Application of Gemin8 or Rnpc3 in maintaining hemopoietic stem progenitor cell protein homeostasis

Abstract

The invention discloses an application of Gemin8 or Rnpc3 in maintaining a hematopoietic stem progenitor cell protein homeostasis, creatively discovers a new application of Gemin8 or Rnpc3 in maintaining the hematopoietic stem progenitor cell protein homeostasis for the first time, and effectively overcomes the technical problem of how to effectively maintain the hematopoietic stem progenitor cell protein homeostasis in the current field. The invention provides an effective method for maintaining the protein homeostasis of the hematopoietic stem progenitor cells, lays a foundation for developing the hematopoietic stem progenitor cells with better functionality and transplantation potential, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to the application of Gemin8 or Rnpc3 in maintaining protein homeostasis of hematopoietic stem and progenitor cells. Background Art

[0002] Proteostasis refers to the use of a series of quality control mechanisms by cells to maintain the stability of their own proteome, which plays an important role in maintaining normal cell function, cell proliferation and survival. When the various molecular mechanisms that maintain protein homeostasis are out of balance, physiological and pathological processes such as cell function, metabolic disorders, abnormal proliferation and apoptosis may occur. Protein homeostasis imbalance may lead to an increase in cell degradation, damage, useless or misfolded proteins, thereby controlling the process of cell aging, which is closely related to the health and life span of living organisms on a macro level. Stem cells, as a special cell group with the ability of self-renewal and multidirectional differentiation, need to maintain protein homeostasis, but the mechanism by which stem cells maintain protein homeostasis is still unclear. Hematopoietic stem progenitor cells (HSPCs) regenerate blood cells throughout the human life cycle. In order to maintain their healthy state, HSPCs are particularly dependent on protein homeostasis. How to effectively maintain HSPCs protein homeostasis remains one of the technical problems that need to be solved in this field. Summary of the invention

[0003] In view of this, in order to overcome the above-mentioned technical problems existing in the art, the purpose of the present invention is to provide the use of Gemin8 or Rnpc3 in maintaining protein homeostasis of hematopoietic stem and progenitor cells.

[0004] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0005] The first aspect of the present invention provides the use of Gemin8 or Rnpc3 in maintaining protein homeostasis of hematopoietic stem and progenitor cells.

[0006] Further, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0007] (1) Gemin8 or Rnpc3 protein;

[0008] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0009] (3) an expression cassette containing the gene described in (2);

[0010] (4) a vector containing the expression cassette described in (3);

[0011] (5) a host cell containing the vector described in (4);

[0012] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0013] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0014] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0015] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0016] Furthermore, the Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.

[0017] In some embodiments, the full name of Gemin8 is gem nuclear organelle associated protein 8. According to the analysis of the GenTree website, the gene is highly conserved in humans and mice. The Gene ID of human Gemin8 in NCBI (https: / / www.ncbi.nlm.nih.gov / ) is 54960, and the Gene ID of mouse Gemin8 in NCBI is 237221. The full name of Rnpc3 is RNA binding region (RNP1, RRM) containing 3. According to the analysis of the GenTree website, the gene is highly conserved in humans and mice. The Gene ID of human Rnpc3 in NCBI is 55599, and the Gene ID of mouse Rnpc3 in NCBI is 67225.

[0018] In some embodiments, the protein homeostasis refers to the dynamic equilibrium state of proteins in cells, which involves multiple aspects such as protein synthesis, degradation and transport. The maintenance of protein homeostasis is essential for the normal function of cells, and any imbalance may lead to cell dysfunction or even cell death. When certain physiological or pathological factors cause the body's protein homeostasis to be destroyed, a large amount of unfolded proteins or misfolded proteins will aggregate. Misfolded or unfolded proteins may be toxic and cause cell death. Many diseases or conditions (for example, sickle cell anemia) are caused by misfolded proteins. Misfolded proteins can also aggregate into clumps, which is a hallmark of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease.

