P2RY2 activity modulators

Abstract

The present invention relates to modulators of P2Y purine receptor 2 (P2RY2) activity for use in T cell immunotherapy. The present invention also relates to polynucleotides encoding modulators of P2RY2 activity and host cells comprising modulators of P2RY2 activity for use in T cell immunotherapy. Furthermore, the present invention relates to a method of identifying a subject capable of accepting T cell immunotherapy comprising (A) determining the activity of P2RY2 in a sample of the subject; (B) comparing the activity determined in step (A) with a reference; and identifying a subject capable of accepting T cell immunotherapy based on the comparison of step (B) and a method for identifying a modulator of P2RY2 activity comprising (I) contacting a host cell with a candidate compound suspected of being a modulator of P2RY2 activity; (II) determining the B7-H3 activity in the host cell; (III) comparing the B7-H3 activity as determined in step (II) with a control; and (IV) identifying modulators of P2RY2 activity based on the comparison in step (III).

Description

[0001] The present invention relates to a P2Y purinergic receptor 2 (P2RY2) activity modulator for T cell immunotherapy. The present invention also relates to a polynucleotide encoding a P2RY2 activity modulator for T cell immunotherapy and to a host cell comprising a P2RY2 activity modulator for T cell immunotherapy. In addition, the present invention relates to a method for identifying a subject capable of receiving T cell immunotherapy, comprising (A) determining the activity of P2RY2 in a sample of the subject; (B) comparing the activity determined in step (A) with a reference; and identifying a subject capable of receiving T cell immunotherapy based on the comparison in step (B), and a method for identifying a P2RY2 activity modulator, the method comprising (I) contacting a host cell with a candidate compound suspected of being a P2RY2 activity modulator; (II) determining the B7-H3 activity in the host cell; (III) comparing the B7-H3 activity determined in step (II) with a control; and (IV) identifying a P2RY2 activity modulator based on the comparison in step (III).

[0002] In recent years, therapies that boost the function or activity of immune cells to fight cancer have been transforming cancer treatment. In particular, engineered T cell therapies, such as CAR-T and immune checkpoint blockade, have been shown to produce more durable responses in many cancer types than traditional therapies, such as chemotherapy. However, current cancer immunotherapies are only effective in some patients, and identifying treatment strategies that benefit more patients remains a challenge.

[0003] Successful targeting of the PD-1 / PD-L1 axis and the CTLA-4 immune checkpoint has aroused interest in other molecules that may enhance the activity of existing cancer immunotherapies or show activity in tumor types with low activity in blocking CTLA-4 and PD-1 / PD-L1 pathways. An immune checkpoint ligand of particular interest is B7-H3 (CD276), a member of the B7 family. Similar to other B7 family members, B7-H3 has immunomodulatory functions, but its receptor on immune cells remains unknown. B7-H3 was originally thought to be a co-stimulatory molecule that enhances T cell activation in vitro and in autoimmune disease models (Chen et al., J Immunol 189, 347-355 (2012)). However, subsequent work demonstrated that B7-H3 inhibits the effector functions of T cells and NK cells in vitro and in syngeneic mouse cancer models (Lee et al., Cell Res 27, 1034-1045 (2017)); Cai et al., Cell Mol Immuno 17(3), 227-236 (2020)). In addition, the immunosuppressive activity of B7-H3 has also been described in mouse models of graft-versus-host disease (Veenstra et al., Blood 125, 3335-3346 (2015), cardiac allograft rejection (Ueno et al., Eur J Immunol 42, 2343-2353 (2012), and autoimmune encephalomyelitis (Suh et al., Nat Immunol 4, 899-906 (2003); Prasad et al., J Immunol 73 (4) 2500-2506 (2004)). Therefore, targeting B7-H3 activity can be used to modulate the function or activity of immune cells (e.g., T cells and NK cells).

[0004] It is reported that in solid human tumors including non-small cell lung cancer (NSCLC), breast cancer, ovarian cancer, endometrial cancer, lung cancer, liver cancer and gastric cancer and blood system tumors including diffuse large B-cell lymphoma (DLBCL), acute myeloid leukemia (AML) and mantle cell lymphoma (MCL), B7-H3 expression levels in cancer cells are higher than in healthy tissues. In solid tumors, B7-H3 expression is also detected on surrounding tumor blood vessels and tumor-infiltrating immune cells including osteoid cells (Yim et al., Eur J Cancer 133, 74-85 (2020)).

[0005] P2RY2 has previously been identified as a receptor for extracellular ATP and UTP (Soltoff et al., J Biol Chem 273(5):2653-2660 (1998); Burnstock et al., Purigergic Signal 9,491-540 (2013)). In addition, P2RY2 expression was found to be associated with patient survival in pancreatic ductal adenocarcinoma (Hu et al., Clin Cancer Res 25(4):1318-1330 (2019)).

[0006] Therefore, there is still a need for improved cancer treatment methods to provide advantageous options for the detection, treatment and management of cancer. The technical problem underlying the present invention can be seen as providing means and methods that meet the above needs. The technical problem is solved by the embodiments characterized by the claims and the embodiments characterized below.

[0007] Accordingly, the present invention relates to modulators of P2Y purinergic receptor 2 (P2RY2) activity for use in T cell immunotherapy.

[0008] In general, the terms used herein have their common and customary meanings for those of ordinary skill in the art, unless otherwise specified, and are not limited to special or customized meanings. As used below, the terms "having", "including" or "comprising" or any arbitrary grammatical variants thereof are used in a non-exclusive manner. Therefore, these terms can refer to the situation where there are no other features in the entity described in this context except for the features introduced by these terms, and to the situation where there are one or more other features. As an example, the expressions "A has B", "A includes B" and "A includes B" can refer to the situation where there are no other elements in A except B (that is, the situation where A is composed of B alone and exclusively) and the situation where there are one or more other elements such as element C, element C and D or even other elements in entity A except B. Similarly, as understood by those skilled in the art, the expressions "including" and "comprising" preferably refer to "including one or more than one", that is, equivalent to "including at least one". Thus, unless stated otherwise, a statement relating to one of a plurality of items preferably relates to at least one such item, more preferably to a plurality of such items; thus, for example, identifying a "cell" relates to identifying at least one cell, preferably to identifying a plurality of cells.

[0009] In addition, as used hereinafter, the terms "preferably", "more preferably", "most preferably", "particularly", "more specifically", "particularly", "more specifically" or similar terms are used in combination with optional features without limiting other possibilities. Therefore, the features introduced by these terms are optional features and are not intended to limit the scope of the claims in any way. As will be appreciated by those skilled in the art, the present invention can be implemented by using alternative features. Similarly, features introduced by "in an embodiment" or similar expressions are intended to be optional features, without any limitation on other embodiments of the invention, without any limitation on the scope of the invention, and without any limitation on the possibility of combining the features introduced in this manner with other optional or non-optional features of the invention.

[0010] The method described below is preferably an in vitro method. In principle, the method steps can be performed in any order that the skilled person considers suitable, but are preferably performed in the order shown; in addition, one or more than one of the steps, preferably all of the steps, can be assisted or performed by automated equipment. In addition, the method may include steps other than the steps explicitly mentioned above.

[0011] As used herein, unless otherwise specified, the term "standard conditions" refers to IUPAC standard ambient temperature and pressure (SATP) conditions, i.e., preferably a temperature of 25°C and an absolute pressure of 100 kPa; also preferably, standard conditions include a pH of 7. In addition, if not otherwise specified, the term "about" is the indicated value and the technical accuracy recognized in the relevant field, preferably involving the indicated value ± 20%, more preferably ± 10%, and most preferably ± 5%. In addition, the term "substantially" means that there is no deviation that affects the indicated result or use, that is, the potential deviation will not cause the indicated result to deviate by more than ± 20%, more preferably more than ± 10%, and most preferably more than ± 5%. Therefore, "substantially consisting of..." means including the specified components, but not including other components, except for materials present as impurities, unavoidable materials present as a result of the method used to provide the components, and components added for purposes other than the technical effects of the present invention. For example, the composition defined using the phrase "substantially consisting of..." includes any known acceptable additives, excipients, diluents, carriers, etc. Preferably, a composition consisting essentially of one group of components will contain less than 5 wt%, more preferably less than 3 wt%, even more preferably less than 1 wt%, most preferably less than 0.1 wt% of non-specific components.

[0012] The degree of identity (e.g., expressed as "% identity") between two biological sequences, preferably DNA, RNA or amino acid sequences, can be determined by algorithms known in the art. Preferably, the degree of identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the sequence fragment within the comparison window may include additions or deletions (e.g., gaps or overhangs) compared to the sequences compared to the optimal alignment. The percentage is calculated by counting the number of positions at which the same residue occurs in the two sequences, preferably over the entire length of the polynucleotide or polypeptide, to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The optimal alignment of the sequences for comparison can be performed by the local homology algorithm of Smith and Waterman (1981), the homology alignment algorithm of Needleman and Wunsch (1970), the search similarity method of Pearson and Lipman (1988), the computerized implementation of these algorithms (GAP, BESTFIT, BLAST, PASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI) or by visual inspection. Assuming that two sequences for comparison have been identified, it is preferred to use GAP and BESTFIT to determine their optimal alignment, thereby determining the degree of identity. Preferably, the default values ​​of 5.00 for gap weight and 0.30 for gap weight length are used. In the context of the biological sequences mentioned herein, the term "substantially identical" means having a % identity value of at least 80%, preferably at least 90%, more preferably at least 98%, and most preferably at least 99%. It will be understood that the term substantially identical includes 100% identity.The foregoing applies mutatis mutandis to the term "substantially complementary".

[0013] The term "fragment" of a biomacromolecule, preferably a polynucleotide or a polypeptide, is used in a broad sense herein and relates to any sub-portion, preferably a sub-region, of the corresponding biomacromolecule comprising a specified sequence, structure and / or function. Thus, the term includes sub-portions generated by actual cleavage of the biomacromolecule, as well as sub-portions derived from the corresponding biomacromolecule in an abstract manner, such as by computer. Thus, as used herein, Fc or Fab fragments, as well as, for example, single-chain antibodies, bispecific antibodies and nanobodies, may be referred to as fragments of immunoglobulins.

[0014] Unless otherwise specifically stated herein, the specified compounds, particularly polynucleotides and polypeptides, may be included in a larger structure, for example, they may be covalently or non-covalently linked to other sequences, carrier molecules, flame retardants and other excipients. In particular, the specified polypeptide may be included in a fusion polypeptide comprising other peptides, which may be used as, for example, a tag, a linker, or to extend the in vivo half-life of the compound for purification and / or detection. The term "detectable label" refers to a segment of amino acids added or introduced into a fusion polypeptide; preferably, the label should be added to the C-terminus or N-terminus of the polypeptide of the present invention. The amino acid sequence preferably allows the polypeptide to be detected by an antibody that specifically recognizes the label; or it preferably allows the formation of a functional conformation, such as a chelator; or it preferably allows visualization, such as in the case of a fluorescent label. Preferred detectable labels are Myc tags, FLAG tags, 6-His tags, HA tags, GST tags, or fluorescent protein tags, such as GFP tags. These tags are well known in the art. Other peptides preferably included in the fusion polypeptide include other amino acids or other modifications, which may be used as secretion mediators, blood-brain barrier channel mediators, cell penetrating peptides, and / or immunostimulants. Other polypeptides or peptides to which the polypeptide can be fused are signal and / or transport sequences, such as the IL-2 signal sequence, and linker sequences.

[0015] The term "polypeptide" as used herein refers to a molecule consisting of several, usually at least 20 amino acids covalently linked to each other by peptide bonds. Molecules consisting of less than 20 amino acids covalently linked by peptide bonds are generally considered to be "peptides". Preferably, the polypeptide comprises 50 to 1000, more preferably 75 to 1000, still more preferably 100 to 500, most preferably 110 to 400 amino acids. Preferably, the fusion polypeptide and / or polypeptide complex comprises a polypeptide. Unless otherwise specified, a specific polypeptide mentioned herein preferably includes a polypeptide variant.

[0016] As used herein, the term "polypeptide variant" refers to any chemical molecule comprising at least one polypeptide as described herein, which has the activity shown, but is structurally different from the specific polypeptide. Preferably, the polypeptide variant includes a polypeptide having a continuous amino acid sequence, and the continuous amino acid sequence corresponds to at least 50% of the amino acid sequence of the specific polypeptide indicated, preferably at least 75%, more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95%. In addition, it should be understood that the polypeptide variants mentioned according to the present invention should have different amino acid sequences due to at least one amino acid substitution, deletion and / or addition, wherein the amino acid sequence of the variant is still preferably at least 70% with the amino acid sequence of the specific polypeptide, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, still more preferably at least 98%, and most preferably at least 99% the same. The degree of identity between the two amino acid sequences can be determined by algorithms well known in the art and as described above. The polypeptide variants mentioned above can be allelic variants or any other species-specific homologs, paralogs or orthologs. In addition, the polypeptide variants referred to herein include fragments of specific polypeptides or polypeptide variants of the aforementioned types, as long as these fragments and / or variants have specific biological activities. Such fragments may be or may be derived from, for example, degradation products or splice variants of the polypeptide. Variants that differ by post-translational modifications such as phosphorylation, glycosylation, ubiquitination, SUMOylation or myristoylation are also included, by including unnatural amino acids and / or by peptide mimetics.

[0017] As used herein, the term "polynucleotide" refers to a linear or circular nucleic acid molecule. Preferably, the polynucleotide of the present invention should preferably be provided as an isolated polynucleotide (i.e., isolated from its natural environment) or in a genetically modified form, preferably containing at least one heterologous sequence. The term includes single-stranded and double-stranded polynucleotides. In addition, chemically modified polynucleotides are also included, including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides, or artificially modified derivatives such as biotinylated polynucleotides, locked nucleic acids, etc. The polynucleotides of the present invention have the activity of encoding a P2RY2 activity regulator or have the activity of a P2RY2 activity regulator. Methods for testing whether a given polynucleotide has the above-mentioned activity are known in the art. For example, preferably, a candidate polynucleotide of interest can be introduced into a host cell, and the amount and / or activity of the resulting P2RY2 can be determined, preferably compared with a control. Unless otherwise specified, the specific polynucleotides mentioned herein preferably include polynucleotide variants.

