Method for single-base targeted editing of broccoli mitochondrial gene and application

Abstract

The invention discloses a method for single-base targeted editing of a broccoli mitochondrial gene and application, the method utilizes mitochondrial single-base editing technology mitochondrial TALECD to carry out targeted editing of the broccoli mitochondrial gene, that is, a cytosine base editor is utilized to convert a CG base pair into TA, a sequence TGG corresponding to a 42nd codon UGG of ORF138 is edited, the TGG is converted into TAG, TGA or TAA, and the TGG is converted into TA, TGA or TAA. And plant mitochondrial genome recombination and large fragment deletion which are possibly caused by the mitoTALENs in the existing mitochondrial gene editing technology are avoided. The method is favorable for creating new germplasm of broccoli and has wide economic benefit prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of crop breeding using gene editing technology, and in particular relates to a method and application of single-base targeted editing of broccoli mitochondrial genes. Background Art

[0002] Broccoli (Brassica oleracea L. var. italica Plenck), also known as broccoli, green cauliflower, etc., is a variety of Brassica oleracea in the Cruciferae family. Broccoli is native to the Mediterranean coast and was introduced to my country in the late 19th century. In recent years, due to its rich nutrition and special health functions, it has been favored by the public and has come to the table of the people from a side dish of Western cuisine. At present, broccoli breeding started late and lacked the accumulation of germplasm resources, which has become a key core issue in the field of broccoli breeding (Li Zhansheng, Liu Yumei, Fang Zhiyuan, et al. The current status, existing problems and coping strategies of my country's broccoli industry development [J]. Chinese Vegetables, 2019(04): 1-5.).

[0003] Mitochondria are the site of energy production (Spinelli JB, Haigis M C. The multifaceted contributions of mitochondria to cellular metabolism [J]. Nature Cell Biology, 2018, 20 (7): 745-754.). Mitochondrial genes play an important role in plant breeding, especially in the cytoplasmic male sterility (CMS) system. The use of the cytoplasmic male sterility system for hybrid seed production can eliminate the need for artificial emasculation, greatly improving the efficiency of seed production. Cytoplasmic male sterility is usually caused by mitochondrial DNA (mtDNA) mutations (Levings CS, Pring DR, 1976. Restriction Endonuclease Analysis of Mitochondrial-DNA from Normal and Texas Cytoplasmic Male-Sterile Maize. Science, 193, 158-60.). In addition, there are many unknown functions in mitochondria. ORFs , which may be related to disease resistance and stress resistance. Therefore, it is urgent to develop efficient mitochondrial gene editing technology to promote the development of plant mitochondrial genomics and further promote crop variety improvement.

[0004] Among gene editing technologies, CRISPR-Cas9 technology is the most widely used (Chen KL, Wang YP, Zhang R, Zhang HW, Gao CX. CRISPR / Cas Genome Editing and Precision Plant Breeding in Agriculture[J]. Annual Review of Plant Biology , 2019, 70:667-97.). However, the gRNA that plays a role in recognition in the CRISPR system is difficult to enter the double membrane system of mitochondria, so it is not suitable for editing the mitochondrial genome. The previous generation of editing tools, TALENs, is composed only of proteins. It uses a natural protein TALE secreted by plant bacteria to recognize specific DNA sequences and enter mitochondria. At present, mitochondrial gene editing technology is developed based on TALE. Dr. Arimura's team at the Plant Molecular Genetics Laboratory, Faculty of Agriculture, University of Tokyo, first established plant mitochondrial gene editing technology based on large-fragment knockout of mitoTALENs (Kazama T, Okuno M, Watari Y, Yanase S, KoizukaC, Tsuruta Y, Sugaya H, Toyoda A, Itoh H, Tsutsumi N, Toriyama K, Koizuka N, Aimura S. Curing cytoplasmic male sterility via TALEN-mediated mitochondrial genome editing[J]. Nature Plants , 2019, 5(7):722-730.), but this technology will cause the recombination of the mitochondrial genome and the loss of large fragments of mitochondrial DNA while knocking out mitochondrial genes. So far, there is no research on editing the broccoli genome using mitochondrial single base editing. Summary of the invention

[0005] In order to solve the above technical problems, the present invention aims at the targeted editing of broccoli mitochondrial genome and avoids the problems of plant mitochondrial genome recombination and large fragment deletion. The broccoli mitochondrial genome is targetedly edited by using the mitochondrial single base editing technology mitoTALECD.