[0019] In some embodiments, the hematopoietic stem and progenitor cells (HSPCs) are the source of blood cells and immune cells in the body. HSPCs have multipotency, longevity and self-regeneration capabilities. The hematopoietic stem and progenitor cells include hematopoietic stem cells (HSC) and / or hematopoietic progenitor cells (HPC).

[0020] In some embodiments, hematopoietic stem cells refer to stem cells that are capable of generating all blood cell types of the three hematopoietic lineages (erythroid, lymphoid, and myeloid), including the myeloid lineage (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) and the lymphoid lineage (T cells, B cells, NK cells).

[0021] In some embodiments, hematopoietic progenitor cells refer to hematopoietic stem cells that proliferate and differentiate into progenitor cells of various blood cells under the regulation of a certain microenvironment and certain factors. They are also a relatively primitive cell with proliferation ability, but have lost the ability of multidirectional differentiation and can only proliferate and differentiate toward one or several blood cell lineages. Therefore, they are also called directed stem cells. Hematopoietic progenitor cells can differentiate into multipotent cells of several cell types of the hematopoietic system, including but not limited to: granulocytes, monocytes, erythrocytes, megakaryocytes, B cells and T cells. Hematopoietic progenitor cells are directed toward the hematopoietic cell lineage and generally do not self-regenerate.

[0022] In some embodiments, the hematopoietic stem cell can be obtained from any one or more of the following sources: embryonic tissue, umbilical cord blood, bone marrow, peripheral blood, circulating peripheral blood, stem cell line, or can be obtained in vitro from other cells, such as embryonic stem cells, induced pluripotent stem cells (iPS cells) or adult pluripotent cells. The cells from the above sources can be expanded in vitro using any method acceptable to those skilled in the art before use. In some cases, the hematopoietic stem cell can be separated from any of the above sources (e.g., bone marrow) or cultured in vitro. If the cells used are derived from an immortal stem cell line, it can further be beneficial to easily obtain and prepare a sufficient number of cells.

[0023] In some embodiments, the Gemin8 or Rnpc3 maintains protein homeostasis of hematopoietic stem and progenitor cells by reducing the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells.

[0024] In some embodiments, the Gemin8 or Rnpc3 includes Gemin8 or Rnpc3, or a Gemin8 promoter or a Rnpc3 promoter. The Gemin8 promoter or the Rnpc3 promoter refers to any substance that can upregulate the expression of Gemin8 or Rnpc3, increase the activity of Gemin8 or Rnpc3, improve the stability of Gemin8 or Rnpc3, increase the effective action time of Gemin8 or Rnpc3, or promote the transcription and translation of Gemin8 or Rnpc3. These substances can be used in the present invention.

[0025] In some embodiments, the Gemin8 promoter or Rnpc3 promoter includes but is not limited to: nucleic acid promoter, protein promoter, for example, a vector that overexpresses Gemin8 or Rnpc3, an active peptide that promotes the expression of Gemin8 or Rnpc3, a protein that promotes the expression of Gemin8 or Rnpc3, an oligonucleotide that promotes the expression of Gemin8 or Rnpc3, and a small molecule compound that promotes the expression of Gemin8 or Rnpc3.

[0026] In a specific embodiment of the present invention, the inventors of the present invention have creatively discovered for the first time through a large number of experimental studies the new use of Gemin8 or Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells. Overexpression of Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines, thereby playing a role in maintaining protein homeostasis in hematopoietic stem and progenitor cells, providing new research ideas and strategies for the treatment and / or prevention of various diseases or conditions caused by imbalance in protein homeostasis in hematopoietic stem and progenitor cells.

[0027] The second aspect of the present invention provides a pharmaceutical composition for maintaining protein homeostasis of hematopoietic stem and progenitor cells.

[0028] Furthermore, the pharmaceutical composition comprises Gemin8 or Rnpc3.