[0018] As used herein, the term "polynucleotide variant" refers to a polynucleotide variant comprising a nucleic acid sequence as referred to herein, characterized in that the sequence can be derived from the aforementioned specific nucleic acid sequence by at least one nucleotide substitution, addition and / or deletion, wherein the polynucleotide variant should have a specific activity of a specific polynucleotide. Preferably, the polynucleotide variant is an ortholog, a paralog or another homolog of a specific polynucleotide. Also preferably, the polynucleotide variant is or is derived from a non-naturally occurring allele of a specific polynucleotide. Polynucleotide variants also include polynucleotides containing a nucleic acid sequence that can hybridize with the aforementioned specific polynucleotide, preferably under stringent hybridization conditions. These stringent conditions are known to the skilled person and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. The skilled person knows how to determine the required hybridization conditions by referring to textbooks such as the above or the following textbooks: Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach", IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach", IRL Press at Oxford University Press, Oxford. Alternatively, polynucleotide variants can be obtained based on PCR techniques, such as DNA amplification based on mixed oligonucleotide primers, i.e., using degenerate primers for the conserved domains of the polypeptides of the present invention. The conserved domains of the polypeptides can be identified by comparing the nucleic acid sequence of the polynucleotide or the amino acid sequence of the polypeptides of the present invention with the sequences of other organisms. DNA or cDNA from bacteria, fungi, plants, or preferably from animals can be used as templates. In addition, variants include polynucleotides comprising a nucleic acid sequence that is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95%, still more preferably at least 98%, and most preferably at least 99% identical to a specifically specified nucleic acid sequence. In addition, polynucleotides comprising a nucleic acid sequence encoding an amino acid sequence that is at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, still more preferably at least 98%, and most preferably at least 99% identical to a specifically specified amino acid sequence.Preferably, the percentage identity value is calculated over the entire amino acid or nucleic acid sequence region, preferably as described above. The polynucleotides of the present invention are composed of, substantially composed of, or comprise the aforementioned nucleic acid sequences. Therefore, they may also contain other nucleic acid sequences. Specifically, the polynucleotides of the present invention may encode fusion proteins, wherein one partner of the fusion protein is a polypeptide encoded by the nucleic acid sequence as described herein. In addition, the polynucleotides may be contained in a vector.

[0019] The term "vector" preferably includes bacteriophage, plasmid, virus or retroviral vector and artificial chromosome, such as bacterial artificial chromosome or yeast artificial chromosome. In addition, the term also relates to a targeting construct, which allows the targeting construct to be randomly or site-specifically integrated into genomic DNA. This target construct preferably comprises DNA of sufficient length for homologous or heterologous recombination, as described in detail below. The vector comprising the polynucleotide of the present invention preferably also comprises a selectable marker for propagation and / or selection in a host. The vector can be introduced into a host cell by various techniques well known in the art. For example, a plasmid vector can be introduced into a precipitate such as a calcium phosphate precipitate or a rubidium chloride precipitate, or into a complex of a charged lipid or into a carbon group cluster such as fullerene. Alternatively, a plasmid vector can be introduced into a host cell by heat shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line before being applied to a host cell. Retroviral vectors may have replication ability or replication defects. In the latter case, viral proliferation will usually only occur in a complementary host / cell. More preferably, in the vector of the present invention, the polynucleotide is effectively connected with the expression control sequence that allows expression in prokaryotic or eukaryotic cells or their separated parts, i.e., preferably, the polynucleotide is contained in the expression vector. The expression of the polynucleotide includes the polynucleotide being transcribed into RNA, preferably as described above. It is well known in the art to ensure that the regulatory elements expressed in eukaryotic cells, preferably mammalian cells, are well known in the art. Preferably, they include regulatory sequences that ensure transcription initiation and optionally poly-A signals that ensure transcription termination and transcript stability. Other regulatory elements may include transcription enhancers and translation enhancers. Possible regulatory elements that allow expression in prokaryotic host cells include, for example, lac promoter, trp promoter or tac promoter in Escherichia coli, and examples of regulatory elements that allow expression in eukaryotic host cells are AOX1 promoter or GAL1 promoter or CMV promoter, SV40 promoter, RSV promoter (Rous sarcoma virus), CMV enhancer, SV40 enhancer or globin introns in mammals and other animal cells in yeast. In addition, inducible expression control sequences can be used in the expression vectors encompassed by the present invention. Such inducible vectors may comprise tet operator or lac operator sequences or sequences that are inducible by heat shock or other environmental factors. Suitable expression control sequences are well known in the art. In addition to the elements responsible for transcription initiation, these regulatory elements may also comprise transcription termination signals, such as SV40-poly-A sites or tk-poly-A sites downstream of the polynucleotide.In this context, suitable expression vectors are known in the art, such as the Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pBluescript (Stratagene), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (InVitrogene), or pSPORT1 (GIBCO BRL). Preferably, the vector is an expression vector and a gene transfer vector or a targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia viruses, adeno-associated viruses, herpes viruses, or bovine papilloma viruses can be used to deliver polynucleotides or vectors to a target cell population. Recombinant viral vectors can be constructed using methods well known to those skilled in the art; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) NY and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1994).

[0020] The term "P2Y purinergic receptor 2", which is known to the skilled person, may be abbreviated as "P2RY2", and is related to members of the group of G protein-coupled receptors, which respond to both adenosine and uridine nucleotides. Preferably, P2RY2 is mammalian P2RY2, more preferably human P2RY2, most preferably having an amino acid sequence with Genbank accession numbers NP_002555.4, NP_788085.3 or NP_788086.3, preferably encoded by a nucleic acid sequence with Genbank accession numbers NM_002564.4, NM_176071.3 or NM_176072.3. Preferably, P2RY2 is P2RY2 expressed by cancer cells or T cells that mediate autoimmune diseases.

[0021] The term "activity modulator" is known to the skilled person and relates to any compound that causes the activity of a biomolecule or pathway to deviate, preferably significantly deviate from the activity in the absence of the activity modulator. Preferably, the deviation is at least 20%, more preferably at least 50%, even more preferably at least 75%, even more preferably at least 90% of the value of the activity parameter that can be determined in the absence of the activity modulator, especially when the activity modulator is a compound that reduces the activity; however, the deviation can also be at least 2 times, preferably at least 5 times, more preferably at least 10 times, especially when the activity modulator is a compound that increases the activity. However, as will be understood by the skilled person from the description below, regulation can also be the complete elimination of the activity present in the absence of the modulator; or it can be a de novo activity that does not exist in the absence of the modulator. The effect of the activity modulator can be temporary, for example for a period of hours or days, or can be permanent, in particular depending on the specific choice of the modulator. Preferably, the effect is temporary and lasts from 1 day to 6 months, preferably from 2 days to 2 months, more preferably from 3 days to 4 weeks, and most preferably from 1 week to 4 weeks. Those skilled in the art will also appreciate that the effect may be local, ie, local to the site of administration, or may be systemic, such as following systemic administration of the active modulator.

[0022] Preferably, the activity modulator is a compound that reduces activity; thus, preferably, a P2RY2 activity modulator is a compound that reduces P2RY2 activity, preferably a compound that reduces specific P2RY2 activity. Preferably, the compound that reduces specific P2RY2 activity inhibits non-specific P2RY2 activity by up to 50%, preferably up to 25%, more preferably up to 10% at a concentration that inhibits P2RY2 activity by 90%. The activity of the compound that reduces P2RY2 activity is preferably determined in vitro by determining the amount and / or enzymatic activity of P2RY2 as described elsewhere herein, preferably as shown in the Examples herein. Also preferably, the compound that reduces P2RY2 activity increases T cell anti-cancer activity in vitro and / or in vivo. Known polypeptide gene products such as compounds that reduce P2RY2 activity can be provided by a skilled person by standard methods of molecular biology, for example as described below. Preferably, when the T cell immunotherapy is a cancer T cell immunotherapy, the P2RY2 activity modulator is a compound that reduces P2RY2 activity.

[0023] Preferably, the compound that reduces the activity of P2RY2 is a compound that directly reduces the activity of P2RY2, i.e. a compound that binds to P2RY2, preferably specifically binds to P2RY2, and thereby inhibits P2RY2. More preferably, the compound that directly reduces the activity of P2RY2 is a small molecule inhibitor, a polypeptide inhibitor, a polynucleotide inhibitor or a non-polypeptide non-polynucleotide inhibitor macromolecule. Preferably, the compound that directly reduces the activity of P2RY2 is a compound that binds to at least one epitope in P2RY2, preferably an epitope including an interaction epitope and / or an epitope of at least one amino acid in the active center of P2RY2. The skilled person is aware of methods suitable for determining the binding of direct inhibitors to P2RY2, such as staining P2RY2-positive cells or extracts of such cells with a candidate direct inhibitor, wherein the inhibitor is coupled to a detectable label, preferably a colored and / or fluorescent dye; ELISA method; surface plasmon resonance method, etc.

[0024] As used herein, the term "small molecule" relates to a chemical molecule with a molecular weight of at most 2.5 kDa, preferably at most 2 kDa, more preferably at most 1.5 kDa, most preferably at most 1 kDa. A "small molecule inhibitor" can in principle be a molecule from any chemical class. Preferably, the small molecule inhibitor is an organic molecule, i.e. comprises at least one carbon-carbon bond. Small molecule inhibitors of P2RY2 activity are known in the art, in particular for example from WO 1999 / 002501. AR-C 118925XX (CAS number: 216657-60-2) can be identified by the method described below.

[0025] The term "polypeptide inhibitor" is used herein to refer to any and all polypeptides or peptides that bind to P2RY2 and inhibit its activity. Therefore, the polypeptide inhibitor is preferably an antagonist, more preferably a competitive antagonist or a non-competitive antagonist. Preferably, the polypeptide inhibitor is selected from antibodies, aptamers, anticalins and designed ankyrin repeat proteins (DARPins).

[0026] As used herein, the term "antibody" refers to a soluble immunoglobulin or a fragment thereof from any of the classes IgA, IgD, IgE, IgG or IgM, having the activity of directly interacting with P2RY2 and inhibiting the activity of P2RY2 as described above. Antibodies against P2RY2 or a fragment thereof can be prepared by well-known methods using a purified P2RY2 polypeptide or a suitable fragment derived therefrom as an antigen. Fragments suitable as antigens can be identified by antigenicity determination algorithms well known in the art. Suitable fragments can also be obtained from the P2RY2 polypeptide by proteolytic digestion, which can be synthetic peptides, or can be recombinantly expressed. The suitability of the antibodies thus generated as P2RY2 inhibitors can be tested by the assays described elsewhere herein. Preferably, the antibody of the present invention is a monoclonal antibody, a human, primate chimeric or humanized antibody or a fragment thereof. More preferably, the antibody is a single-chain antibody, a single-domain antibody, a nanobody or an antibody fragment, such as Fab, scFab, etc. The antibodies of the present invention also include bispecific antibodies, synthetic antibodies or chemically modified derivatives of any of the aforementioned antibodies. Preferably, the antibodies of the invention will specifically bind (i.e., will not cross-react with other polypeptides or peptides) to a P2RY2 polypeptide as described above. Specific binding can be tested by a variety of well-known techniques. Antibodies or fragments thereof can be obtained using, for example, the methods described in Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. Monoclonal antibodies can be obtained by initially making a monoclonal antibody in a and Milstein, Nature. 1975. 256: 495 and Galfr, Meth. Enzymol. 1981, 73: 3, comprising the fusion of mouse myeloma cells with spleen cells from an immunized mammal. Preferably, the antibody is an antibody as described above or a polypeptide derivative thereof; more preferably, the antibody is an antibody as described above.

[0027] As used herein, the term "aptamer" refers to a polynucleotide or polypeptide that specifically binds to a target molecule through its three-dimensional structure. Preferably, the aptamer is a peptide aptamer, and a "peptide aptamer" is preferably a peptide that specifically interacts with P2RY2, thereby inhibiting the activity of P2RY2 as mentioned above. Peptide aptamers are preferably peptides comprising 8 to 80 amino acids, more preferably 10 to 50 amino acids, and most preferably 15 to 30 amino acids. They can be isolated, for example, from a random peptide expression library in a suitable host system such as baker's yeast (see, for example, Klevenz et al., Cell Mol Life Sci. 2002, 59: 1993-1998). Peptide aptamers are preferably free peptides; however, it is also contemplated that peptide aptamers are fused to polypeptides to act as "scaffolds", which means covalently attached to the polypeptide to fix the three-dimensional structure of the peptide aptamer in a specific conformation. More preferably, peptide aptamers are fused to transport signals, particularly cell penetrating peptides. Preferably, the aptamer is an aptamer as described above or a polypeptide or polynucleotide derivative thereof; more preferably, the aptamer is an aptamer as described above.

[0028] As used herein, the term "anticalin" relates to an artificial polypeptide derived from a lipocalin that specifically binds to P2RY2 and inhibits P2RY2 activity. Similarly, a "designed ankyrin repeat protein" or "DARPin" as used herein is an artificial polypeptide comprising several ankyrin repeat motifs that specifically bind to P2RY2 and inhibit P2RY2 activity. Preferably, the anticalin or DARPin is an anticalin or DARPin as described above or a polypeptide derivative thereof; more preferably, the anticalin or DARPin is an anticalin or DARPin as described above.

[0029] As used herein, the term "non-polypeptide non-polynucleotide inhibitor macromolecule" refers to any and all molecules that have the property of being a direct inhibitor of P2RY2 and are macromolecules, preferably biomacromolecules. As used herein, the term "macromolecule" refers to a molecule with a molecular weight greater than 1 kDa, preferably greater than 1.5 kDa, more preferably greater than 2 kDa, and most preferably greater than 2.5 kDa. As will be appreciated by those skilled in the art, the non-polypeptide non-polynucleotide inhibitor macromolecule is preferably neither a polypeptide nor a polynucleotide, although the non-polypeptide non-polynucleotide inhibitor macromolecule may contain a substructure belonging to one of the above molecular categories. Preferably, the non-polypeptide non-polynucleotide inhibitor macromolecule is a polysaccharide and / or a lipid.

[0030] It is also preferred that the compound that reduces the activity of P2RY2 is a compound that does not directly inhibit the activity of P2RY2, but still reduces, preferably significantly reduces, the activity of P2RY2 in the target cell. It is preferred that the compound that indirectly reduces the activity of P2RY2 is a compound that reduces the amount of P2RY2 in the target cell. It is preferred that the compound that indirectly reduces the activity of P2RY2 specifically binds to a P2RY2 encoding polynucleotide, preferably thereby significantly reducing, more preferably preventing the expression of P2RY2. It is also preferred that the compound that indirectly reduces the activity of P2RY2 is or binds to, preferably specifically binds to, a transcriptional regulator of the P2RY2 gene, preferably thereby significantly reducing, more preferably preventing P2RY2 transcription. Therefore, the compound that indirectly reduces the activity of P2RY2 may be a transcriptional repressor of P2RY2 transcription or may be an inhibitor of a transcriptional activator of P2RY2 transcription. However, the compound that indirectly reduces the activity of P2RY2 may also be a compound that accelerates the degradation of P2RY2 in cells or a compound that reduces the concentration of P2RY2 activators, in particular nucleotides; therefore, the compound that indirectly reduces the activity of P2RY2 is preferably an apyrase (EC 3.6.1.5), a nucleoside triphosphate phosphatase (EC 3.6.1.15) or a triphosphatase (EC 3.6.1.25).

