TRAFD1 induces activation of cd8+ t cell immune response and use in treating pancreatic cancer
By overexpressing the TRAFD1 gene in pancreatic cancer and activating CD8+ T cells, the problem of drug resistance to immunotherapy in pancreatic cancer was solved, achieving the effects of tumor growth inhibition and enhanced immune response.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE FIFTH AFFILIATED HOSPITAL SUN YAT SEN UNIV
- Filing Date
- 2024-10-29
- Publication Date
- 2026-06-26
AI Technical Summary
Pancreatic cancer has a low response rate to immune checkpoint inhibitory therapy (ICB). The tumor microenvironment is highly immunosuppressive, and existing treatment regimens are unable to effectively activate CD8+ T cells, leading to immunotherapy resistance.
By studying the TRAFD1 gene and its expression products, it was found that it is expressed at low levels in pancreatic cancer and can promote the activation and effector function of CD8+ T cells. Recombinant plasmids or recombinant cells overexpressing TRAFD1 were constructed and combined with anti-PD-1 monoclonal antibodies for immunotherapy.
It significantly reduces the growth rate of pancreatic cancer tumors, promotes the secretion of granzyme B and IFNG proteins by CD8+ T cells, enhances the immune response against pancreatic cancer, and improves the efficacy of immunotherapy.
Smart Images

Figure CN119506427B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of disease treatment technology, and more specifically, relates to the application of TRAFD1 in inducing and activating CD8+ T cell immune responses in the treatment of pancreatic cancer. Background Technology
[0002] Pancreatic ductal carcinoma (PDAC) is a highly aggressive and lethal malignant tumor with an average 5-year overall survival rate of less than 10%. Currently, immunotherapy, particularly immune checkpoint blockade (ICB), has been shown to enhance T-cell-mediated immune responses. In recent years, ICB has become a promising treatment option for various cancers, including advanced skin cancer, lung cancer, and colorectal cancer. However, due to the highly proliferative connective tissue and immunosuppressive tumor microenvironment of pancreatic cancer, multiple clinical trials have shown a low response rate to ICB. Therefore, finding safe and effective new strategies to enhance anti-tumor immunity is a crucial and urgent issue that needs to be addressed.
[0003] Due to the limitations of traditional treatments, immunotherapy has garnered significant attention. The principle of immunotherapy is to utilize specific immune cells or drugs to modulate the body's immune system, enabling it to better recognize and attack cancer cells. PD-1 / PD-L1 immune checkpoint inhibitor therapy (hereinafter referred to as "immunotherapy") has shown promising efficacy in various solid tumors, even becoming a first-line treatment option in some. However, except for a very small number of pancreatic cancers with microsatellite instability-high (MSI-H) characteristics that respond well to immunotherapy, the vast majority of pancreatic cancers are resistant to immunotherapy. The tumor microenvironment in which pancreatic cancer resides is highly immunosuppressive, a crucial factor contributing to immunotherapy resistance.
[0004] The tumor microenvironment is a crucial component of tumor tissue, comprising tumor cells, immune cells, stromal cells, extracellular matrix, and various soluble molecules, playing a vital role in tumor development and progression. From a histological perspective, the immune microenvironment of pancreatic cancer is characterized by a dense matrix composed of various cellular and non-cellular components. This matrix is also known as the pro-fibrotic response or tumor microenvironment (TME). It contains various immune cell types, such as myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), tumor-associated fibroblasts (TAFs), and regulatory T cells (Tregs), while anti-tumor immune cells, such as cytotoxic T cells (CD8+ T cells), infiltrate less. Single-cell sequencing analysis revealed that the majority of cells sorted from pancreatic cancer tissue were immune cells, with myeloid cells (including MDSCs and TAMs) accounting for 36.7%, T cells and NK cells accounting for 30.5%, and CAFs accounting for 6.2%. The abundance of M2-type TAMs, MDSCs, Tregs, and Th2-type T cells in the TME all suggest a poor prognosis for pancreatic cancer. The combined effect of these multiple factors reshapes the highly immunosuppressive microenvironment of pancreatic cancer.