[0006] The present invention is achieved through the following technical solutions: A method for single-base targeted editing of broccoli mitochondrial genes, comprising the following steps: (1) Selection of mitoTALECD editing target sites (a) Using mitoTALECD technology, we identified genes related to cytoplasmic male sterility in mitochondria of cytoplasmic male sterile broccoli. ORF138 Perform gene editing; (b) Obtaining broccoli cytoplasmic male sterility-related genes through the website TALEN targeter ORF138 Candidate pairs of left and right TALE recognition sequences are selected to target genes ORF138 Construction of the target site of the mitoTALECD vector TCD; (2) Construction of mitoTALECD vector TCD (a) Assemble the TALE repetitive sequence according to the Platinum Gate TALEN Assembly Kit, using the vectors in the kit to assemble the TALE repetitive sequence in the first step, and use the entry vector 1 and entry vector 3 of mitoTALECD in the second step, without using the vectors in the kit; (b) According to the multi-site Gateway LR reaction of LR Clonase II plus, entry vectors 1 and 3 were cloned together with entry vector 2 containing the promoter, terminator, and mitochondrial localization signal required by the TALECD vector into the tandem expression Ti plasmid destination vector pK7WG2mito; through this reaction, the ORFs of the two TALEs, CDhalf, and UGI in entry vectors 1 and 3 were transferred to the Ti plasmid containing the CaMV 35S promoter and the mitochondrial targeting signal of the Arabidopsis ATPaseδ subunit, respectively; (c) The final tandemly expressed Ti plasmid was checked by third-generation sequencing to obtain the constructed mitoTALECD plasmid; (3) Evaluation of the effectiveness of the constructed mitoTALECD plasmid using protoplast transformation (a) Isolate broccoli CMS protoplasts, transform the mitoTALECD vector TCD into broccoli CMS protoplasts based on the PEG-mediated transformation method, and extract DNA after culturing for 24 h; (b) Extract the protoplast DNA transformed with the mitoTALECD vector TCD, design primers to amplify the target site, perform PCR amplification, and perform Sanger sequencing. When the target base shows a double peak, the vector can be used; (4) Agrobacterium transformation and broccoli genetic transformation (a) The constructed mitoTALECD plasmid was transformed into Agrobacterium GV3101 using the heat shock method; (b) sterilizing cytoplasmic male sterile broccoli seeds and sowing them in a culture medium, using cotyledons as explants for plant regeneration, and obtaining broccoli regenerated seedlings through Agrobacterium-mediated genetic transformation and kanamycin resistance screening; (c) Based on the upstream and downstream sequences of the target site, the DNA of the regenerated plant is extracted and used as a template for PCR amplification. Sanger sequencing is used to detect the changes in the target bases. If TGG is converted to TAG, TGA or TAA, it is considered that gene editing has occurred in the regenerated plant.

[0007] Furthermore, in step (1), the mitoTALECD technology is used to detect the cytoplasmic male sterility-related genes in the mitochondria of cytoplasmic male sterile broccoli. ORF138 Gene editing is performed by using a cytosine base editor to convert CG base pairs into TA. ORF138 The 42nd codon UGG corresponds to the sequence TGG, which converts TGG into TAG, TGA or TAA. ORF138 Early termination; avoiding plant mitochondrial genome recombination and fragment deletion caused by mitoTALENs technology, thereby performing single-base editing of broccoli mitochondrial genes.

[0008] Specifically, the left and right TALE recognition sequences in step (1) are respectively located at ORF138 The sequence TGG upstream and downstream of the 42nd codon UGG, the first base before the recognition site is T, the length is 13-20 bp, and the two sequences are separated by 12-24 bp, and the interval must contain the target base for single-base editing.