[0031] Preferably, the compound that indirectly reduces the activity of P2RY2 is a polynucleotide, more preferably a polynucleotide that inhibits the expression of P2RY2 mRNA or induces its degradation. More preferably, the compound that indirectly reduces the activity of P2RY2 is selected from shRNA agents, siRNA agents, miRNA agents, ribozymes, antisense molecules / inhibitory oligonucleotides and CRISPR / Cas oligonucleotides. The skilled person will appreciate that inhibiting the expression of a specific RNA or inducing its degradation can be achieved in a variety of ways. The skilled person will also appreciate that the specific embodiment of the polynucleotide as a compound that indirectly reduces the activity of P2RY2 of the present invention will depend on the intended treatment.

[0032] Preferably, the compound that indirectly reduces the activity of P2RY2 is a ribozyme. The term "ribozyme" as used herein refers to a catalytic RNA molecule with a well-defined tertiary structure that allows catalysis of the hydrolysis of one of its own phosphodiester bonds (ribozyme self-cleavage), or catalysis of the hydrolysis of bonds of other RNAs, but they are also found to catalyze the transaminase activity of the ribosome. The ribozymes envisaged according to the present invention are preferably those that specifically hydrolyze their target RNA, preferably P2RY2 mRNA, i.e., RNA preferably transcribed from the P2RY2 gene. In particular, hammerhead ribozymes are preferred according to the present invention. How to generate and use such ribozymes is well known in the art (see, for example, Hean & Weinberg (2008), RNA and the Regulation of Gene Expression: A Hidden Layer of Complexity, Chapter 1. Caister Academic Press).

[0033] More preferably, the compound that indirectly reduces the activity of P2RY2 is an antisense oligonucleotide. The term "antisense oligonucleotide" is known to the skilled person and relates to an oligonucleotide that hybridizes with a target RNA, resulting in the formation of a DNA / RNA hybrid. The DNA / RNA hybrid is a substrate for RNase H, which degrades the RNA portion of the DNA / RNA hybrid. Thus, the antisense oligonucleotide comprises at least five, preferably at least seven, more preferably at least nine, most preferably at least ten DNA nucleotides. Preferably, the antisense oligonucleotide is at least 15 nucleotides, preferably at least 18 nucleotides, even more preferably at least 20 nucleotides in length, preferably complementary to the P2RY2 mRNA sequence as described above.

[0034] Most preferably, the compound that indirectly reduces the activity of P2RY2 is a polynucleotide that induces RNA interference. As used herein, "RNA interference (RNAi)" refers to the silencing of a selected target gene sequence-specific post-transcriptional gene by degrading RNA transcribed from the target gene (target RNA). Preferably, the target RNA is P2RY2 mRNA, i.e., RNA transcribed from the P2RY2 gene as described above. It should be understood that silencing as used herein does not necessarily mean complete elimination of expression. Compared to the expression level in a reference without RNAi, RNAi preferably reduces expression by at least 40%, more preferably at least 60%, even more preferably at least 80%, and most preferably at least 90%. RNAi requires the presence of dsRNAs homologous to the target RNA sequence in the target cell. The term "dsRNA" refers to an RNA having a double helix structure comprising two complementary and antiparallel nucleic acid chains. The RNA chains forming the dsRNA may have the same or different numbers of nucleotides, wherein one dsRNA chain may be the target RNA. However, the present invention also contemplates that dsRNA is formed between two sequence fragments on the same RNA molecule, for example by forming a stem-loop structure. RNAi can be used to specifically inhibit the expression of target RNAs of the present invention in vivo. Therefore, it can be used for medical purposes specified elsewhere herein. For this treatment method, the expression construct of siRNA can be introduced into the target cells of the host. Therefore, siRNA can be effectively used in combination with other treatment methods. It is known in the art to be related to methods for using RNAi to silence animal (including mammalian) genes.

[0035] Therefore, the compound that indirectly reduces the activity of P2RY2 is preferably an RNAi agent. As used herein, the term "RNAi agent" refers to shRNA, siRNA agent or miRNA agent as described below. The RNAi agent of the present invention has sufficient length and complementarity to stably interact with the target RNA, that is, it contains at least 15, at least 17, at least 19, at least 21, at least 22 nucleotides complementary to the target RNA. "Stable interaction" refers to the interaction between the RNAi agent or its product produced by the target cell and the target RNA, for example, forming hydrogen bonds with complementary nucleotides in the target RNA under physiological conditions.

[0036] The term "siRNA agent" as referred to herein includes: a) dsRNA consisting of at least 15, at least 17, at least 19, at least 21 consecutive nucleotides of base pairing, i.e., forming hydrogen bonds with complementary nucleotides. b) Small interfering RNA (siRNA) molecules or molecules comprising siRNA molecules. siRNA is a single-stranded RNA molecule, preferably greater than or equal to 15 nucleotides in length, and preferably 15 to 49 nucleotides in length, more preferably 17 to 30 nucleotides, and most preferably 17 to 30 nucleotides, preferably 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. According to the present invention, the term "molecule comprising siRNA molecules" includes RNA molecules of siRNAs processed from cells, preferably mammalian cells. Therefore, the molecule comprising siRNA molecules is preferably a small hairpin RNA, also referred to as shRNA. As used herein, the term "shRNA" refers to preferably an artificial RNA molecule that forms a stem-loop structure, comprising at least 10, preferably at least 15, more preferably at least 17, and most preferably at least 20 nucleotides that base pair with the complementary sequence on the same mRNA molecule ("stem"), i.e., dsRNA, separated by a stretch of non-base-paired nucleotides ("loop"). c) A polynucleotide encoding a) or b), wherein, preferably, the polynucleotide is operably linked to an expression control sequence. Therefore, the function of the siRNA agent to inhibit the expression of the target gene can be regulated by the expression control sequence. Preferred expression control sequences are those that can be regulated by exogenous stimuli, such as the tet operator, whose activity can be regulated by tetracycline or heat-inducible promoters. Alternatively or in addition, one or more than one expression control sequence that allows tissue-specific expression of the siRNA agent can be used.

[0037] However, the present invention also contemplates that the RNAi agent is a miRNA agent. "MiRNA agents" referred to herein include: a) microRNA precursors (pre-microRNA), i.e., mRNAs comprising at least 30, at least 40, at least 50, at least 60, at least 70 nucleotides, which are base-paired with complementary sequences on the same mRNA molecule ("stem"), i.e., as dsRNAs, separated by a stretch of non-base-paired nucleotides ("loop"). b) microRNA precursors, i.e., dsRNA molecules comprising at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 base-paired nucleotides formed by nucleotides of the same RNA molecule (stem), which are separated by loops. c) microRNA (miRNA), i.e., dsRNAs comprising at least 15, at least 17, at least 18, at least 19, at least 21 nucleotides on two separate RNA chains. d) A polynucleotide encoding a) or b), wherein, preferably, the polynucleotide is operably linked to an expression control sequence as described above.

[0038] It is also preferred that the compound that indirectly reduces the activity of P2RY2 comprises at least one, preferably two CRISPR / Cas oligonucleotides. The CRISPR / Cas system has been used for several years as a convenient system for inducing knockout mutations, i.e., deletions, preferably deletions of chromosomal genes. The skilled person knows how to design suitable oligonucleotides, which are preferably expressed from a vector, to induce the deletion of a DNA sequence of interest. Preferably, the deletion is a partial deletion, more preferably a partial deletion of a functionally essential gene; most preferably, the deletion is a complete deletion of at least the entire coding region. As is known in the art, a single CRISPR / Cas oligonucleotide can be used to introduce short insertions, deletions and / or frameshifts into a coding sequence of interest, while two CRISPR / Cas oligonucleotides can be used to mediate larger deletions or deletions of exons, coding regions and / or entire genes. As described herein, two CRISPR / Cas oligonucleotides that together mediate such partial or complete deletions of at least one exon, coding region and / or entire gene are referred to as "a pair of CRISPR / Cas oligonucleotides".

[0039] Also preferably, the compound that indirectly reduces the activity of P2RY2 is a polypeptide comprising a lysosomal degradation sequence, preferably a molecular partner-mediated autophagy targeting motif (CTM). Preferably, the CTM-containing polypeptide specifically binds to P2RY2; for example, the CTM-containing polypeptide may further comprise an antibody that specifically binds to P2RY2. As will be appreciated by the skilled artisan, the CTM-conjugated antibody does not necessarily have to be an inhibitory P2RY2 antibody as described above; however, it is preferred that the antibody is a P2RY2-specific antibody. Preferably, the CTM-containing polypeptide that specifically binds to P2RY2 has a KD value for binding to P2RY2 that is at least 10 times higher than the KD value of the CTM-containing polypeptide for other G protein-coupled receptors, preferably at least 20 times, more preferably at least 50 times, and most preferably at least 100 times. More preferably, the CTM-containing polypeptide that specifically binds to P2RY2 does not detectably bind to other cellular proteins, preferably including non-P2RY2 G protein-coupled receptors. As will be appreciated by the skilled artisan, in the case where the compound that indirectly reduces P2RY2 activity is a polypeptide comprising a CTM, the polypeptide comprising a CTM is not necessarily, but may be, a compound that directly reduces P2RY2 activity. Therefore, preferably, the CTM-containing polypeptide is also a compound that directly reduces P2RY2 activity.

[0040] It is also preferred that the activity modulator is an activity increasing compound; thus, preferably, the P2RY2 activity modulator is a compound that increases the activity of P2RY2, preferably a P2RY2 specific activity increasing compound. Preferably, the P2RY2 specific activity increasing compound activates the non-P2RY2 specific activity by at most 50%, preferably at most 25%, more preferably at most 10%, at a concentration that activates 90% of the P2RY2 activity. The activity of the compound that increases the activity of P2RY2 is preferably determined in vitro by determining the amount and / or enzymatic activity of P2RY2, as described elsewhere herein, preferably as shown in the examples herein. It is also preferred that the compound that increases the activity of P2RY2 reduces T cell-mediated autoimmune activity in vitro and / or in vivo. Compounds that increase the activity of known polypeptide gene products such as P2RY2 can be provided by the skilled person by standard methods of molecular biology, for example as described below. Preferably, in the case where the T cell immunotherapy is the treatment of a T cell-mediated autoimmune disease, the P2RY2 activity modulator is a compound that increases the activity of P2RY2, as described below.

[0041] Preferably, the compound that increases P2RY2 activity is a compound that directly increases P2RY2 activity by binding to and activating P2RY2 activity, more preferably a small molecule activator, a polypeptide activator, a polynucleotide activator, or a non-polypeptide non-polynucleotide activator macromolecule.

[0042] The term "small molecule" has been explained in detail above. Therefore, the term "small molecule activator" used herein relates to a small molecule compound that increases the activity of P2RY2. Small molecule activators of P2RY2 are known in the art, and specifically include nucleotides and their derivatives. Therefore, the small molecule activator of P2RY2 is preferably ATP or UTP or a derivative thereof, more preferably MRS 2768 (uridine-5'-tetraphosphate δ-phenyl ester, CAS No.: 1047980-83-5), uridine-5'-(γ-thio)-triphosphate (CAS No.: 1266569-94-1), 4-thiouridine-5'-O-(β,γ-difluoromethylene) triphosphate (CAS No.: 1657025-60-9), denufosol (CAS No.: 211448-85-0) or diquafosol (CAS No.: 59985-21-6).

[0043] The term "polypeptide activator" used herein includes any and all polypeptides that have an activating effect on P2RY2. Preferably, the polypeptide activator is an activator antibody, preferably a P2RY2 agonist antibody.

[0044] Also preferably, the compound that increases the activity of P2RY2 is a compound that indirectly increases the activity of P2RY2, i.e., a compound that does not bind to P2RY2 but increases the activity of P2RY2. Preferably, the indirect P2RY2 activator is (i) a polypeptide comprising a P2RY2 polypeptide; (ii) a polynucleotide encoding a polypeptide comprising a P2RY2 polypeptide; (iii) a vector comprising the polynucleotide of (ii); (iv) a host cell comprising the polynucleotide of (ii) and / or the vector of (iii); or (v) any combination of (i) to (iv). However, the compound that indirectly increases the activity of P2RY2 may also be an apyrase inhibitor, a nucleoside triphosphate phosphatase inhibitor, or a triphosphatase inhibitor.

[0045] Exemplary sequences of P2RY2 polypeptides and polynucleotides encoding P2RY2 have been indicated above. Exemplary vectors, in particular expression vectors, suitable for containing a polynucleotide encoding a polypeptide comprising a P2RY2 polypeptide have also been discussed above.

[0046] The term "T cell" is considered by technicians to refer to a lymphocyte expressing at least one T cell receptor. Preferably, the T cell is a CD8+T cell that recognizes MHC class I molecules on the surface of the target cell, or a CD4+T cell that recognizes MHC class II molecules on the surface of the target cell, more preferably a CD8+T cell. Preferably, the T cell is a cytotoxic T cell, more preferably a CD8+ cytotoxic T cell, which may also be referred to as a "killer cell". It is also preferred that the T cell is a regulatory T cell or a helper T cell, more preferably a regulatory T cell. Preferably, the T cell is reactive to cancer cells, that is, a cancer reactive T cell or a cell presenting a T cell autoantigen, that is, a T cell that mediates an autoimmune disease. Therefore, preferably, the T cell expresses a TCR that recognizes a cancer antigen, preferably a cancer-specific antigen. It is also preferred that the T cell expresses a TCR that recognizes an autoimmune T cell antigen, preferably a specific autoimmune T cell antigen. Preferably, the T cell is a recombinant cell expressing a chimeric antigen receptor (CAR) and / or a recombinant T cell receptor. Methods for preparing suitable recombinant T cells are known in the art.

[0047] The term "treatment" refers to improving the disease or condition mentioned herein or the accompanying symptoms to a significant extent; as used herein, the term includes preventing the disease, condition or the accompanying symptoms from worsening. The treatment used herein also includes the complete recovery of health of the disease or condition referred to herein. It should be understood that the term treatment used herein may not be effective for all subjects to be treated. However, the term should preferably require that a statistically significant portion of subjects suffering from the disease or condition mentioned herein can be successfully treated. A person skilled in the art can determine whether a certain part is statistically significant without further trouble using various well-known statistical evaluation tools, such as determining confidence intervals, p-value determination, Student's t-test, Mann-Whitney test, etc. Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. The p-value is preferably 0.1, 0.05, 0.01, 0.005 or 0.0001. Preferably, the treatment will be effective for at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the subjects in a given group or population. Preferably, the treatment comprises activating an immune response to an agent that causes or mediates the disease, i.e., an immune response to cancer cells; or in the case of an autoimmune disease, comprising suppressing an immune response to host cells that cause or mediate the disease. Preferably, treating cancer is to reduce the tumor and / or cancer cell burden of the subject. As will be appreciated by those skilled in the art, for example, the effectiveness of cancer treatment depends on a variety of factors, including, for example, the cancer stage and the cancer type. Also preferably, cancer treatment also includes at least one of surgery, chemotherapy and radiotherapy.