[0029] Further, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0030] (1) Gemin8 or Rnpc3 protein;

[0031] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0032] (3) an expression cassette containing the gene described in (2);

[0033] (4) a vector containing the expression cassette described in (3);

[0034] (5) a host cell containing the vector described in (4);

[0035] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0036] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0037] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0038] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0039] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0040] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is described in detail in Remington's Pharmaceutical Sciences (19th ed, 1995). These substances are used to help the stability of the drug or to help improve the activity of the active ingredient (i.e., Gemin8 or Rnpc3 as described above in the present invention) as needed. The substances include but are not limited to: diluents, surfactants, wetting agents, adhesives, fillers, disintegrants, adsorption carriers, lubricants, stabilizers, bactericides, buffers, isotonic agents, chelating agents, pH control agents. The pharmaceutical composition prepared in this way can be administered by any appropriate administration method known to those skilled in the art as needed.

[0041] In some embodiments, the pharmaceutically acceptable carrier and / or excipient may additionally contain liquids such as water, saline, glycerol, and ethanol.

[0042] The third aspect of the present invention provides a pharmaceutical preparation for maintaining protein homeostasis of hematopoietic stem and progenitor cells.

[0043] Furthermore, the pharmaceutical preparation comprises the pharmaceutical composition described in the second aspect of the present invention.

[0044] In some embodiments, the dosage form of the pharmaceutical preparation includes but is not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, solutions, emulsions, suspensions, controlled release preparations, aerosols, films, injections, intravenous drips, transdermal absorption preparations, ointments, lotions, adhesive preparations, suppositories, nasal preparations, pulmonary preparations, eye drops, etc., for patient ingestion.

[0045] In some embodiments, suitable modes of administration of the pharmaceutical composition or pharmaceutical formulation include any of a variety of methods and delivery systems known to those skilled in the art to physically introduce the pharmaceutical composition or pharmaceutical formulation of the present invention into a subject, including but not limited to oral administration, parenteral administration, administration by inhalation spray, topical administration, rectal administration, nasal administration, buccal administration, or administration via an implanted reservoir.

[0046] In some embodiments, oral administration or injection administration can be selected, wherein injection administration includes the form of rapid injection or continuous infusion. In the case of a pharmaceutical composition or pharmaceutical preparation for injection administration, it can be in the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it can contain formulation agents, such as suspending agents, preservatives, stabilizers and / or dispersants.

[0047] A fourth aspect of the present invention provides a method for maintaining protein homeostasis of hematopoietic stem and progenitor cells.

[0048] Furthermore, the method comprises administering the Gemin8 or Rnpc3 described in the first aspect of the present invention to a hematopoietic stem and progenitor cell system in need thereof.

[0049] Furthermore, the Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.

[0050] The fifth aspect of the present invention provides the use of Gemin8 or Rnpc3 in reducing the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells.

[0051] Further, the Gemin8 or Rnpc3 is selected from any one or more of the following:

[0052] (1) Gemin8 or Rnpc3 protein;

[0053] (2) Genes encoding Gemin8 or Rnpc3 proteins;

[0054] (3) an expression cassette containing the gene described in (2);

[0055] (4) a vector containing the expression cassette described in (3);

[0056] (5) a host cell containing the vector described in (4);

[0057] (6) Active peptides that promote the expression of Gemin8 or Rnpc3;

[0058] (7) Proteins that promote the expression of Gemin8 or Rnpc3;

[0059] (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3;

[0060] (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

[0061] In addition, the present invention also provides a method for treating and / or preventing diseases or conditions caused by imbalance in protein homeostasis of hematopoietic stem and progenitor cells, the method comprising: administering a therapeutically and / or preventively effective amount of the pharmaceutical composition or pharmaceutical preparation provided above of the present invention to a subject in need.

[0062] In some embodiments, the disease or disorder caused by the imbalance of protein homeostasis in hematopoietic stem and progenitor cells includes, but is not limited to, sickle cell anemia, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and different types of spinocerebellar ataxia.