[0009] Specifically, in step (1), the gene ORF138 The target sites for constructing the mitoTALECD vector TCD are as follows: TCD-left:TGTCCACTTTTTGTC TCD-right: TACACTAACTTTACATTCAG.

[0010] Specifically, the entry vector 1 and entry vector 3 of mitoTALECD in step (2) each contain a split half of cytosine deaminase DddA that can convert cytosine C into uracil U, namely CD half, and a uracil glycosylase inhibitor UGI that inhibits the degradation of the generated uracil, which is compatible with the subsequent multi-site Gateway LR reaction.

[0011] Furthermore, the method for single-base targeted editing of broccoli mitochondrial genes is used in targeted editing of broccoli mitochondrial genes through mitochondrial single-base editing.

[0012] According to the above application, the editing is carried out in the cytoplasm of broccoli.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a method for targeted editing of broccoli mitochondrial genes through mitochondrial single base editing, using a cytosine base editor to convert CG base pairs into TA, thereby avoiding plant mitochondrial genome recombination and large fragment deletion caused by the existing mitoTALENs technology; it is conducive to the creation of new broccoli germplasm and has broad application prospects and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0015] Figure 1 Schematic diagram of mitoTALECD vector construction; Figure 2 Schematic diagram for evaluating the effectiveness of the constructed mitoTALECD plasmid using protoplast transformation and Sanger sequencing; Figure 3 This is a diagram of the sequencing results of the target site of the regenerated plant obtained by mitochondrial single-base editing. DETAILED DESCRIPTION

[0016] 1. Materials Cytoplasmic male sterile broccoli variety with excellent cold resistance Platinum Gate TALEN Assembly Kit (Addgene Kit #1000000043), (https: / / www.addgene.org / kits / yamamoto-platinumgate / ). LR Clonase II plus (for multipoint Gateway LR cloning, Invitrogen).

[0017] Entry vector 1 (E1 pENTR L1-L4 NN G1397-DddtoxA-C, E1 pENTR L1-L4 HD G1397-DddtoxA-C, E1 pENTR L1-L4 NG G1397-DddtoxA-C, or E1 pENTR L1-L4 NI G1397-DddtoxA-C), Entry vector 2 (pENTR E2 HSPter-35Sp-mito), and Entry vector 3 (E3 pENTR L3-L2NN G1397-DddtoxA-N, E3 pENTR L3-L2 NI G1397-DddtoxA-N, E3 pENTR L3-L2 HDG1397-DddtoxA-N, or E3 pENTR L3-L2 NG G1397-DddtoxA-N) and the destination vector (pDESTpK7WG2mito). All clones and their sequences are available from Addgene (https: / / www.addgene.org / Shin-ichi_Arimura / ).

[0018] DNA extraction kit: Coolbo CTAB Agrobacterium competent cell: GV3101 (Weidi Biotechnology) Primer synthesis and sequencing were completed by Zhejiang Youkang Biotechnology Co., Ltd. Protoplast preparation kit: Coolbo 2. Construction of mito-TALENs vector and Agrobacterium transformation 1. Selection of target sites for editing with mito-TALENs Use NCBI (https: / / www.ncbi.nlm.nih.gov / ) to find ORF138 Gene (ID: 13630158) sequence. Use the website TALEN targeter “old version with Design Guidelines” to obtain broccoli cytoplasmic male sterility-related genes ORF138 The candidate pairs of left and right TALECD recognition sequences. The sequences recognized by the left and right TALEs are located at ORF138 The sequence TGG upstream and downstream of the 42nd codon UGG, the first base before the recognition site is T, the length should be 13-20bp, and the two sequences are separated by 12-24bp, and the interval must contain the target base of single base editing. ORF138 The target sites of the constructed mitoTALECD vector TCD1 are as follows: TCD-left: TGTCCACTTTTTGTC TCD-right: TACACTAACTTTACATTCAG.