[0048] The term "prevention" refers to maintaining the health of an object for a disease or condition described herein over a period of time. It should be understood that the time period may depend on the amount of the drug compound that has been administered and the individual factors of the object discussed elsewhere in this specification. It should be understood that prevention may not be effective in all objects treated with compounds according to the present invention. However, the term requires that a statistically significant portion of the objects of a group or population is preferably effectively prevented from suffering from a disease or condition referred to herein or its associated symptoms. Preferably, the group or population of the object envisioned in this case, usually, that is, if there is no preventive measure according to the present invention, will develop a disease or condition referred to herein. Those skilled in the art can use various well-known statistical evaluation tools discussed elsewhere in this specification to effortlessly determine whether a portion is statistically significant. In the case of cancer treatment, prevention particularly relates to preventing cancer development, preventing metastasis formation and / or preventing recurrence, preferably relates to preventing metastasis formation and / or preventing recurrence.

[0049] The term "immunotherapy" as used herein relates to treating and / or preventing a disease, preferably cancer and / or an autoimmune disease, by regulating the immune response of a subject. The regulation may be inducing, enhancing or inhibiting the immune response, for example by administering a P2RY2 modulator, and optionally additionally administering at least one immune checkpoint regulator and / or cytokine, preferably an immune checkpoint inhibitor and / or cytokine. Preferably, in this case, the cytokine is an interferon, an interleukin or a chemokine. Immunotherapy may further include administering at least one T cell engager, i.e., a molecule that binds T cells to target cells; corresponding T cell engagers, such as bispecific T cell engagers (BiTEs) such as bispecific antibodies, are known in the art.

[0050] The term "T cell immunotherapy" relates to a therapy for a disease, which includes regulating T cell activity, such as the activity of cancer-specific T cells (cancer T cell immunotherapy); as used herein, the term regulating T cell activity relates to regulating the activity of T cells, preferably in a subject, which may require regulating the activity of already existing T cells, such as in a subject, but may also include administering enriched and / or genetically modified T cells to recognize a target of interest, preferably a cancer antigen. Therefore, T cell immunotherapy may be particularly adoptive T cell immunotherapy, preferably including the administration of tumor infiltrating lymphocytes (TIL), i.e., TIL therapy, and / or including the administration of genetically engineered T cells, particularly genetically modified T cells expressing chimeric antigen receptors (CARs) and / or recombinant T cell receptors (TCRs), i.e., genetically engineered T cell immunotherapy. As will be understood by those skilled in the art from the disclosure herein, as described herein, T cells are effector cells that mediate or contribute to T cell immunotherapy; however, the T cells are not necessarily target cells of the P2RY2 activity modulator; therefore, the effect of the P2RY2 activity modulator may preferably be mediated by the effect of the P2RY2 activity modulator on the target cells of the T cells, such as cancer cells and / or cells presenting autoimmune T cell antigens.

[0051] Preferably, T cell immunotherapy also includes administering immune checkpoint inhibitors, administering chemokines, and identifying at least one, preferably at least two, and more preferably all three of the objects that can receive T cell immunotherapy before treatment. More preferably, T cell immunotherapy includes identifying the object that can receive T cell immunotherapy before treatment, or includes identifying the object that can receive T cell immunotherapy before treatment, and (i) administering immune checkpoint inhibitors, (ii) administering cytokines and / or (iii) administering T cell adapters. However, T cell immunotherapy can also include the in situ activation of the existing T cells of the object, so it is unnecessary to administer T cells. In addition, particularly in the case of cancer treatment, T cell immunotherapy can include the separation of T cells, the in vitro activation of the T cells, and re-application to the same or different objects, preferably the same object (autologous treatment).

[0052] Preferably, T cell immunotherapy is usually administered systemically, preferably orally or parenterally, for example, by intravenous administration, or topically, preferably intratumorally, topically, or by inhalation; in the case of cancer treatment, topically, it may be intratumorally or peritumorally, and / or topically at the site of tumor resection. However, administration may also be into a blood vessel, typically an artery, and delivered to the intended site of action, such as a tumor. However, depending on the nature of the formulation and the intended therapeutic application, the drug may also be administered by other routes. T cell immunotherapy is preferably administered in a conventional dosage form prepared by combining the drug with a standard drug carrier according to conventional procedures. These steps may include mixing, granulating, compressing or dissolving appropriate ingredients to obtain the intended formulation.

[0053] The term "cancer" as used herein relates to a disease in animals, including humans, characterized by the uncontrolled growth of a group of somatic cells ("cancer cells"). This uncontrolled growth may be accompanied by invasion and destruction of surrounding tissues, and the cancer cells may spread to other parts of the body. Preferably, the term cancer also includes the recurrence of cancer. Thus, preferably, the cancer is a solid cancer, a metastatic cancer or a recurrence thereof. Preferably, the cancer is selected from the group consisting of acute lymphocytic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, atypical teratoma, basal cell carcinoma, bile duct cancer, bladder cancer, brain stem glioma, breast cancer, Burkitt's lymphoma, carcinoid tumor, cerebellar astrocytoma, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myeloid leukemia, colon cancer, colorectal cancer, craniopharyngioma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal stromal tumor, gestational trophoblastic tumor, hairy cell leukemia, head and neck cancer, hepatocellular carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamus and visual pathway Glioma, intraocular melanoma, Kaposi's sarcoma, laryngeal cancer, medulloblastoma, medullary epithelioma, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, multiple endocrine neoplasms, multiple myeloma, mycosis fungoides, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low-grade malignant potential tumor, pancreatic cancer, papillomatosis, paranasal and paranasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome syndrome), small cell lung cancer, small intestinal cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, testicular cancer, pharyngeal cancer, thymic cancer, thymoma, thyroid cancer, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia ( More preferably, the cancer is a solid cancer, a metastatic cancer or a recurrent cancer thereof. More preferably, the cancer is a glioblastoma, a pancreatic ductal adenocarcinoma, an osteosarcoma or a brain metastasis of a non-brain primary tumor.

[0054] The term "cancer antigen" relates to an antigen, preferably a polypeptide, expressed by a cancer cell. Preferably, the expression rate of the cancer antigen in non-cancer cells is at least 5 times lower, preferably at least 10 times lower, and more preferably at least 25 times lower. Preferably, the cancer antigen is not expressed in non-tumor cells of the same tissue of the subject, more preferably, not expressed in non-cancer cells of the subject; therefore, the cancer antigen is preferably a cancer-specific antigen. More preferably, the cancer antigen is a new antigen and / or comprises a new epitope expressed by a cancer cell. However, the cancer antigen may also be a foreign antigen of the subject, in particular a viral, bacterial or microbial antigen, preferably a cancer antigen. In particular, viral cancer antigens are known in the art, including, for example, antigens derived from human papillomavirus E6 and E7 genes, Epstein-Barr virus LMP-1 protein, and the like. Preferably, one or more than one peptide of the cancer antigen is presented as a "cancer epitope" on the surface of the host cell producing the cancer antigen through an MHC molecule, more preferably an MHC class I molecule, which is preferably a cancer-specific epitope, or, as described above, a cancer-associated viral epitope and / or a cancer neo-epitope.

[0055] In principle, it is known to the person skilled in the art that the term "autoimmune T cell activation antigen" relates to any antigen presented by a subject cell, the recognition of which causes, exacerbates or contributes to an autoimmune disease, preferably a T cell-mediated autoimmune disease. T cell-mediated autoimmune diseases are known in the art; preferably, a T cell-mediated autoimmune disease is selected from multiple sclerosis, celiac disease, rheumatoid arthritis, type 1 diabetes, hypothyroidism and Addison's disease.

[0056] The above definitions apply mutatis mutandis to the following. The other definitions and explanations further provided below also apply to all embodiments described in this specification, mutatis mutandis.

[0057] Advantageously, based on the work of the present invention, it was found that P2RY2 is both a regulator of B7-H3 expression and an inhibitor of T cell activation, for example against cancer cells. Thus, inhibition of P2RY2 was found to increase T cell activity against cancer cells in a B7-H3-dependent and B7-H3-independent manner. Thus, inactivation of P2RY2 was found to eliminate two T cell inhibitory pathways, improving the effectiveness of T cell immunotherapy.

[0058] The present invention also relates to a pharmaceutical composition comprising the P2RY2 activity modulator of the present invention, which is used for T cell immunotherapy.

[0059] The terms "drug" and "pharmaceutical composition" are used interchangeably herein and are known in principle to the skilled person. As described herein, the term refers to any material composition comprising a specific active agent as a pharmaceutically active compound and one or more than one excipient. The pharmaceutically active compound may be present in liquid or dry form, such as lyophilized form. It should be understood that the form and characteristics of pharmaceutically acceptable excipients, such as carriers or diluents, depend on the amount of active ingredient combined therewith, the route of administration and other well-known variables. The excipient must be acceptable, i.e. compatible with the other ingredients of the formulation and harmless to its recipient. The excipients used may include solids, gels or liquids. Examples of solid carriers are lactose, gypsum powder, sucrose, talc, gelatin, agar, pectin, gum arabic, magnesium stearate, stearic acid, etc. Examples of liquid carriers are phosphate buffered saline, physiological saline, Ringer's solution, glucose solution and Hank's solution, syrup, oil, water, emulsions, various types of wetting agents, etc. Similarly, the carrier or diluent may include time-delay materials well known in the art, such as glyceryl monostearate or glyceryl distearate used alone or in combination with wax. Suitable carriers include those described above and other carriers well known in the art, see, for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania. Excipients are selected so as not to affect the biological activity of the composition. However, excipients may also be selected to improve the uptake of the active agent by host cells, particularly target cells. Therefore, excipients may also be viral particles and / or lipid vesicles, preferably viral particles and / or lipid vesicles known to mediate entry and / or fusion with the target cell of interest.

[0060] The drug is preferably administered by the route described above. A therapeutically effective dose refers to the amount of an effector polypeptide or an expression construct encoding the effector polypeptide used in a drug, which prevents, improves or cures the symptoms of a disease or condition mentioned in this specification. The therapeutic effect and toxicity of a drug can be determined by standard pharmaceutical procedures in cell culture or experimental animals, such as ED50 (a dose effective for 50% of the population) and LD50 (a dose lethal to 50% of the population). The dose ratio between the therapeutic effect and the toxic effect is the therapeutic index and can be expressed as a ratio LD50 / ED50. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dosage of any one patient depends on many factors, including the patient's body size, age, specific formulation of the drug to be administered, sex, time of administration and route of administration, overall health and other drugs administered at the same time. The drug referred to herein is preferably administered at least once, such as a single administration. However, the drug may be administered more than once, preferably at least twice, such as permanently or periodically after a specified time window. Progress can be monitored by regular assessment. Dosage recommendations may be indicated in prescriber or user instructions to anticipate dosage adjustments based on the recipient in question.

[0061] In addition to the above-mentioned active agents, the medicine according to the present invention may also include other active agents. Preferably, the pharmaceutically active compound according to the present invention is administered together with at least one other drug, and therefore, can be formulated into a medicine together with the at least one other drug. More preferably, in the case of cancer treatment, the at least one other active agent is a chemotherapeutic agent or other immunotherapeutic agent, such as an immune checkpoint regulator; in the case of autoimmune disease treatment, the at least one other active agent is preferably an anti-inflammatory agent. In addition, it should be understood that the preparation of the pharmaceutical composition is preferably carried out under GMP standardized conditions, etc., to ensure the quality, drug safety and effectiveness of the drug.

[0062] The present invention also relates to the use of the P2RY2 activity regulator as described above in the preparation of a pharmaceutical composition for T cell immunotherapy.

[0063] The present invention also relates to polynucleotides encoding the P2RY2 activity modulators of the present invention for use in T cell immunotherapy. As will be appreciated by the skilled artisan, the P2RY2 activity modulator encoded by the polynucleotide is preferably a polypeptide modulator or a polynucleotide modulator.

[0064] The present invention also relates to a vector comprising a polynucleotide encoding the P2RY2 activity regulator of the present invention, which is used for T cell immunotherapy. Suitable vectors, preferably expression vectors, especially mammalian expression vectors have been described in detail above.

[0065] The present invention also relates to a host cell comprising the P2RY2 activity regulator, polynucleotide and / or vector of the present invention, which is used for T cell immunotherapy.

[0066] As used herein, the term "host cell" refers to any cell that is capable of receiving and preferably maintaining a polynucleotide, vector and / or P2RY2 activity modulator as described above. Preferably, the host cell is capable of expressing the P2RY2 activity modulator encoded on the expression polynucleotide and / or expression vector as described above. Also preferably, the host cell is a cell that is capable of providing a P2RY2 activity modulator, preferably a target cell specified below, for example, by cell fusion, secretion, etc. Therefore, the host cell may also be a cell that produces viral particles and / or liposomes containing the P2RY2 activity modulator described herein. Preferably, the host cell is a eukaryotic cell, preferably an animal cell, such as an insect cell or a mammalian cell. More preferably, the host cell is a cell of a livestock animal, a companion animal or an experimental animal. Most preferably, the host cell is a human cell. Preferred host cells for determining P2RY2 regulation of B7-H3 expression are cell lines THP-1, U937, KBM7 and K562; preferred host cells for determining P2RY2 activity are cell lines BxPC3, MCF7 and the aforementioned host cells for determining P2RY2 regulation of B7-H3; the aforementioned cell lines are available from commonly known commercial sources and strain collections.

[0067] Preferably, the host cell is a target cell, and the term "target cell" as used herein relates to a host cell in which P2RY2 activity is expected to be modulated. The target cell may be any cell type that causes or contributes to a disease, in which case it may also be referred to as a "disease-mediating cell"; thus, the target cell is preferably an immune cell, preferably a T cell, a monocyte or a tissue macrophage. More preferably, the target cell is a cancer cell and / or a cell presenting an autoimmune T cell antigen.

[0068] The present invention also relates to a method for identifying a subject who can receive T cell immunotherapy, comprising

[0069] (A) determining the activity of P2RY2 in a sample from the subject;

[0070] (B) comparing the activity determined in step (A) with a reference; and

[0071] (C) Identifying subjects who can receive T cell immunotherapy based on the comparison in step (B).

[0072] The method of the invention is preferably an in vitro method. Furthermore, it may comprise steps other than those explicitly mentioned above. For example, further steps may involve, for example, obtaining a sample in step a), or determining the activity of P2RY2 in a reference in step b). Furthermore, one or more of the steps may be assisted or performed by automated equipment.

[0073] The term "determine" as used herein refers to quantitatively or semi-quantitatively determining an analyte by measuring at least one characterizing feature of an analyte to be determined in a sample. Characterizing features according to the present invention are features of the physical and / or chemical properties of an analyte, including biochemical properties. These properties include, for example, molecular weight, such as determined by mass spectrometry; nucleic acid sequence, such as determined by sequencing; the ability to react with other compounds, in particular hybridization with one or more than one probe oligonucleotide or primer oligonucleotide, or activation of downstream components of a signal pathway, such as described below; the ability to trigger a reaction in a biological reading system (e.g., induction of a reporter gene); and the like. The values ​​of the above properties can be used as characterizing features and can be determined by techniques well known in the art. In addition, the determined value can be any value derived from the value of the physical and / or chemical properties of an analyte by standard operations, such as mathematical calculations, such as multiplication, division or logarithmic operations. Preferably, the determined value of a is a normalized value, such as normalized to a control analyte.

