcgg cggcggcggc 780 ttctacggcg ccggcgtcta cttgccattt ctgtacaaca ccttcagtta gttagctagc 840 tagctagttc gtcgtgtatt tgtctgtgct tctcactgtg gttgcttcag tgtactagct 900 agctacatgt gtgatgtgtc tgcatcttgt gatcatcttg atctgtgctt tgatgctgat 960 cgatccagca tatccgtacg tgttcgttcc gttgcttcgg atcttaatta actaatttaa 1020 ttgtgctaat taattttgt 1039

Claims

1. Rice G 1 Gene mutants g1-1437 Its characteristics are, Based on the nucleotide sequence shown in SEQ ID NO. 8, the gene mutant g1-1437 The 112th base C is mutated to the base T.

2. A gene mutant causing abnormal glume development in rice. g1-1437 Its characteristics are, It contains the nucleotide sequence shown in SEQ ID NO.

1.

3. Containing the gene mutant as described in claim 1 or 2 g1-1437 The biological material is an expression cassette, a vector, or a host cell; the host cell is a microbial cell or a non-reproductive plant cell.

4. The gene mutant according to claim 1 or 2 g1-1437 Or the use of the biomaterial of claim 3 in any of the following aspects: (1) Application in the preparation of transgenic rice with recessive abnormal glumes; (2) Application as a phenotypic screening marker in transgenic rice with recessive abnormal glumes; (3) Application in elongating the glumes in the floret structure of rice panicles; The abnormal guard refers to the guard elongation.

5. For detecting the gene mutant as described in claim 1 or 2 g1-1437 Molecular markers, characterized by, The molecular marker is a nucleotide sequence containing a C / T polymorphism at position 112 of the sequence shown in SEQ ID NO.

1.

6. Primers for detecting the molecular marker of claim 5, characterized in that, It contains the primers shown in SEQ ID NO.2-3.

7. A reagent or kit containing the primers of claim 6.

8. The molecular marker of claim 5, the primer of claim 6, or the reagent or kit of claim 7 for detecting gene mutants. g1-1437 Or its application in the developmental abnormalities of rice glumes; the aforementioned developmental abnormalities refer to the elongation of glumes.

9. A method for identifying the gene mutant as described in claim 1 or 2 g1-1437 Or a method for treating abnormal development of rice glumes, characterized in that, include: The primers of claim 6 or the reagents or kits of claim 7 are used to amplify the rice samples to be tested. G1 The steps include: gene fragment extraction and cutting the amplified fragment with SnaBI restriction enzyme; If the length of the amplified fragment after cutting is 118 bp, then the rice to be tested does not contain the gene mutant. g1- 1437 The rice glumes develop normally; if the length of the amplified fragment after cutting is 99 bp, then the rice being tested contains the gene mutant. g1-1437 1. Abnormal development of rice glumes; the abnormal development of glumes refers to the elongation of glumes.

Images