[0019] 2. Construction of mitoTALECDs vector like Figure 1 As shown, Figure 1 (a) Steps for assembling a TALECD ORF with a DNA binding domain of a target sequence. Step 1 is completed using the Platinum Gate TALEN Assembly Kit, and step 2 is implemented using the mitoTALECD vector to achieve the same level of integration between entry vectors 1 and 3 and Figure 1 The reaction in (b) is compatible. Figure 1 (b) is the latter step of making a tandem expression vector for a pair of TALECDs by using Multisite Gateway (Invitrogen). Figure 1 The entry vectors 1 and 3 prepared in (a), and the entry vector 2 having a terminator (Arabidopsis heat shock protein terminator), a promoter (CaMV35Spro) and a mitochondrial localization signal (MLS, the presequence of the Arabidopsis ATPaseδ subunit) are introduced into the target Ti plasmid vector, and the target Ti plasmid vector has a promoter (CaMV35Spro), MLS (the presequence of the Arabidopsis ATPaseδ subunit) and a terminator. The obtained vector can simultaneously express a pair of TALECD open reading frames (TALECD ORFs) with MLS at the N-terminus. Specifically, it is as follows: 1. Refer to the manual of the Platinum Gate TALEN Assembly Kit to assemble the TALECD repetitive sequence in step one, and use entry vector 1 and entry vector 3 to assemble the TALE sequence assembled in step one in step two. The resulting sequences are named entry vector 1; left TALECD and entry vector 3; right TALECD.

[0020] 2. Referring to the multi-site Gateway LR reaction of LR Clonase II plus (Invitrogen, see the manufacturer's manual), the entry vector 1; left TALECD and entry vector 3 and entry vector 3; right TALECD were cloned together into the tandem expression Ti plasmid destination vector pDESTpK7WG2mito.

[0021] Through this reaction, the ORFs of the left and right TALECDs in entry vectors 1 and 3 were transferred to the Ti plasmid containing the CaMV 35S promoter and the mitochondrial targeting signal of the Arabidopsis ATPase δ subunit, respectively.

[0022] 3. Check the final tandemly expressed Ti plasmid by third-generation sequencing.

[0023] 3. Protoplast transformation 1. After disinfecting broccoli seeds, sow them in germination medium. After 10 days, take the cotyledons and cut them into 1.0 mm wide strips in a clean bench. Quickly immerse them in filtered and sterilized enzymatic solution. Protect from light, enzymatically hydrolyze for 3 h at 28°C and 40 rpm, and filter through a cell sieve. Centrifuge the filtrate at 100 g for 3 min, and the precipitate is the broccoli protoplasts. Add 5 mL of II-W5 solution and let stand on ice. Count the protoplasts under a microscope using a hemocytometer. After centrifugation, adjust the protoplast density to 2×10^6 cells / mL using III-MMg solution.

[0024] 2. Add 50 ug of plasmid to 300 mL of protoplasts, mix well, add IV-PEG solution and mix well, let stand at room temperature for 15 min, then add II-W5 solution to terminate the reaction, remove the supernatant after centrifugation, resuspend with II-W5 solution, and culture at 28°C in the dark for 24 h.

[0025] 3. Extract DNA from untransformed protoplasts and protoplasts transformed with mitoTALECD vector TCD, and perform PCR amplification. The primers are: ORF138-For:ATGATTACCTTTTTCGAAAAATTGTCC ORF138-Rev:TTATTTTCTCGGTCCATTTTCCAACCT The amplification system is shown in Table 1: Table 1 <![CDATA[Sterile ddH2O(Sterile double distilled water)]]> 21μl KOD ONE Mix (KOD ONE PCR polymerase mixture) 25μl ORF138-For (forward primer) 1.5μl ORF138-Rev (reverse primer) 1.5μl DNA 1μl Total 50μl The amplification procedure is as follows: Pre-denaturation at 94°C for 5 min, then start the following cycle: ; The final extension was performed at 72°C for 10 min, and the temperature was finally lowered to 4°C to stop the reaction and remove the cells.

[0026] The length of the amplified fragment was about 417 bp. The PCR product was sent to the company for Sanger sequencing. Figure 2 If the sequencing result shows that the target base has a double peak, it means that the vector can be used. If the sequencing result shows that the sequence is the same as the wild type and the target base is a single peak, it means that the vector is unusable or has low efficiency.