[0074] The term "activity of P2RY2" relates to the activity of a P2RY2 polypeptide in a cell, preferably signal transduction, in particular G protein receptor signal transduction. Thus, the activity of P2RY2 can be determined by determining the activity and / or amount of P2RY2 in a cell, but can also be determined by determining the activity and / or amount of activated signaling molecules downstream of P2RY2, in particular products such as the phosphatidylinositol-calcium second messenger system, in particular intracellular calcium concentration. Preferably, determining the activity of P2RY2 is determining the amount of P2RY2.

[0075] The method of identifying an object capable of receiving T cell immunotherapy may include additionally determining the activity of B7-H3 (B7 homolog 3, also known as CD276). Human B7-H3 preferably has an amino acid sequence having a Genbank accession number of NP_001019907.1 or a variant thereof, and is preferably encoded by a polynucleotide comprising a nucleic acid sequence having a Genbank accession number of NM_001024736.2 or a variant thereof. The activity of B7-H3 can be determined by determining its immune checkpoint activity and / or by determining the amount of B7-H3 in the cell, preferably by determining the amount of B7-H3. As described herein, the method of identifying an object capable of receiving T cell immunotherapy does not include determining B7-H3 alone.

[0076] The term "comparison" as used herein includes comparing the activity contained in the sample with the activity of a suitable reference described elsewhere in this article. Comparison can also include calculating a score. It should be understood that the comparison referred to herein refers to the comparison of corresponding parameters or values, for example, comparing the absolute amount of a polypeptide with an absolute reference amount; comparing the concentration of a polypeptide with a reference concentration; or comparing the activity with the same type of activity in a reference, comparing the score with a reference score, and the like. The comparison involved in the method of the present invention can be performed manually or computer-assisted. For computer-assisted comparison, the determined value can be compared with a value corresponding to an appropriate reference value stored in a database by a computer program. The computer program can also evaluate the results of the comparison by an expert system. Therefore, the recognition results mentioned here can be automatically provided in a suitable output format.

[0077] As used herein, the term "reference", "reference value", "reference amount" or "reference score" refers to an activity, amount and / or value derived therefrom, which allows the assessment of whether the subject from which the sample is derived is able to receive T cell immunotherapy. A suitable reference can be determined from a reference subject, preferably a reference subject population, before, simultaneously or after the sample. Preferably, the reference is a previously determined reference that can be stored, for example, in a database. Also preferably, the reference is a fixed value or a range of values ​​for all subjects to be tested.

[0078] In principle, a reference value can be calculated for a group or population of subjects described herein based on the mean or median value of a given analyte by applying standard statistical methods. In particular, the accuracy of a test, such as the accuracy of a method for predicting whether an event will occur or not, is best described by its receiver operating characteristic (ROC) (see, in particular, Zweig (1993), Clin. Chem. 39: 561). Preferably, the reference amount used herein is derived from a sample of a subject population, whose donors are known to be able to receive T cell immunotherapy. The reference can be a discrete number or can be a range of numbers. Preferably, the reference can be from a subject or group of subjects known to respond to T cell immunotherapy; in this case, preferably, a substantially equal or decreased P2RY2 activity compared to the reference indicates that the subject is able to receive T cell immunotherapy, while an increased activity compared to the reference indicates that the subject is not able to receive T cell immunotherapy. Preferably, the reference may also be from a subject or group of subjects that is later known to be incapable of receiving T-cell immunotherapy; in this case, preferably, a substantially equal or increased P2RY2 activity compared to the reference indicates that the subject is incapable of receiving T-cell immunotherapy, while a reduced activity compared to the reference indicates that the subject is capable of receiving T-cell immunotherapy. It should be understood that the above activities may vary due to statistical data and measurement errors. The deviation referred to here, i.e. a decrease or increase in activity, is preferably a statistically significant deviation, i.e. a statistically significant decrease or a statistically significant increase. On the other hand, the number of samples, in particular the number of samples from the subjects to be evaluated, and therefore a statistical evaluation may be impossible or may be dispensable.

[0079] The term "subject" as used herein relates to a vertebrate, preferably a mammal, in particular a livestock, a companion animal or a laboratory animal. Most preferably, the subject is a human. Preferably, the subject has been diagnosed with a cancer or an autoimmune disease as described above.

[0080] The term "sample" refers to a body fluid sample, preferably a sample of blood, plasma, serum, saliva, sputum, urine, or a sample comprising isolated cells, or a sample from a tissue or organ. More preferably, a cancer sample, particularly a tumor sample or a metastatic cancer sample, can be obtained, for example, by biopsy. The isolated cells can be obtained from body fluids such as lymph, blood, plasma, serum, liquid, etc., or obtained from a tissue or organ by separation techniques such as centrifugation or cell sorting. Preferably, the sample is a tissue or body fluid sample, more preferably, the sample is a body fluid sample, preferably a blood sample, serum or plasma sample, most preferably a serum sample. More preferably, the sample is a known or suspected sample comprising cancer cells. The sample can be obtained from an object by conventional techniques well known to those skilled in the art, such as venous or arterial puncture or open biopsy, including drawing tissue or cell material from an object. For those areas that are not easily accessible by open biopsy, surgery can be performed, and preferably minimally invasive surgery can be performed.

[0081] The present invention also relates to a method for treating a subject suffering from an immune-aggravated disease, the method comprising

[0082] (i) contacting the subject with a P2RY2 activity modulator; and

[0083] (ii) thereby treating immune-aggravated diseases.

[0084] As used herein, the term "immune exacerbated disease" includes any and all diseases in which the immune response contributes to the severity of the disease, wherein the contribution of the immune response may be a reduced immune response compared to a reference, such as in cancer, or may be an increased immune response compared to a reference, such as in an autoimmune disease. Thus, based on the description herein, the skilled artisan will select an appropriate P2RY2 activity modulator to achieve the desired effect.

[0085] The present invention also relates to a method for identifying a modulator of P2RY2 activity, the method comprising

[0086] (I) contacting a host cell with a candidate compound suspected of being a modulator of P2RY2 activity;

[0087] (II) determining the activity of B7-H3 in the host cell;

[0088] (III) comparing the B7-H3 activity determined in step (II) with a control; and

[0089] (IV) identifying a modulator of P2RY2 activity based on the comparison in step (III).

[0090] The term "B7-H3 activity" relates to the activity of a B7-H3 polypeptide in a cell, preferably signal transduction. Thus, the activity of B7-H3 can be determined by determining the activity and / or amount of B7-H3 in a cell, but can also be determined by determining the activity and / or amount of a signaling molecule activated downstream of B7-H3, as described elsewhere herein. Preferably, determining the activity of B7-H3 is determining the amount of B7-H3.

[0091] The term "control" is understood by the skilled artisan; preferably, the control is the determination of B7-H3 in host cells that have not been treated with a candidate compound suspected of being a modulator of P2RY2 activity, but preferably, are treated in the same manner in other respects. As understood by those skilled in the art, a modulator of P2RY2 activity is identified when the B7-H3 activity determined in host cells treated with a candidate compound suspected of being a modulator of P2RY2 activity is different from the B7-H3 activity determined in untreated (control) host cells.

[0092] The present invention also relates to a kit comprising a P2RY2 activity modulator and (i) a means for determining P2RY2 activity and / or B7-H3 activity in a sample, and (ii) a B7-H3 activity modulator.

[0093] The term "kit" as used herein refers to a collection of the above-mentioned compounds, tools or reagents, which may be packaged together or not. The components of the kit may be included in separate vials (i.e., a kit as a separate part) or provided in a single vial, for example, as a composition as described above. In an embodiment, the housing of the kit allows the translocation of the compounds of the kit, particularly common translocation; therefore, the housing may be a transportable container including all specified components. In addition, it should be understood that the kit of the present invention can be used to implement the method mentioned above. In an embodiment, it is envisaged that all components are provided in a ready-to-use manner to implement the above method. In addition, the kit preferably includes instructions for implementing the method. The instructions may be provided by a user manual in paper or electronic form. For example, the manual may include instructions for explaining the results obtained when the kit is used to implement the above method. Preferably, the kit includes other compounds, such as reaction buffer, hybridization solution, lysis buffer, etc. Preferably, the kit is suitable for use in the method of the present invention, and more preferably is suitable for including all reagents expected to carry out the method or multiple methods.

[0094] Based on the above, the following implementation plans are specifically envisioned:

[0095] Embodiment 1: A P2Y purinergic receptor 2 (P2RY2) activity regulator for use in T cell immunotherapy.

[0096] Embodiment 2: A P2RY2 activity regulator for the use according to Embodiment 1, wherein the T cell immunotherapy is adoptive T cell immunotherapy, preferably tumor infiltrating lymphocyte (TIL) therapy, and / or engineered T cell immunotherapy, in particular chimeric antigen receptor (CAR) and / or recombinant T cell receptor immunotherapy.

[0097] Embodiment 3: The P2RY2 activity modulator for the use according to Embodiment 1 or 2, wherein the P2RY2 modulator is a compound that reduces the activity of P2RY2.

[0098] Embodiment 4: A P2RY2 activity modulator for the use according to any one of Embodiments 1 to 3, wherein the T cell immunotherapy is cancer T cell immunotherapy, preferably further comprising administering at least one of an immune checkpoint inhibitor, administering a cytokine, administering a T cell engager, and identifying a subject capable of receiving T cell immunotherapy, preferably identifying a subject capable of receiving T cell immunotherapy according to any one of Embodiments 28 to 30.

[0099] Embodiment 5: The P2RY2 activity modulator for use according to any one of Embodiments 1 to 4, wherein the compound that reduces P2RY2 activity increases T cell anti-cancer activity in vitro and / or in vivo.

[0100] Embodiment 6: The P2RY2 activity modulator for use according to any one of Embodiments 1 to 5, wherein the compound that reduces the activity of P2RY2 is a compound that specifically binds to P2RY2 and inhibits P2RY2 and directly reduces the activity of P2RY2.

[0101] Embodiment 7: The P2RY2 activity modulator for use according to any one of Embodiments 1 to 6, wherein the compound that directly reduces the activity of P2RY2 is a small molecule inhibitor, a polypeptide inhibitor, a polynucleotide inhibitor, or a non-polypeptide non-polynucleotide inhibitor macromolecule.

[0102] Embodiment 8: The P2RY2 activity modulator for the use according to Embodiment 7, wherein the small molecule inhibitor is AR-C 118925XX (CAS No.: 216657-60-2).

[0103] Embodiment 9: The P2RY2 activity modulator for the use according to embodiment 7, wherein the polypeptide inhibitor is selected from antibodies, aptamers, anticalins and designed ankyrin repeat proteins (DARPins).

[0104] Embodiment 10: The P2RY2 activity modulator for the use according to Embodiment 7, wherein the polynucleotide inhibitor is a polynucleotide aptamer.

[0105] Embodiment 11: The P2RY2 activity regulator for use according to any one of Embodiments 1 to 5, wherein the compound that reduces P2RY2 activity is a compound that indirectly reduces P2RY2 activity by reducing the amount of P2RY2 in target cells.

[0106] Embodiment 12: A P2RY2 activity regulator for the use according to Embodiment 11, wherein the compound that indirectly reduces P2RY2 activity is selected from shRNA agents, siRNA agents, miRNA agents, antisense oligonucleotides, ribozymes and CRISPR / Cas oligonucleotides, preferably a pair of CRISPR / Cas oligonucleotides.

[0107] Embodiment 13: The P2RY2 activity modulator for use according to any one of Embodiments 1 to 12, wherein the P2RY2 activity modulator is administered topically, preferably intratumorally.

[0108] Embodiment 14: The P2RY2 activity modulator for use according to any one of Embodiments 1 to 3, wherein the P2RY2 modulator is a compound that increases the activity of P2RY2.

[0109] Embodiment 15: The P2RY2 activity modulator for use according to Embodiment 14, wherein the immunotherapy is immunotherapy for an autoimmune disease.

[0110] Embodiment 16: The P2RY2 activity modulator for the use according to Embodiment 14 or 15, wherein the compound that increases the activity of P2RY2 is a compound that directly increases the activity of P2RY2 and binds to P2RY2 and increases the activity of P2RY2.

[0111] Embodiment 17: The P2RY2 activity regulator for use according to any one of Embodiments 14 to 16, wherein the compound that increases the activity of P2RY2 is a small molecule activator, a polypeptide activator, a polynucleotide activator, or a non-polypeptide non-polynucleotide activator macromolecule.

[0112] Embodiment 18: A P2RY2 activity regulator for the use according to Embodiment 17, wherein the small molecule activator is a nucleotide or a derivative thereof, preferably ATP or UTP or a derivative thereof, more preferably MRS2768 (uridine-5'-tetraphosphate δ-phenyl ester, CAS No.: 1047980-83-5), uridine-5'-(γ-thio)-triphosphate (CAS No.: 1266569-94-1), 4-thiouridine-5'-O-(β,γ-difluoromethylene) triphosphate (CAS No.: 1657025-60-9), denufosol (CAS No.: 211448-85-0) or diquafosol (CAS No.: 59985-21-6).

[0113] Embodiment 19: The P2RY2 activity regulator for the use according to Embodiment 17, wherein the polypeptide activator is a P2RY2 agonist, preferably a P2RY2 agonist antibody.

[0114] Embodiment 20: The P2RY2 activity modulator for use according to embodiment 14 or 15, wherein the P2RY2 activator is an indirect P2RY2 activator that increases the amount of P2RY2 in target cells.

[0115] Embodiment 21: The P2RY2 activity modulator according to the use of embodiment 20, wherein the indirect P2RY2 activator is

[0116] (i) a polypeptide comprising a P2RY2 polypeptide;

[0117] (ii) a polynucleotide encoding a polypeptide, wherein the polypeptide comprises a P2RY2 polypeptide;

[0118] (iii) a vector comprising the polynucleotide of (ii);

[0119] (iv) a host cell comprising the polynucleotide of (ii) and / or the vector of (iii); or

[0120] (v) any combination of items (i) to (iv).

[0121] Embodiment 22: The P2RY2 activity modulator for use according to Embodiment 20, wherein the vector is a virus.

[0122] Embodiment 23: A pharmaceutical composition comprising the P2RY2 activity modulator according to any one of Embodiments 5 to 22, for use in T cell immunotherapy.

[0123] Embodiment 24: Use of the P2RY2 activity modulator according to any one of Embodiments 5 to 22 in the preparation of a pharmaceutical composition for T cell immunotherapy.

[0124] Embodiment 25: A polynucleotide encoding the P2RY2 activity modulator according to any one of Embodiments 5 to 22, for use in T cell immunotherapy.

[0125] Embodiment 26: A vector comprising the polynucleotide according to embodiment 25, for use in T cell immunotherapy.

[0126] Embodiment 27: A host cell comprising the P2RY2 activity modulator according to any one of embodiments 5 to 22, the polynucleotide according to embodiment 25 and / or the vector according to embodiment 26, for use in T cell immunotherapy.