[0063] In some embodiments, the subject comprises one or more animals, including, for example, cattle, horses, sheep, primates, avian and rodent species. The subject can be a mammal, bird, fish, reptile or amphibian. The mammal includes a human or non-human mammal. In other embodiments, the subject can be a mouse, rat, hamster, ferret, gerbil, rabbit, monkey, chimpanzee, horse, pony, donkey, sheep, pig, chicken, goat, cat or dog. In a preferred embodiment, the subject is a human.

[0064] Compared with the prior art, the present invention has the following beneficial effects:

[0065] The present invention creatively discovered for the first time a new use of Gemin8 or Rnpc3 in maintaining protein homeostasis of hematopoietic stem and progenitor cells, effectively overcoming the current technical problem faced in the field of how to effectively maintain protein homeostasis of hematopoietic stem and progenitor cells, and providing an effective method for maintaining protein homeostasis of hematopoietic stem and progenitor cells. It also lays the foundation for the development of hematopoietic stem and progenitor cells with better functionality and transplantation potential, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 : After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the expression level of Gemin8 was detected;

[0067] Figure 2 :After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in cells was detected by flow cytometry;

[0068] Figure 3 : After overexpressing Gemin8 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in cells was detected by flow cytometry;

[0069] Figure 4 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the expression level of Gemin8 was detected;

[0070] Figure 5 :After knocking down Gemin8 in hematopoietic stem cell lines, the content of misfolded proteins in cells was detected by flow cytometry;

[0071] Figure 6 :After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in cells was detected by flow cytometry;

[0072] Figure 7 : After knocking down Gemin8 in hematopoietic stem and progenitor cell lines, the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 were detected by RT-qPCR;

[0073] Figure 8 :Analysis of translation efficiency of c-Kit+ cells with knockdown of Gemin8;

[0074] Fig. 9 : After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the expression level of Rnpc3 was detected;

[0075] Fig.10 :After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in cells was detected by flow cytometry;

[0076] Fig.11 : After overexpressing Rnpc3 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in cells was detected by flow cytometry;

[0077] Fig.12 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the expression level of Rnpc3 was detected;

[0078] Fig.13 :After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the content of misfolded proteins in cells was detected by flow cytometry;

[0079] Fig.14 :After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the content of unfolded proteins in cells was detected by flow cytometry;

[0080] Fig.15 : After knocking down Rnpc3 in hematopoietic stem and progenitor cell lines, the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 were detected by RT-qPCR;

[0081] Fig.16: Analysis of translation efficiency in c-Kit+ cells with knockdown of Rnpc3;

[0082] Fig.17 : Schematic diagram of lentiviral infection vector overexpressing Gemin8;

[0083] Fig.18 : Schematic diagram of the lentiviral infection vector overexpressing Rnpc3. DETAILED DESCRIPTION

[0084] The present invention is further described below in conjunction with specific embodiments. The following specific embodiments are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0085] The reagents and raw materials used in the present invention are easily obtained by those of ordinary skill in the art, and can be obtained from commercial sources unless otherwise specified. The experimental methods for which specific conditions are not specified in the present invention are usually carried out under conventional conditions or under conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0086] Example 1 Application of high-level expression of Gemin8 in maintaining protein homeostasis in hematopoietic stem and progenitor cells

[0087] 1. Experimental methods

[0088] Screening strategy: Mouse c-Kit+ LSK cells and LKS- cells were sorted for Polysome profiling detection, and RNA-binding proteins that bind to 80s and Polysome and play a role in the translation process were analyzed. Gemin8 was screened out based on the results of extremely trace protein spectrum.