[0027] 4. Genetic transformation of broccoli 1. Agrobacterium transformation: The constructed mitoTALECD plasmid was transformed into Agrobacterium GV3101 using the heat shock method.

[0028] 2. Disinfection and sowing: Disinfect the cold-resistant and excellent seeds of broccoli varieties in 70% ethanol for 2 min and in 15% commercial sodium hypochlorite disinfectant for 15 min, then wash with sterile water, dry with filter paper, sow in germination medium, and culture at 26°C under light and wait for germination.

[0029] 3. Agrobacterium culture: Take 50 μL of Agrobacterium glycerol bacteria that have been transferred into the vector and add 10 mL of LB containing 50 mg / L spectinomycin and 25 mg / L rifampicin. Culture medium , shake at 28℃ overnight, centrifuge and discard LB Culture medium , use 30 mL of MS Culture medium Resuspend to obtain Agrobacterium resuspension for standby use. In the Agrobacterium resuspension, the OD of Agrobacterium is 0.3-0.4; 4. Collection and infection of explants: After the cotyledons in step 1 are unfolded, cut off the cotyledons and place them in the Agrobacterium resuspension obtained in step 2. After 10 minutes, transfer them to a co-culture medium without antibiotics and culture them in the dark for 2-3 days (culture temperature is 22°C).

[0030] 6. Explant subculture: After co-cultivation in step 3, transfer to differentiation medium and subculture every 10-14 days. After sprouts grow, transfer to rooting medium and transplant to soil after rooting.

[0031] The culture medium used above can refer to the method of Lawrenson et al. (Lawrenson T, GoldsackC, Ostergaard L, et al.: Brassica rapa, Wang K, editor, Agrobacterium Protocols, Volume 2, Third Edition, 2015: 3-10.).

[0032] 4. Gene Editing Detection in Regenerated Plants The leaf DNA of the wild type (excellent cold resistance) and the regenerated plants were extracted and PCR amplified. The primers were: ORF138-For:ATGATTACCTTTTTCGAAAAATTGTCC ORF138-Rev:TTATTTTCTCGGTCCATTTTCCAACCT The amplification system is shown in Table 2: Table 2 <![CDATA[Sterile ddH2O(Sterile double distilled water)]]> 21μl KOD ONE Mix (KOD ONE PCR polymerase mixture) 25μl ORF138-For (forward primer) 1.5μl ORF138-Rev (reverse primer) 1.5μl DNA 1μl Total 50μl The amplification program is as follows: 94°C pre-denaturation for 5 min, followed by the following cycles: ; The final extension was performed at 72°C for 10 min, and the temperature was finally lowered to 4°C to stop the reaction and remove the cells.

[0033] The length of the amplified fragment is about 417 bp. The PCR product was sent to the company for Sanger sequencing. Figure 3 As shown, if the sequencing results show that the target base pair is changed from CG to TA, it means that the regenerated plant is successfully edited. If the sequencing results show that the sequence is the same as the wild type, it means that no editing has occurred.

[0034] Finally, it should be noted that the above are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

[0035] Those skilled in the art will readily appreciate other embodiments of the present application after considering the specification and practicing the contents disclosed herein. The present application is intended to cover any variations, uses or adaptations of the present application, which follow the general principles of the present application and include common knowledge or customary technical means in the art that are not disclosed in the present application.

[0036] It should be understood that the present application is not limited to the exact construction that has been described above and shown in the drawings, and that various modifications and changes may be made without departing from the scope thereof.