[0127] Embodiment 28: A method for identifying a subject who can receive T cell immunotherapy, comprising

[0128] (A) determining the activity of P2RY2 in a sample from the subject;

[0129] (B) comparing the amount determined in step (A) with a reference; and

[0130] (C) Identifying subjects who can receive T cell immunotherapy based on the comparison in step (B).

[0131] Embodiment 29: The method according to embodiment 28, wherein the reference is derived from (i) a subject or group of subjects known to be capable of receiving immunotherapy or (ii) a subject or group of subjects known to be incapable of receiving immunotherapy.

[0132] Embodiment 30: The method according to embodiment 28 or 29, wherein determining the activity comprises determining the amount of P2RY2 and / or at least one downstream signaling molecule thereof, preferably the intracellular calcium concentration.

[0133] Embodiment 31: A method for treating a subject suffering from an immune-aggravated disease, the method comprising

[0134] (a) contacting the subject with a P2RY2 activity modulator; and

[0135] (b) thereby treating immune-aggravated diseases.

[0136] Embodiment 32: The method according to embodiment 31, wherein the immune-aggravated disease is cancer or an autoimmune disease.

[0137] Embodiment 33: A method for identifying a P2RY2 activity modulator, the method comprising

[0138] (I) contacting a host cell with a candidate compound suspected of being a modulator of P2RY2 activity;

[0139] (II) determining the activity of B7-H3 in the host cell;

[0140] (III) comparing the B7-H3 activity determined in step (II) with a control; and

[0141] (IV) identifying a modulator of P2RY2 activity based on the comparison in step (III).

[0142] Embodiment 34: A kit comprising a P2RY2 activity modulator and (i) a means for determining P2RY2 activity and / or B7-H3 activity in a sample, and (ii) a B7-H3 activity modulator.

[0143] Embodiment 35: The subject matter according to any one of embodiments 23 to 33, wherein the T cell immunotherapy is a T cell immunotherapy comprising administration of at least one P2RY2 activity modulator, and preferably, further comprising administration of at least one of an immune checkpoint inhibitor, administration of a cytokine, and administration of a T cell engager.

[0144] All references cited in the present specification are hereby incorporated by reference, and the citation relates to their entire disclosure content and the disclosure content specifically mentioned in the present specification. BRIEF DESCRIPTION OF THE DRAWINGS

[0145] Figure 1 . Regulators of B7-H3 expression identified by flow cytometry-based genetic screening. Dots represent individual genes; y-axis represents Log 10 Converted MAGeCK robust sequencing integration (RRA) scores based on B7-H3 sorted from a genome-wide CRIPSR / Cas9 (Brunello) library in THP-1 cells 高 Relative to B7-H3 低 Depletion or enrichment of sgRNA within a cell population.

[0146] Figure 2 Flow cytometric analysis of B7-H3 expression in wild-type (WT) and P2RY2-deficient THP-1, U937, KBM7, and K562 cells (P2RY2-3 KO and P2RY2-4 KO) in the absence or presence of ATP. Values ​​represent MFI relative to untreated WT cells.

[0147] Figure 3 Flow cytometric analysis of B7-H3 expression in THP-1 cells in the absence or presence of ATP. Values ​​represent MFI relative to untreated cells.

[0148] Figure 4Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with CD33-specific CAR (CAR-T) were co-cultured with gene-edited THP-1 cells for 6 to 24 hours. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with sgRNA and Cas9 targeting B7-H3 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced THP-1 cells; P2RY2 overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral construct. Flow cytometric analysis of the expression of CD25, CD69 and CD137 within the CD3+CD8+ cell population and the production of IFNγ, IL-2 and TNFα is shown (values ​​represent the percentage of positive cells).

[0149] Figure 5Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with CD33-specific CAR (CAR-T) were co-cultured with gene-edited THP-1 cells for 6 to 24 hours. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced THP-1 cells; P2RY2 overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral construct. Flow cytometric analysis of CD25 expression and production of IFNγ, IL-2, and TNFα within the CD3+CD8- cell population is shown (values ​​represent the percentage of positive cells).

[0150] Figure 6Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited MART-1+BxPC3 cells for 6 to 24 hours. Control cells: BxPC3 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: BxPC3 cells transduced with P2RY2-targeting sgRNA and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: BxPC3 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: BxPC3 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3, and Cas9 (gCD276-1 gP2RY2-3DKO, gCD276-1 gP2RY2-4 DKO) transduced BxPC3 cells; P2RY2 overexpressing cells: BxPC3 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: BxPC3 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral constructs. Flow cytometric analysis of the expression of CD25, CD69 and CD137 within the CD8+ cell population and the production of IFNγ, IL-2 and TNFα is shown (values ​​represent the percentage of positive cells).

[0151] Figure 7Effects of P2RY2 and B7-H3 gene perturbations on cancer cell viability in T cell-cancer cell co-cultures. T cells transduced with CD33-specific CAR (CAR-T) were co-cultured with gene-edited THP-1 cells for 6 to 24 hours. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited or peptide-loaded cancer cells in the presence of the MART-1 epitope for 6 to 24 hours (by incubating cells with MART-1 peptide to load the MART-1 epitope onto THP-1 cells; BxPC3 and MCF7 cells were transduced with the MART-1 epitope). Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1gP2RY2-4 DKO); P2RY2 overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics based on the antibiotic resistance genes carried by the lentiviral constructs. For THP-1 cells, normalized counts of viable cells after co-culture with CD33-specific CAR-T cells or MART-1-specific TCR-T cells are shown. Endpoint cell counts were normalized to the number of THP-1 cells in cultures without T cells. For BxPC3 cells and MCF7 cells, after co-culture with MART-1-specific TCR-T cells, the viable cells were screened with antibiotics based on the antibiotic resistance genes carried by the lentiviral constructs. Cell viability (Promega) assay was used to determine the normalized cell viability of cancer cells. Cell viability was measured by Promega assay, and the endpoint cell viability was normalized to that of BxPC3 or MCF7 cells.

[0152] Figure 8Effects of P2RY2 antagonists on T cells and cancer cells in T cell-cancer cell co-cultures. T cells transduced with CD33-specific CAR (CAR-T) were co-cultured with gene-edited THP-1 cells in the absence or presence of 5 μM AR-C118925XX (AR-C) for 6 to 24 hours. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: THP-1 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: THP-1 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: THP-1 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3DKO, gCD276-1 gP2RY2-4 DKO) transduced THP-1 cells; P2RY2 overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: THP-1 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral construct. Flow cytometry analysis of IFNγ and TNFα expression in CD3+CD8+ cell populations is shown (values ​​represent the percentage of positive cells). For the viability of THP-1 cells, the normalized cell counts of live cells after co-culture with CD33-specific CAR-T cells are shown. The endpoint cell counts were normalized to the number of THP-1 cells in cultures without T cells.

[0153] Fig. 9 .Effects of P2RY2 antagonists and P2RY2 agonists on cancer cells in T cell-cancer cell co-cultures. T cells transduced with CD33-specific CAR (CAR-T) were co-cultured with gene-edited THP-1 cells for 24 hours in the absence or presence of 5 μM AR-C 118925xx (AR-C) or 100 μM diquafosol. Control cells: THP-1 cells transduced with non-targeting sgRNA and Cas9 (Ctrl.); P2RY2 overexpressing cells: THP-1 cells transduced with the open reading frame of P2RY2 (P2RY2-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. The normalized cell counts of live cells after co-culture with CD33-specific CAR-T cells are shown. The endpoint cell counts were normalized to the number of THP-1 cells in the culture without T cells.

[0154] Fig.10 Effects of P2RY2 inhibition and PD-L1 immune checkpoint inhibition on T cells in T cell-cancer cell co-culture. T cells transduced with MART-1-specific TCR (TCR-T) and MART-1 + BxPC3 cells were co-cultured for 6 to 24 hours in the presence of 5 μM AR-C118925XX (AR-C), 10 μg / mL atezolizumab, 10 μg / mL durvalumab or a combination thereof. Untreated cells were used as controls. Flow cytometry analysis of CD25, CD69 and CD137 expression in CD8+MART-1 specific TCR+ cell populations is shown (values ​​represent the percentage of positive cells). Data represent the mean ± standard deviation of three groups of data and are analyzed by one-way ANOVA and multiple comparisons * p ≤ 0.0013.

[0155] Fig.11 Effects of P2RY2 inhibition and PD-L1 immune checkpoint inhibition on cancer cells in T cell-cancer cell co-culture. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with MART-1+BxPC3 cells in the presence of 5 μM AR-C118925XX (AR-C), 10 μg / mL atezolizumab, 10 μg / mL durvalumab, or a combination thereof for 6 to 24 hours. Untreated cells served as controls. After co-culture with MART-1-specific TCR-T cells, Cell viability (Promega) assay was used to determine normalized cell viability of BxPC3 cells. Endpoint cell viability was normalized to BxPC3 cells in cultures without T cells. Data represent mean ± SD of triplicate data and were analyzed by one-way ANOVA with multiple comparisons. *p ≤ 0.0013.

[0156] Fig.12.Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-culture. T cells transduced with CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells for 24 hours. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced SW480 cells; P2RY2 overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral construct. Flow cytometric analysis of the expression of CD25, CD69 and CD137 within the CD3+CD8+ cell population and the production of IFNγ, IL-2 and TNFα is shown (values ​​represent the percentage of positive cells).

[0157] Fig.13.Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-culture. T cells transduced with CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells for 24 hours. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced SW480 cells; P2RY2 overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance genes carried by the lentiviral constructs. Flow cytometric analysis of the expression of CD25, CD69 and CD137 within the CD3+CD4+ cell population and the production of IFNγ, IL-2 and TNFα is shown (values ​​represent the percentage of positive cells).

[0158] Fig.14Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited MART-1+MIA PaCa-2 cells for 16 h. Control cells: MIA PaCa-2 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MIA PaCa-2 cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MIA PaCa-2 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2 overexpressing cells: MIA PaCa-2 cells transduced with the open reading frame of P2RY2 (P2RY2-OE) PaCa-2 cells; B7-H3 overexpressing cells: MIAPaCa-2 cells transduced with an open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometric analysis of the expression of CD25, CD69 and CD137 within the CD3+CD8+ cell population and the production of IFNγ and IL-2 is shown (values ​​represent the percentage of positive cells).

[0159] Fig.15Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited MART-1+MIA PaCa-2 cells for 16 h. Control cells: MIA PaCa-2 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MIA PaCa-2 cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MIA PaCa-2 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MIA PaCa-2 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA and Cas9 (gCD276-1 gP2RY2-3 DKO, gcd 276-1 gp2ry 2-4 DKO); P2RY2 overexpressing cells: MIA PaCa-2 cells transduced with the open reading frame of P2RY2 (P2RY2-OE) PaCa-2 cells; B7-H3 overexpressing cells: MIAPaCa-2 cells transduced with an open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics based on the antibiotic resistance gene carried by the lentiviral construct. Flow cytometric analysis of CD25 and CD69 expression and IFNγ and IL-2 production within the CD3+CD4+ cell population is shown (values ​​represent the percentage of positive cells).

[0160] Fig.16Effects of P2RY2 and B7-H3 gene perturbations on T cell activity in T cell-cancer cell co-cultures. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited MART-1+MDA-MB-231 cells for 21 hours. Control cells: MDA-MB-231 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: MDA-MB-231 cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: MDA-MB-231 cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: MDA-MB-231 cells transduced with P2RY2-targeting sgRNA, B7-H3-targeting sgRNA and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced MDA-MB-231 cells; P2RY2 overexpressing cells: MDA-MB-231 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: MDA-MB-231 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometric analysis of CD25 and CD69 expression within the CD3+CD8+ cell population or the CD3+CD4+ cell population is shown (values ​​represent the percentage of positive cells).

[0161] Fig.17Effects of P2RY2 and B7-H3 gene perturbations on cancer cell viability in CAR-T cell-cancer cell co-culture. T cells transduced with CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells for 48 h. Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO); P2RY2 overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). According to the antibiotic resistance gene carried by the lentiviral construct, the transduced cancer cells were selected with antibiotics. Cell viability (Promega) assay was used to determine the normalized cell viability of cancer cells. Cell viability (Promega) assay, and endpoint cell viability was normalized to SW480 cells.

[0162] Fig.18Effects of P2RY2 and B7-H3 gene perturbations on cancer cell viability in TCR-T cell-cancer cell co-cultures. T cells transduced with MART-1-specific TCR (TCR-T) were co-cultured with gene-edited MART-1+MDA-MB-231 / MIA PaCa-2 cells for 48 hours. MIA PaCa-2 and MDA-MB-231 cells were transduced with the MART-1 epitope. Control cells: cancer cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: cancer cells transduced with sgRNA and Cas9 targeting P2RY2 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: cancer cells transduced with B7-H3-targeting sgRNA and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: cancer cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3, and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4DKO); P2RY2 overexpressing cells: cancer cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: cancer cells transduced with the open reading frame of CD276 (CD276-OE). According to the antibiotic resistance gene carried by the lentiviral construct, the transduced cancer cells were selected with antibiotics. Cell viability (Promega) assay was used to determine the normalized cell viability of cancer cells. Cell viability (Promega) assay was used to measure the endpoint cell viability, and the measured endpoint cell viability was normalized to that of MIAPaCa-2 and MDA-MB-231 cells.

[0163] Fig.19Effects of P2RY2 agonists and P2RY2 antagonists on T cell activity in T cell-cancer cell co-cultures. T cells transduced with CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells in the absence or presence of 400 μM ATP, 200 μM ATPγS, 100 μM diquafosol, 50 μM denufosol, and 10 μM AR-C118925XX (AR-C) for 24 h. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4DKO) transduced SW480 cells; P2RY2 overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were screened with antibiotics according to the antibiotic resistance gene carried by the lentiviral construct. Flow cytometric analysis of CD25 and CD69 expression and IFNγ production within the CD3+CD8+ or CD3+CD4+ cell populations is shown (values ​​represent the percentage of positive cells).

[0164] Fig. 20Effects of P2RY2 agonists and P2RY2 antagonists on cancer cell viability in T cell-cancer cell co-cultures. T cells transduced with CEA-specific CAR (CAR-T) were co-cultured with gene-edited SW480 cells in the absence or presence of 400 μM ATP, 200 μM ATPγS, 100 μM diquafosol, 50 μM denufosol, and 10 μM AR-C118925XX (AR-C) for 48 h. Control cells: SW480 cells transduced with non-targeting sgRNA and Cas9 (gNT); P2RY2-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2 and Cas9 (gP2RY2-3, gP2RY2-4); B7-H3 (CD276)-deficient cells: SW480 cells transduced with sgRNA targeting B7-H3 and Cas9 (gCD276-1); P2RY2 and B7-H3 double-deficient cells: SW480 cells transduced with sgRNA targeting P2RY2, sgRNA targeting B7-H3 and Cas9 (gCD276-1 gP2RY2-3 DKO, gCD276-1 gP2RY2-4 DKO) transduced SW480 cells; P2RY2 overexpressing cells: SW480 cells transduced with the open reading frame of P2RY2 (P2RY2-OE); B7-H3 overexpressing cells: SW480 cells transduced with the open reading frame of CD276 (CD276-OE). Transduced cancer cells were selected with antibiotics according to the antibiotic resistance genes carried by the lentiviral construct. After co-culture with CEA CAR-T cells, Normalized cell viability of SW480 cells was determined by cell viability assay (Promega). Cell viability was measured by Promega assay, and the endpoint cell viability was normalized to that of SW480 cells.