[0089] After overexpressing Gemin8 in 32D mouse hematopoietic stem cell line (purchased from ATCC Cell Resource Bank, mouse IL-3-dependent cells), misfolded proteins and unfolded proteins in the cells were detected by flow cytometry. The specific experimental method is as follows:

[0090] Use a lentiviral infection vector (such as Fig.17The vector was purchased from Yunzhou Biotechnology Co., Ltd. and the vector backbone was pLV[Exp]-EGFP / Puro-EF1A. The sequence corresponding to the Gemin8 is shown in SEQ ID NO: 1. The specific steps of lentivirus packaging and infection of 32D cells are as follows:

[0091] (1) Mix the plasmids (4.5 μg of pMD2.G, 1.5 μg of pSPAX2, and 6 μg of pLV[Exp]-EGFP / Puro-EF1A>mGemin8, a total of 12 μg), and add 800 μL of Optimum (for cells in a 10 cm dish). (2) Add the Lipofectamine™ LTX reagent PLUS to the plasmid at a 1:1 mass volume ratio (e.g., 12 μL for 12 μg of plasmid), invert to mix, centrifuge, and incubate at room temperature for 5 min. (3) Add the transfection reagent LTX at a 1:2-1:2.5 ratio to the transfection reagent, invert to mix, centrifuge, and incubate at room temperature for 30 min. (4) After 30 min, replace the cell culture medium with 10 mL of DMEM medium per dish and add 10% fetal bovine serum (FBS) and L-Glutamine (Gln) (200 μL). mM, 100×) and sodium pyruvate (100 mM, 100×); (5) Add the mixed transfection reagent to the cells, mix well, and incubate in a 37°C, 5% incubator for 4-6 h; (6) Change the medium, add 30% FBS, L-Glutamine, Sodium pyruvate and PS to DMEM in 15 mL per dish; (7) Collect the virus after 48 h; (8) Filter the 293T cell supernatant with a 0.45 μm filter; (9) High-speed centrifugation, balance the centrifuge tube with culture medium and then ultracentrifuge at 20,000 rpm, 4°C, 3 h; (10) Discard the supernatant and dissolve the cell basal culture medium; (11) Infect 32D cells, add the infection promoter polybrene (8 mg / mL, 1000×), and change the cell medium after 14-16 h; 36 h later, EGFP-positive cells were sorted by flow cytometry to obtain purified 32D cells overexpressing Gemin8.

[0092] Misfolded protein detection kit (PROTEOSTAT ®Aggresome detection kit, ENZO, ENZ-51035-0025), the operation process is as follows: (1) Collect cells, resuspend the cell pellet in 1 mL 4% tissue cell fixative, and incubate at room temperature for 1 h; (2) Centrifuge the cells at 4°C, 900 rpm, 5 min, and remove the supernatant; (3) Permeabilize the cell membrane with membrane permeabilization buffer (1×Assay Buffer, 0.5% TritonX-100, 3 mM EDTA, pH8.0) at room temperature for 30 min; (4) Centrifuge the cells at 4°C, 600 g, 5 min, and wash the cell pellet with PBS; resuspend each sample in 500 μL 1×Assay Buffer, and add PROTEOSTAT diluted 2000 times ® Aggresome Red Detection Reagent was incubated at room temperature for 30 min before flow cytometry analysis.

[0093] The unfolded protein detection method is as follows: (1) Add tetraphenylethene maleimide (TPE-MI) to the cell culture medium and incubate; (2) Collect the cells and centrifuge at 1000 rpm for 5 min; resuspend in 300 μL PBS and detect by flow cytometry.

[0094] After knocking down Gemin8 in 32D mouse hematopoietic stem cell line (purchased from ATCC Cell Resource Bank, mouse IL-3-dependent cells), misfolded proteins and unfolded proteins in cells were detected by flow cytometry, and the expression levels of UPR-related genes were detected by RT-qPCR. The specific experimental methods are as follows:

[0095] The lentiviral vector plasmid for knocking down Gemin8 was purchased from Jiman Biotechnology (Shanghai) Co., Ltd. The vector backbone was PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro-WPRE, the shRNA NC sequence was constructed as: TTCTCCGAACGTGTCACGT (SEQ ID NO: 2), and the shGemin8 sequence was: AGAGTGCGACCTGAGCAATAT (SEQ ID NO: 3).