Claims

1. A method for single-base targeted editing of broccoli mitochondrial genes, characterized in that: The steps include: (1) Selection of mitoTALECD editing target sites (1a) Using mitoTALECD technology, we identified genes related to cytoplasmic male sterility in mitochondria of cytoplasmic male sterile broccoli. ORF138 Perform gene editing; (1b) Obtain broccoli cytoplasmic male sterility-related genes through the website TALEN targeter ORF138 Candidate pairs of left and right TALE recognition sequences are selected to target genes ORF138 Construction of the target site of the mitoTALECD vector TCD; (2) Construction of mitoTALECD vector TCD (2a) Assemble the TALE repetitive sequence in the first step using the vectors in the Platinum Gate TALEN Assembly Kit, and in the second step use entry vectors 1 and 3 of mitoTALECD without using the vectors in the kit; (2b) According to the multi-site Gateway LR reaction of LR Clonase II plus, entry vectors 1 and 3 are cloned together with entry vector 2 containing the promoter, terminator, and mitochondrial localization signal required by the TALECD vector into the tandem expression Ti plasmid destination vector pK7WG2mito; through this reaction, the ORFs of the two left and right TALEs, CD half, and UGI in entry vectors 1 and 3 are transferred to the Ti plasmid containing the CaMV 35S promoter and the mitochondrial targeting signal of the Arabidopsis ATPaseδ subunit, respectively; (2c) The final tandemly expressed Ti plasmid was checked by third-generation sequencing to obtain the constructed mitoTALECD plasmid; (3) Evaluation of the effectiveness of the constructed mitoTALECD plasmid using protoplast transformation (3a) Isolate broccoli CMS protoplasts, transform the mitoTALECD vector TCD into the broccoli CMS protoplasts based on the PEG-mediated transformation method, and extract DNA after culturing for 24 hours; (3b) Extract the protoplast DNA transformed with the mitoTALECD vector TCD, design primers to amplify the target site, perform PCR amplification, and perform Sanger sequencing. When the target base shows a double peak, the vector can be used; (4) Agrobacterium transformation and broccoli genetic transformation (4a) The constructed mitoTALECD plasmid was transformed into Agrobacterium GV3101 using the heat shock method; (4b) sterilizing cytoplasmic male sterile broccoli seeds and sowing them in a culture medium, using cotyledons as explants for plant regeneration, and obtaining broccoli regenerated seedlings through Agrobacterium-mediated genetic transformation and kanamycin resistance screening; (4c) Based on the upstream and downstream sequences of the target site, the DNA of the regenerated plant is extracted and used as a template for PCR amplification. Sanger sequencing is used to detect the changes in the target bases. If TGG is converted to TAG, TGA or TAA, it is considered that gene editing has occurred in the regenerated plant.

2. The method for single-base targeted editing of broccoli mitochondrial genes according to claim 1, characterized in that: In the step (1a), the mitoTALECD technology is used to detect the cytoplasmic male sterility-related genes in the mitochondria of cytoplasmic male sterile broccoli. ORF138 Gene editing is performed by using a cytosine base editor to convert CG base pairs into TA. ORF138 The sequence corresponding to the 42nd codon UGG is TGG, which converts TGG into TAG, TGA or TAA. ORF138 Early termination; avoiding plant mitochondrial genome recombination and fragment deletion caused by mitoTALENs technology, thereby performing single-base editing of broccoli mitochondrial genes.

3. The method for single-base targeted editing of broccoli mitochondrial genes according to claim 1, characterized in that: In step (1b), the left and right TALE recognition sequences are located respectively ORF138 The sequence TGG upstream and downstream of the 42nd codon UGG, the first base before the recognition site is T, the length is 13-20 bp, and the two sequences are separated by 12-24 bp, and the interval must contain the target base for single-base editing.

4. The method for single-base targeted editing of broccoli mitochondrial genes according to claim 1, characterized in that: In step (1b), the gene targeted is selected ORF138 The target sites for constructing the mitoTALECD vector TCD are as follows: TCD-left:TGTCCACTTTTTGTC TCD-right: TACACTAACTTTACATTCAG.

5. The method for single-base targeted editing of broccoli mitochondrial genes according to claim 1, characterized in that: In the step (2a), the entry vector 1 and entry vector 3 of mitoTALECD each contain a split half of cytosine deaminase DddA that can convert cytosine C into uracil U, namely CD half, and a uracil glycosylase inhibitor UGI that inhibits the degradation of the generated uracil, which is compatible with the subsequent multi-site Gateway LR reaction.

6. Use of the method according to claim 1 in targeted editing of broccoli mitochondrial genes by mitochondrial single base editing.

7. The use according to claim 6, characterized in that Editing takes place in the broccoli cytoplasm.

Images