[0165] The following examples are only used to illustrate the present invention. In any case, they should not be construed as limiting the scope of the present invention.

[0166] Example 1: Screening for B7-H3 regulators using CRISPR-Cas9 based on flow cytometry

[0167] To identify novel regulators of B7-H3, we used a forward genetic screen in human THP-1 cells, which spontaneously express B7-H3 on the cell surface at levels detectable by antibodies.

[0168] We introduced a whole genome CRISPR knockout library (Doench et al., Nat Biotechnol 34, 184-191 (2016)) into THP-1 cells by lentiviral transduction to create a mutant cell pool, screened the transduced cells, expanded the cells, and incubated them with B7-H3 protein-specific antibodies. When analyzed by flow cytometry, the antibody-incubated cell pools showed a signal intensity close to a normal distribution. Using fluorescence-activated cell sorting (FACS), Cas9 / sgRNA-modified cells showing particularly strong or weak B7-H3 signals were isolated, and then the abundance of sgRNAs in the two cell pools was compared ( Figure 1 ).

[0169] Materials and methods

[0170] To generate a genome-wide mutant library of THP-1 cells, a THP-1 clone (cl35) expressing Cas9 was lentivirally transduced with a human Brunello CRISPR genome-wide knockout library (Doench et al., Nat Biotechnol 34, 184-191 (2016)) in a lentiGuide-Puro vector at 1500- to 2000-fold coverage, with an infection rate of approximately 40%, and 1.0 μg mL -1 Puromycin selection of cells continued for at least 10 days. To screen for modulators of B7-H3 expression on THP-1 cells, 3 × 10 8 The cells were washed once with PBS and stained with near-infrared dead cell stain (ThermoFisher) in PBS at 4°C in the dark for 10 min. After washing twice in PBS containing 0.5% (w / v) BSA (Sigma) and 0.2% (w / v) sodium azide (Sigma) (FACS buffer), the cells were stained with a dilution of 0.1 μg mL -1 Unconjugated anti-B7-H3 MIH42 (Biolegend) was added in FACS buffer at 1 × 10 7 The cells were stained at a concentration of 1 μg / mL for 30 min. After washing twice with FACS buffer, the cells were incubated at 4°C in the dark with 2 μg / mL -1The cells were stained with AF488-conjugated goat anti-mouse IgG antibody (A28175, ThermoFisher) at 400 dilutions in FACS buffer for 30 minutes. After washing twice with FACS buffer, the cells were fixed with IC fixation buffer (eBioscience) according to the manufacturer's protocol. Next, the cells were passed through a 40 μm filter (BD Falcon) and FACS sorted to collect the cell populations showing the highest and lowest B7-H3 signals, respectively, both of which constituted approximately 5% to 10% of the total cell pool.

[0171] Two sorted cell populations were precipitated by centrifugation (2000rpm, 10 minutes) and genomic DNA was isolated using Qiagen DNA mini kit (Qiagen). When the cells were fixed, in order to facilitate de-crosslinking, the cell pellets were resuspended in PBS and incubated at 56 °C on a thermomixer (Eppendorf) for at least 12 hours after the addition of proteinase K and buffer AL (Qiagen). DNA was isolated according to the manufacturer's instructions and the concentration of DNA was determined using a Nanodrop2000 spectrophotometer (Thermo Fisher). The gRNAs integrated into the genomic DNA of the sorted cell populations were amplified by two-step PCR using Neb next ultra-fidelity premix (New England Biolab) and the following primer sets.

[0172] Step #1 PCR: forward primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCCGGCTTTATATATCTTGTGGA AAGGACG (SEQ ID NO: 1) or

[0173] ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACAAGGGCTTTATATATCTTGTGGAA AGGACG (SEQ ID NO: 2)) and reverse primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACTGACGGGCACCGGAGCCAATT CC (SEQ ID NO: 3));

[0174] Step #2 PCR: forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT SEQ ID NO: 4) and reverse primer (CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCT (SEQ ID NO: 5)).

[0175] Cycling conditions for PCR#1: 30 sec at 98°C, 18× (10 sec at 98°C, 30 sec at 60°C, 30 sec at 72°C), 2 min at 72°C, end at 4°C. PCR#1 products from each sorted cell population were pooled, and 4×2 μL of the pooled PCR products were used as templates for 4×50 μL PCR#2 reactions. Cycling conditions for PCR#2: 30 sec at 98°C, 12× (10 sec at 98°C, 30 sec at 60°C, 30 sec at 72°C), 2 min at 72°C, end at 4°C. PCR#2 products were purified using the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's instructions. The resulting PCR amplicons were analyzed by Bioanalyzer (Agilent), and samples were pooled in equimolar amounts, sequenced by HiSeq 2500 (Illumina, high output mode, single-end reads, 65 bp), and analyzed by MAGeCK (Li et al., Genome Biology. 2014).

[0176] result

[0177] Genetic screening results for regulators of surface B7-H3 expression in THP-1 cells Figure 1 As expected, the sgRNA targeting the CD276 gene, encoding B7-H3 itself, was highly enriched in B7-H3 low cells, reinforcing the reliability of the genetic screen. In addition, the screen identified P2RY2, encoding the purinergic receptor P2RY2, as a positive regulator of B7-H3.

[0178] Example 2: Expression of P2RY2 and B7-H3

[0179] We set out to validate the involvement of P2RY2 in regulating surface B7-H3 levels by transducing various cell lines with lentiviral vectors encoding Cas9 and sgRNA targeting the P2RY2 gene.

[0180] Materials and methods

[0181] THP-1 cells, U937 cells, K562 cells, and KBM7 cells were transduced with a lentiviral vector encoding Cas9 and a blasticidin S resistance gene (blasticidin D deaminase). One day after transduction, cells were screened with 50 μg / ml of blasticidin S hydrochloride for 72 to 48 hours. Then, surviving cells were transduced with one of the lentiviral vectors encoding sgRNA to the sequences 5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7) on the coding strand of the P2RY2 gene, as well as a puromycin resistance cassette (puromycin N-acetyltransferase). One day after transduction, cells were screened with 2 μg / ml of puromycin dihydrochloride for 48 to 96 hours. The selected cells were expanded, genomic DNA was isolated, and deleterious editing of the P2RY2 locus was analyzed by PCR using primers 5'-GATGAGCTGGGCTACAGGTG-3' (SEQ ID NO: 8) and 5'-GTCGTAAGACGCCCAGACAC-3' (SEQ ID NO: 9), and the PCR products were subjected to Sanger sequencing using primer 5'-GATGAGCTGGGCTACAGGTG-3' (SEQ ID NO: 8) for cells transduced with sgRNA (5'-CTGGTCTATTACTACGCCCG-3', SEQ ID NO: 6) and primer 5'-GTCGTAAGACGCCCAGACAC-3' (SEQ ID NO: 9) for cells transduced with sgRNA (5'-TGGGCTGTGTCTGAACGCCG-3', SEQ ID NO: 7).

[0182] Polyclonal cells transduced with Cas9 and sgRNA targeting P2RY2 and wild-type cells were cultured in the absence or presence of ATP or UTP (P2RY2 ligand, Sigma) for 24 h, stained with anti-B7-H3 antibody and analyzed by flow cytometry.

[0183] result

[0184] CRISPR / Cas9-mediated knockout of P2RY2 resulted in decreased B7-H3 surface levels in THP-1 cells, U937 cells, K562 cells, and KBM7 cells ( Figure 2 P2RY2 has been previously identified as a receptor for extracellular ATP and UTP (Burnstock et al., Purigergic Signal 9, 491-540 (2013)). Next, we stimulated P2RY2 cells with ATP or UTP and observed that B7-H3 expression increased in a dose-dependent manner ( Figure 3). Notably, ATP is present at very high concentrations in tumor stroma but at much lower concentrations in healthy tissues (Di Virgilio et al., Oncogene 36, 293-303 (2017)); Kepp et al., Immunol Rev. 280(1):83-92 (2017); Pellegatti et al., PLOS one 3(7):e2599 (2008)). We next tested whether P2RY2 regulates ATP-induced B7-H3 surface expression and observed that ATP-induced B7-H3 expression was abolished after P2RY2 disruption ( Figure 2 ).

[0185] Example 3: P2RY2 and T cell activity

[0186] Materials and methods

[0187] MART-1 specific T cells were generated as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)). To generate CD33-specific chimeric antigen receptor (CAR) T cells, the CD33Hul95-CD28Z CAR (described in WO 2019 / 178382) cassette was cloned into a retroviral vector and the resulting virus was used to transduce T cells as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)).

[0188] For cancer cells that endogenously express HLA-A2, including THP-1 and MCF7, the MART-1 epitope is incubated with cells by a modified MART-1 peptide (ELAGIGILTV, SEQ ID NO: 12) or loaded onto cancer cells by lentiviral transduction. For lentiviral transduction, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) and subsequent P2A-RFP are cloned into a lentiviral vector, and the resulting virus is used to transduce cancer cells. For cancer cells that do not express endogenous HLA-A2, including BxPC3 cells, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) and P2A-HLA-A2 / B2M are cloned into a lentiviral vector, which is used to generate MART-1 by transduction. + cancer cell.

[0189] Cas9 and sgRNA targeting P2RY2 (5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7)), CD 276 (5'-CACAGGGCAACGCATCCCTG-3', SEQ ID NO: 10), or both were introduced into cancer cells by lentiviral transduction as described in Example 2. An sgRNA that does not recognize any sequence in the human genome (5'-GTATTACTGATATTGGTGGG-3', SEQ ID NO: 11) was used as a control. The open reading frame of the P2RY2 (ENST00000393597.7) or CD276 (ENST00000318443.10) transcript was sequenced into a codon-optimized gBlock gene fragment (Integrated DNA Technologies or Twist Bioscience) and cloned into a lentiviral vector containing a blasticidin selection cassette. The constructs were verified by Sanger sequencing.

[0190] MART1-specific CD8+T cells and cancer cells expressing MART1 epitopes were mixed in a ratio of 1:16 to 1:4. Then, the cells were centrifuged at 1600g for 3 minutes and incubated at 37°C and 5% CO2 for 12 to 72 hours. Surface staining and intracellular staining using anti-IL-2-PE / Cy7 (MQ1-17H12, Biolegend), anti-IFN-γ-BV421 (4S.B3, Biolegend), anti-TNF-α-BV785 (MAb11, Biolegend) antibodies were performed to assess T cell activation, followed by flow cytometry analysis. For intracellular staining, Brefeldin A (Biolegend) was added to the cell culture medium 4 hours before obtaining cells. The viability of cancer cells including THP-1 cells grown in suspension was assessed by absolute cell counting based on flow cytometry using AccuCount microspheres (Spherotech). For adherent cancer cells including BxPC3 and MCF7, cell viability was quantified using CellTiter-Blue cell viability (Promega) assay.

[0191] result

[0192] To determine the effects of P2RY2 on T cells and cancer cells in an in vitro model of T cell-based immunotherapy, we engineered human T cells from peripheral blood with CD33-specific CARs or MART-1-specific TCRs and assessed T cell activation in the presence of antigen-expressing cancer cells carrying Cas9 / sgRNA targeting P2RY, B7-H3, or both or antigen-expressing cancer cells overexpressing P2RY2 or B7-H3. When CD33-specific CAR-transduced T cells were co-cultured with THP-1 cells endogenously expressing CD33, loss of P2RY2 and B7-H3 in THP-1 cells resulted in increased T cell activation, as indicated by increased expression of T cell activation markers CD25, CD69, and CD137 and increased production of cytokines IFNγ, IL-2, and TNFα in CD3+CD8+ T cells. In contrast, overexpression of P2RY2 or B7-H3 in tumor cells resulted in impaired CD3+CD8+ T cell activation and cytokine production ( Figure 4 Furthermore, in the CD3+CD8- T cell population, individual deletion of P2RY2 or B7-H3 in THP-1 cells resulted in increased expression of T cell activation markers including CD25, IFNγ, IL-2, and TNFα, whereas overexpression of P2RY2 or B7-H3 reduced T cell activation ( Figure 5 ).

[0193] Notably, the simultaneous loss of P2RY2 and B7-H3 in THP-1 cells resulted in higher expression levels of these T cell activation markers (CD25, IFNγ, IL-2, and TNFα) than the loss of either P2RY2 or B7-H3 alone in CD3+CD8+ and CD3+CD8- T cells ( Figure 4 , Figure 5 Similar effects were observed in co-cultures of MART-1-specific TCR-transduced T cells with MART-1 epitope-transduced BxPC3 cells ( Figure 6 ).

[0194] Consistent with these data, disruption of P2RY2 or B7-H3 in cancer cells resulted in increased killing of tumor cells by tumor-reactive CAR-T or TCR-T cells in myeloid leukemia cell (THP-1), pancreatic cancer cell (BxPC3), and breast cancer cell (MCF7) models. In addition, combined loss of P2RY2 and B7-H3 significantly enhanced the tumoricidal effect of T cells. In contrast, overexpression of P2RY2 or B7-H3 in cancer cells conferred resistance to tumor-reactive T cells ( Figure 7These results suggest that P2RY2 inhibits T cell activation through both B7-H3-dependent and B7-H3-independent mechanisms, and that combined deletion of P2RY2 and B7-H3 enhances T cell-mediated anticancer effects compared with deletion of either molecule alone.

[0195] Furthermore, we found that pharmacological inhibition of P2RY2 using an inhibitory tool compound (AR-C 118925XX) increased T cell production of IFNγ and TNFα and reduced the viability of P2RY2-enriched THP-1 cells when CD33-specific CAR-transduced T cells were co-cultured with THP-1 cells ( Figure 8 ). In addition, after P2RY2 deletion, AR-C 118925XX did not affect the production of IFNγ and TNFα in T cells, nor did it affect the activity of tumor cells in CAR-T cell-THP-1 cell co-culture assays, suggesting that the compound acts through P2RY2. In contrast, the P2RY2 agonist (Diquafosol) conferred resistance to T cell-mediated cytotoxicity in THP-1 cells ( Fig. 9 ).