[0096] The methods for lentiviral packaging and infection of 32D cells were the same as above; the methods for detecting misfolded and unfolded proteins were the same as above; the steps for detecting the expression levels of UPR-related genes by RT-qPCR were as follows: (1) Total RNA extraction: discard the culture medium, add 500 μL Trizol to lyse the cells, and mix thoroughly; add 100 μL CHCl3, mix vigorously for 15 s, and let it stand at room temperature for 2 min; centrifuge at 12,000 g, 4°C, 15 min; aspirate the aqueous phase into a clean RNase-free 1.5 mL centrifuge tube; add 250 μL IPA, mix by inversion, and let it stand at room temperature for 10 min; centrifuge at 12,000 g, 4°C, 10 min; discard the supernatant, add 1 mL pre-cooled 75% ethanol to wash the RNA precipitate; centrifuge at 12,000 g, 4°C, 5 min; discard the supernatant, dry at room temperature, and add 10-30 μL ultrapure water to dissolve it; use NanoDrop to determine the concentration and purity of RNA. (2) Reverse transcription: Take 1 μg RNA for reverse transcription, reaction system A is shown in Table 1; 70℃, 10 min, quickly transfer to ice for cooling; add reaction system B (as shown in Table 2), shake and centrifuge to mix evenly, and prepare cDNA through the following procedure: 42℃, 1 h; the prepared cDNA can be stored at 4℃ for a short time or at -20℃ for a long time; (3) RT-qPCR real-time fluorescence quantitative PCR: prepare PCR reaction system on ice (as shown in Table 3); add PCR system to 96-well plate or 384-well plate in sequence, centrifuge for 1 min; turn on the machine, start the software, put in the PCR well plate, and set the program as shown in Table 4; run the program, collect data, and analyze the expression of mRNA. The relevant qPCR primer sequences are shown in Table 5.

[0097] Table 1 Reaction system A

[0098]

[0099] Table 2 Reaction system B

[0100]

[0101] Table 3 PCR reaction system

[0102]

[0103] Table 4 Reaction procedure

[0104]

[0105] Table 5 Related qPCR primer sequences

[0106]

[0107] In addition, this example further analyzed the translation efficiency of c-Kit+ cells with knockdown of Gemin8. The specific experimental method is as follows: Click-iT™ Plus OPP Alexa Fluor™ 647 Protein Synthesis Detection Kit (Invitrogen, C10458) was used. The specific operation process is as follows: mice were killed by cervical dislocation; mouse bone marrow cells were isolated; the cell suspension after erythrocyte lysis was diluted and the cells were counted; 1×10 7 Cells, O-propargyl-puromycin analog (OPP) (working concentration 20 μM) of puromycin were added to the cell culture medium and incubated in a 37°C, 5% CO2 incubator for 30 min; cells were collected, anti-C-Kit (BV510, BioLegend, 105839) was used to label c-Kit+ cells at 4°C for 1 h; cells were centrifuged at 4°C, 600 g for 5 min, the supernatant was removed, and the cell pellet was resuspended in 1 mL 4% tissue cell fixative at room temperature for 1 h; cells were centrifuged at 4°C, 600 g for 5 min, the supernatant was removed; 0.1% TritonX-100 was added to permeabilize the cell membrane at room temperature for 30 min; cells were centrifuged at 4°C, 600 g for 5 min, and the cell pellet was washed with PBS; 100 μL of detection solution was added to each sample and incubated at room temperature for 30 min; the detection solution was prepared on the spot, and the formula for 1 mL was: 880 μL Click-iT ® OPP Reaction Buffer, 20 μL Copper Protectant, 2.5 μL Alexa Fluor ® picolyl azide, 100 μL Click-iT ® Reaction Buffer Additive; centrifuge, 4℃, 600g, 5 min, remove the supernatant; resuspend each sample in 300 μL PBS and analyze by flow cytometry.