[0196] In addition to co-inhibition of P2RY2 and B7-H3 immune checkpoints, combinations of P2RY2 inhibitors and blocking antibodies to the PD-L1-PD-1 immune checkpoints were also tested. When MART-1-specific TCR-transduced T cells were cultured in the presence of MART-1-epitope-transduced BxPC3 cells, inhibition of P2RY2 by AR-C 118925XX or blockade of the PD-L1-PD-1 immune checkpoints by atezolizumab or durvalumab increased the expression of CD137, CD69, and CD25 on T cells, while combined P2RY2 and PD-L1 inhibition also increased the expression of T cell activation markers ( Fig.10 ). Consistent with this, inhibition of P2RY2 by AR-C 118925XX or blockade of PD-L1 by atezolizumab or durvalumab enhanced the tumoricidal effect of T cells, as indicated by reduced BxPC3 cell viability, whereas combined inhibition of P2RY2 and PD-L1 resulted in improved antitumor efficacy compared with either treatment alone ( Fig.11 ).

[0197] Together, these data suggest that P2RY2 expression on cancer cells inhibits T cell activation and T cell-mediated cytotoxicity and that modulation of P2RY2 activity can be exploited to regulate T cell activity in immunotherapy.

[0198] Example 4: P2RY2 and T cell activity ( Figures 12 to 20 )

[0199] Materials and methods

[0200] MART-1 specific T cells were generated as described (Mezzadra et al., Nature 549, 106-110 (2017)); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)). To prepare CD33-specific chimeric antigen receptor (CAR) T cells and CEA-specific CAR-T cells, the CD33Hul95-CD28Z CAR (described in WO 2019 / 178382) cassette and MFE-23 (described in US20050147614A1)-CD28Z CAR were cloned into retroviral vectors, respectively, and the resulting viruses were used to transduce T cells as described (Mezzadra et al., Nature 549, 106-110 (2017); Jorritsma et al., Blood 110 (10): 3564-3572. (2007)).

[0201] For cancer cells that endogenously express HLA-A2, including THP-1, MDA-MB-231, and MCF7, the MART-1 epitope is loaded onto the cancer cells by incubating the cells with a modified MART-1 peptide (ELAGIGILTV, SEQ ID NO: 12) or by lentiviral transduction. For lentiviral transduction, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) and subsequent P2A-RFP are cloned into a lentiviral vector, and the resulting virus is used to transduce cancer cells. For cancer cells that do not express endogenous HLA-A2, including BxPC3 and MIA PaCa-2 cells, a gene fragment encoding the MART-1 epitope (ELAGIGILTV, SEQ ID NO: 12) is cloned into a lentiviral vector, and then P2A-HLA-A2 / B2M is cloned into the lentiviral vector, and MART-1 is obtained by transduction. + cancer cell.

[0202] Cas9 and sgRNA targeting P2RY2 (5'-CTGGTCTATTACTACGCCCG-3' (SEQ ID NO: 6) and 5'-TGGGCTGTGTCTGAACGCCG-3' (SEQ ID NO: 7)), CD 276 (5'-CACAGGGCAACGCATCCCTG-3', SEQ ID NO: 10), or both were introduced into cancer cells by lentiviral transduction as described in Example 2. An sgRNA that does not recognize any sequence in the human genome (5'-GTATTACTGATATTGGTGGG-3', SEQ ID NO: 11) was used as a control. The open reading frame of the P2RY2 (ENST00000393597.7) or CD276 (ENST00000318443.10) transcript was sequenced as a codon-optimized gBlock gene fragment (Integrated DNA Technologies or Twist Bioscience) and cloned into a lentiviral vector containing a blasticidin selection cassette. The constructs were verified by Sanger sequencing.

[0203] MART1-specific CD8+ T cells and cancer cells expressing the MART1 epitope were mixed at a ratio of 1:16 to 1:1. CD33 CAR-T cells and THP-1 cells expressing CD33 were mixed at a ratio of 1:16 to 1:4. CEA CAR-T cells and SW480 cells expressing CEA were mixed at a ratio of 1:1. Next, the cells were centrifuged at 1600g for 3 minutes and incubated at 37°C and 5% CO2 for 12 to 72 hours. T cell activation was assessed by surface staining with anti-CD137-BV421 (4-1BB, Biolegend), anti-CD137-PE / Cy7 (4-1BB, Biolegend), anti-CD69-APC / FireTM 750 (FN50, Biolegend), anti-CD25-AF700 (BC96, Biolegend), anti-CD25-APC (BC96, Biolegend) antibodies and intracellular staining with anti-IL-2-PE / Cy7 (MQ1-17H12, Biolegend), anti-IFN-γ-BV421 (4S.B3, Biolegend), anti-TNF-α-BV785 (MAb11, Biolegend), anti-TNF-α-APC (MAb11, Biolegend) antibodies, followed by flow cytometry analysis. For intracellular staining, Brefeldin A (Biolegend) was added to the cell culture medium 4 hours before obtaining cells. The viability of cancer cells (including THP-1 cells) grown in suspension was assessed by absolute cell counting based on flow cytometry using AccuCount microspheres (Spherotech). For adherent cancer cells including BxPC3, MIA PaCa-2, MDA-MB-231 and MCF7, cell viability was quantified using the CellTiter-Blue cell viability (Promega) assay.

[0204] result

[0205] To determine the effects of P2RY2 on T cells and cancer cells in in vitro models of T cell-based immunotherapy, we engineered human T cells from peripheral blood with CD33-specific CAR, CEA-specific CAR, or MART-1-specific TCR and assessed T cell activation in the presence of antigen-expressing cancer cells carrying Cas9 / sgRNA targeting P2RY, B7-H3, or both, or antigen-expressing cancer cells overexpressing P2RY2 or B7-H3.

[0206] Notably, the combined deletion of P2RY2 and B7-H3 in THP-1 cells increased the expression levels of these T cell activation markers (CD25, IFNγ, IL-2, and TNFα) compared with the deletion of either P2RY2 or B7-H3 alone in CD3+CD8+ and CD3+CD8- T cells ( Figure 4 , Figure 5 , see Example 3). In the co-culture of CEA-specific CAR-transduced T cells and CEA+SW480 cells ( Fig.12 , Fig.13 ), and in MART-1-specific TCR-transduced T cells and MART-1 epitope-transduced BxPC3 cells ( Figure 6 , see Example 3), MIA PaCa-2 ( Fig.14 , Fig.15 ) or MDA-MB-231 cells ( Fig.16 ) were co-cultured with .

[0207] Consistent with these data, P2RY2 or B7-H3 disruption in cancer cells resulted in increased killing of tumor cells by tumor-reactive CAR-T or TCR-T cells in myeloid leukemia cell (THP-1), colorectal cancer cell (SW480), pancreatic cancer cell (BxPC3 and MIA PaCa-2), and breast cancer cell (MCF7 and MDA-MB-231) models ( Figure 7 , Fig.17 , Fig.18 ). In addition, the combined loss of P2RY2 and B7-H3 significantly enhanced the tumoricidal effect of T cells. Conversely, overexpression of P2RY2 or B7-H3 in cancer cells conferred resistance to tumor-reactive T cells ( Figure 7 , Fig.17 , Fig.18 These results suggest that P2RY2 inhibits T cell activation through both B7-H3-dependent and B7-H3-independent mechanisms, and that combined deletion of P2RY2 and B7-H3 enhances T cell-mediated anticancer effects compared with deletion of either molecule alone.

[0208] With above Figure 8 and Fig. 9 Consistent with the results shown in Figure 2, the P2RY2 inhibitor AR-C 118925XX increased the expression of T cell activation markers CD25, CD69, and IFN-γ, whereas activation of P2RY2 by ATP, non-hydrolyzable ATP (adenosine-5'-(γ-thio)-triphosphate), dequafosol, or denufosol resulted in inhibition of T cell activation in co-cultures of SW480 cells and CEA-specific CAR-transduced T cells ( Fig.19). Moreover, when P2RY2 was depleted in SW480 cells, P2RY2-targeting chemicals had little effect on T cell activation in the same SW480-CEA-specific CAR-T co-culture assay. Moreover, in this analysis, a decrease in tumor cell viability was observed after AR-C 118925XX treatment, whereas P2RY2 agonists increased tumor cell viability. Again, this effect was achieved through P2RY2, as evidenced by the fact that all chemicals targeting P2RY2 lost their effect after P2RY2 depletion ( Fig. 20 ).

[0209] Together, these data suggest that P2RY2 expression on cancer cells inhibits T cell activation and T cell-mediated cytotoxicity and that modulation of P2RY2 activity could be exploited to modulate T cell activity in immunotherapy.

[0210] References

[0211] Burnstock et al., Purigergic Signal 9, 491-540 (2013);

[0212] Cai et al., Cell Mol Immuno 17(3), 227-236 (2020);

[0213] Chen et al., J Immunol 189, 347-355 (2012);

[0214] Di Virgilio et al., Oncogene 36, 293-303 (2017);

[0215] Doench et al., Nat Biotechnol 34, 184-191 (2016);

[0216] Hu et al., Clin Cancer Res 25(4):1318-1330 (2019);

[0217] Jorritsma et al., Blood 110(10):3564-3572. (2007);

[0218] Kepp et al., Immunol Rev 280(1):83-92 (2017);

[0219] Lee et al., Cell Res 27, 1034-1045 (2017);

[0220] Mezzadra et al., Nature 549,106-110(2017);

[0221] Pellegatti et al., PLOS one 3(7):e2599 (2008);

[0222] Prasad et al., J Immunol 73(4)2500-2506 (2004);

[0223] Suh et al., Nat Immunol 4, 899-906 (2003);

[0224] Soltoff et al., J Biol Chem 273(5)2653-2660 (1998);

[0225] Ueno et al., Eur J Immunol 42, 2343-2353 (2012);

[0226] US2005 / 0147614A1;

[0227] Veenstra et al., Blood 125, 3335-3346 (2015);

[0228] WO 99 / 02501;

[0229] WO 2019 / 178382;

[0230] Yim et al., Eur J Cancer 133, 74-85 (2020).

Claims

1. A P2Y purinergic receptor 2 (P2RY2) activity regulator for use in T cell immunotherapy.

2. A P2RY2 activity regulator for use according to claim 1, wherein the T cell immunotherapy is adoptive T cell immunotherapy, preferably tumor infiltrating lymphocyte (TIL) therapy, and / or engineered T cell immunotherapy, in particular chimeric antigen receptor (CAR) and / or recombinant T cell receptor immunotherapy.

3. The P2RY2 activity modulator for use according to claim 1 or 2, wherein the P2RY2 modulator is a compound that reduces P2RY2 activity, preferably wherein the compound that reduces P2RY2 activity increases T cell anti-cancer activity in vitro and / or in vivo.

4. A P2RY2 activity modulator for use according to any one of claims 1 to 3, wherein the T cell immunotherapy is cancer T cell immunotherapy, preferably further comprising administering an immune checkpoint inhibitor, administering a cytokine, administering a T cell engager, and identifying at least one of a subject capable of receiving T cell immunotherapy, preferably identifying a subject capable of receiving T cell immunotherapy according to the method of claim 13 or 14.

5. The P2RY2 activity regulator for use according to claim 3 or 4, wherein the compound that reduces the activity of P2RY2 is a compound that directly reduces the activity of P2RY2 and specifically binds to P2RY2 and inhibits P2RY2, wherein the compound that directly reduces the activity of P2RY2 is a small molecule inhibitor, a polypeptide inhibitor, a polynucleotide inhibitor or a non-polypeptide non-polynucleotide inhibitor macromolecule.

6. The P2RY2 activity modulator for use according to claim 5, wherein the small molecule inhibitor is AR-C118925XX (CAS No.: 216657-60-2), wherein the polypeptide inhibitor is selected from antibodies, aptamers, anticalins and designed ankyrin repeat proteins (DARPins), and / or wherein the polynucleotide inhibitor is a polynucleotide aptamer.

7. The P2RY2 activity regulator for use according to claim 3 or 4, wherein the compound that reduces P2RY2 activity is a compound that indirectly reduces P2RY2 activity by reducing the amount of P2RY2 in target cells, wherein the compound that indirectly reduces P2RY2 activity is selected from shRNA agents, siRNA agents, miRNA agents, antisense oligonucleotides, ribozymes and CRISPR / Cas oligonucleotides, preferably a pair of CRISPR / Cas oligonucleotides.

8. The P2RY2 activity modulator for use according to any one of claims 1 to 7, wherein the P2RY2 activity modulator is administered topically, preferably intratumorally.

9. The P2RY2 activity modulator for use according to any one of claims 1 to 3, wherein the P2RY2 modulator is a compound that increases P2RY2 activity, and wherein the T cell immunotherapy is a T cell immunotherapy for an autoimmune disease.

10. The P2RY2 activity modulator for use according to claim 9, wherein the compound that increases P2RY2 activity is a compound that directly increases P2RY2 activity by binding to P2RY2 and activating P2RY2 activity, and wherein the compound that increases P2RY2 activity is a small molecule activator, a polypeptide activator, a polynucleotide activator, or a non-polypeptide non-polynucleotide activator macromolecule; preferably, wherein the small molecule activator is a nucleotide or a derivative thereof, preferably ATP or UTP or a derivative thereof , more preferably MRS2768 (uridine-5'-tetraphosphate δ-phenyl ester, CAS No.: 1047980-83-5), uridine-5'-(γ-thio)-triphosphate (CAS No.: 1266569-94-1), 4-thiouridine-5'-O-(β,γ-difluoromethylene) triphosphate (CAS No.: 1657025-60-9), denufosol (CAS No.: 211448-85-0) or diquafosol (CAS No.: 59985-21-6).

11. The P2RY2 activity modulator for use according to claim 9, wherein the P2RY2 activator is an indirect P2RY2 activator that increases the amount of P2RY2 in target cells, wherein the indirect P2RY2 activator is (i) a polypeptide comprising a P2RY2 polypeptide; (ii) a polynucleotide encoding a polypeptide, wherein the polypeptide comprises a P2RY2 polypeptide; (iii) a vector comprising the polynucleotide of (ii); (iv) a host cell comprising the polynucleotide of (ii) and / or the vector of (iii); or (v) Any combination of (i) to (iv).

12. A polynucleotide encoding a P2RY2 activity modulator as defined in any one of claims 5 to 11, and / or a host cell comprising a P2RY2 activity modulator as defined in any one of claims 5 to 11; both for use in T cell immunotherapy.

13. A method for identifying a subject who can receive T cell immunotherapy, comprising (A) determining the activity (amount) of P2RY2 in the sample of the subject; (B) comparing the amount determined in step (B) with a reference; and (C) identifying a subject who can receive T cell immunotherapy based on the comparison in step (C); Preferably, wherein the reference is derived from (i) a subject or group of subjects known to be capable of receiving immunotherapy or (ii) a subject or group of subjects known to be incapable of receiving immunotherapy.

14. The method according to claim 13, wherein determining the activity comprises determining the amount of P2RY2 and / or at least one downstream signaling molecule thereof, preferably intracellular calcium concentration.

15. A method for identifying a P2RY2 activity modulator, the method comprising (I) contacting a host cell with a candidate compound suspected of being a modulator of P2RY2 activity; (II) determining the activity of B7-H3 in the host cell; (II) comparing the B7-H3 activity determined in step (II) with a control; and (IV) Identifying a P2RY2 activity modulator based on the comparison in step.

Images