[0108] 2. Experimental results

[0109] The results showed that after overexpression of Gemin8 in 32D mouse hematopoietic stem cell line, Gemin8 was significantly overexpressed ( Figure 1 ), in 32D cells with significant overexpression of Gemin8, the amount of misfolded proteins aggregated in the cells ( Figure 2 ), unfolded protein content ( Figure 3 ) were significantly reduced.

[0110] The results showed that after knocking down Gemin8 in the 32D mouse hematopoietic stem cell line, Gemin8 was significantly knocked down ( Figure 4), in 32D cells with significant knockdown of Gemin8, the amount of misfolded proteins aggregated in the cells ( Figure 5 ), unfolded protein content ( Figure 6 ) were significantly increased, and the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 ( Figure 7 ) were significantly increased, proving that Gemin8 does play an important role in maintaining HSC protein homeostasis. Overexpression of Gemin8 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines.

[0111] By analyzing the translation efficiency of c-Kit+ cells in Gemin8 KD, it was found that the translation efficiency of this cell was Figure 8 ), suggesting that Gemin8 may maintain the protein homeostasis of c-Kit+ by maintaining its lower translation efficiency.

[0112] Example 2 Application of high-level expression of Rnpc3 in maintaining protein homeostasis in hematopoietic stem and progenitor cells

[0113] 1. Experimental methods

[0114] Screening strategy: Mouse c-Kit+ LSK cells and LKS- cells were sorted for Polysome profiling detection, and RNA-binding proteins that bind to 80s and Polysome and play a role in the translation process were analyzed. Rnpc3 was screened out based on the results of extremely trace protein spectrum.

[0115] After overexpressing Rnpc3 in 32D mouse hematopoietic stem cell line (purchased from ATCC Cell Resource Bank, mouse IL-3 dependent cells), misfolded proteins and unfolded proteins in the cells were detected by flow cytometry. The specific experimental method is as follows:

[0116] The lentiviral vector plasmid (such as Fig.18 The vector was purchased from Yunzhou Biotechnology Co., Ltd. The vector backbone was pLV[Exp]-EGFP / Puro-EF1A, and the sequence of Rnpc3 was shown in SEQ ID NO:12.

[0117] The methods for lentiviral packaging and infection of 32D cells were the same as above; the methods for detecting misfolded and unfolded proteins were the same as above.

[0118] After knocking down Rnpc3 in 32D mouse hematopoietic stem cell line (purchased from ATCC cell resource bank, mouse IL-3 dependent cells), misfolded proteins and unfolded proteins in cells were detected by flow cytometry, and the expression levels of UPR-related genes were detected by RT-qPCR. Among them, the lentiviral vector plasmid for knocking down Rnpc3 was purchased from Jiman Biotechnology (Shanghai) Co., Ltd., the vector backbone is PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro-WPRE, the shRNA NC sequence is constructed as shown in SEQ ID NO: 2, and the shRnpc3 sequence is ACAGAGAATGAACAGATTAAT (SEQ ID NO: 13). Other detection methods are the same as above.

[0119] In addition, this example further analyzed the translation efficiency of c-Kit+ cells with Rnpc3 knockdown, and the detection method was the same as above.

[0120] 2. Experimental results

[0121] The results showed that after overexpression of Rnpc3 in 32D mouse hematopoietic stem and progenitor cell lines, Rnpc3 was significantly overexpressed ( Fig. 9 ), in 32D cells with significant overexpression of Rnpc3, the amount of misfolded proteins aggregated in the cells ( Fig.10 ), unfolded protein content ( Fig.11 ) were significantly reduced.

[0122] The results showed that knockdown of Rnpc3 in 32D mouse hematopoietic stem cell line significantly reduced Rnpc3 ( Fig.12 ), in 32D cells with significant knockdown of Rnpc3, the amount of misfolded proteins aggregated in the cells ( Fig.13 ), unfolded protein content ( Fig.14 ) were significantly increased, and the expression levels of UPR-related genes ERDJ4, CHOP and their downstream gene GADD34 ( Fig.15 ) were significantly increased, proving that Rnpc3 does play an important role in maintaining HSC protein homeostasis. Overexpression of Rnpc3 can significantly reduce the content of misfolded proteins and unfolded proteins in hematopoietic stem and progenitor cell lines.

[0123] By analyzing the translation efficiency of c-Kit+ cells in Rnpc3 KD, it was found that the translation efficiency of this cell was Fig.16 ), suggesting that Rnpc3 may maintain the protein homeostasis of c-Kit+ by maintaining its lower translation efficiency.

Claims

1. Application of Gemin8 or Rnpc3 in maintaining protein homeostasis of hematopoietic stem and progenitor cells.

2. The use according to claim 1, characterized in that: The Gemin8 or Rnpc3 is selected from any one or more of the following: (1) Gemin8 or Rnpc3 protein; (2) Genes encoding Gemin8 or Rnpc3 proteins; (3) an expression cassette containing the gene described in (2); (4) a vector containing the expression cassette described in (3); (5) a host cell containing the vector described in (4); (6) Active peptides that promote the expression of Gemin8 or Rnpc3; (7) Proteins that promote the expression of Gemin8 or Rnpc3; (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3; (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

3. The use according to claim 1, characterized in that: The Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain protein homeostasis in hematopoietic stem and progenitor cells.

4. A pharmaceutical composition for maintaining protein homeostasis in hematopoietic stem and progenitor cells, characterized in that: The pharmaceutical composition comprises Gemin8 or Rnpc3.

5. The pharmaceutical composition according to claim 4, characterized in that The Gemin8 or Rnpc3 is selected from any one or more of the following: (1) Gemin8 or Rnpc3 protein; (2) Genes encoding Gemin8 or Rnpc3 proteins; (3) an expression cassette containing the gene described in (2); (4) a vector containing the expression cassette described in (3); (5) a host cell containing the vector described in (4); (6) Active peptides that promote the expression of Gemin8 or Rnpc3; (7) Proteins that promote the expression of Gemin8 or Rnpc3; (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3; (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

6. A pharmaceutical preparation for maintaining protein homeostasis in hematopoietic stem and progenitor cells, characterized in that: The pharmaceutical preparation comprises the pharmaceutical composition according to claim 4 or 5.

7. A method for maintaining protein homeostasis in hematopoietic stem and progenitor cells, characterized in that: The method comprises administering the Gemin8 or Rnpc3 described in any one of claims 1 to 3 to a hematopoietic stem and progenitor cell system in need thereof.

8. The method according to claim 7, characterized in that The Gemin8 or Rnpc3 can significantly reduce the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells to maintain the protein homeostasis of hematopoietic stem and progenitor cells.

9. Application of Gemin8 or Rnpc3 in reducing the content of misfolded proteins and / or unfolded proteins in hematopoietic stem and progenitor cells.

10. The use according to claim 9, characterized in that: The Gemin8 or Rnpc3 is selected from any one or more of the following: (1) Gemin8 or Rnpc3 protein; (2) Genes encoding Gemin8 or Rnpc3 proteins; (3) an expression cassette containing the gene described in (2); (4) a vector containing the expression cassette described in (3); (5) a host cell containing the vector described in (4); (6) Active peptides that promote the expression of Gemin8 or Rnpc3; (7) Proteins that promote the expression of Gemin8 or Rnpc3; (8) Oligonucleotides that promote the expression of Gemin8 or Rnpc3; (9) Small molecule compounds that promote the expression of Gemin8 or Rnpc3.

Images