[0005] CD8+ T cells are the most important cells in anti-tumor immunity in pancreatic cancer. Studies have shown that CD8+ T cell infiltration into the tumor microenvironment indicates a good tumor prognosis, and CD8+ T cells are closely related to inhibiting tumor development and metastasis, as well as immune enhancement. CD8+ T cells promote tumor cell caspase activation and apoptosis by secreting cytotoxic granzyme B and perforin. CD8+ T cells induce tumor cell death through the Fas / Fas ligand pathway. Therefore, exploring novel genes that promote CD8+ T cell activation in pancreatic cancer will provide new targets for immunotherapy of pancreatic cancer. Summary of the Invention
[0006] To overcome the limitations of existing technologies, research has revealed that the TRAF-type zinc finger domain containing 1 gene (TRAFD1) can serve as a molecular marker for predicting whether pancreatic cancer patients will benefit from immunotherapy. Furthermore, TRAFD1 enhances the efficacy of immunotherapy by influencing CD8+ T cell activation and effector function, which is of significant importance for advancing immunotherapy in pancreatic cancer.
[0007] The primary objective of this invention is to provide the application of the TRAFD1 gene and its expression products in the development and screening of functional products for the treatment of pancreatic cancer.
[0008] The second objective of this invention is to provide the application of functional products that promote the TRAFD1 gene and its expression products in the preparation of products that promote the immune response of CD8+ T cells.
[0009] A third objective of this invention is to provide the application of functional products that promote the TRAFD1 gene and its expression products in the preparation of products for the treatment of pancreatic cancer.
[0010] The objective of this invention is achieved through the following technical solution:
[0011] The application of the TRAFD1 gene and its expression products in the development and screening of functional products for the treatment of pancreatic cancer, wherein the functional products have a promoting effect on the TRAFD1 gene and its expression products.
[0012] This invention compared TRAFD1 gene expression in pancreatic cancer cells and adjacent normal cells using public databases, revealing that TRAFD1 is lowly expressed in pancreatic cancer tissues; this finding was verified by qPCR. Subsequently, by constructing pancreatic cancer cells overexpressing TRAFD1 and co-culturing them with anti-tumor immune cells (CD8+ T cells) in vitro, it was found that co-culturing the KPC-OVA cell line overexpressing TRAFD1 with CD8+ T cells resulted in a higher proportion of GZMB+CD8 T cells and IFNG+CD8 T cells. This indicates that TRAFD1 can serve as a molecular marker for predicting whether pancreatic cancer patients will benefit from immunotherapy. Furthermore, TRAFD1 promotes the efficacy of immunotherapy by influencing CD8+ T cell activation and effector function. This conclusion was also validated in subsequent in vivo animal experiments.
[0013] Therefore, this invention also protects the use of functional products that promote the TRAFD1 gene and its expression products in the preparation of products that promote the immune response of CD8+ T cells.
[0014] Preferably, the promotion of CD8+ T cell immune response manifests in one or more of the following ways:
[0015] (1) Promotes the secretion of granzyme B by CD8+ T cells;
[0016] (2) Promotes the secretion of IFNG protein by CD8+ T cells;
[0017] (3) CD8+ T cells kill an increased number of pancreatic cancer tumor cells;
[0018] (4) Combine immunotherapy drugs to reduce the growth rate of pancreatic cancer tumors.
[0019] Preferably, the functional product that promotes the TRAFD1 gene and its expression product is selected from any one of the following:
[0020] (i) Targeting TRAFD1 or TRAFD1 transcripts and enhancing the expression of TRAFD1 gene expression products;
[0021] (ii) A construct containing TRAFD1, or a TRAFD1 complementary sequence, and capable of forming an enhanced TRAFD1 gene expression product after being transfected into the body;
[0022] (iii) Immune-associated cells, their differentiated cells, or constructs that overexpress the TRAFD1 gene sequence.
[0023] More preferably, the immunotherapy drug is PD-1, and the functional product is a recombinant plasmid overexpressing TRAFD1 or recombinant cells.
[0024] This invention, through in vivo animal experiments, found that overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody significantly reduced the growth rate of pancreatic cancer tumors.
[0025] Therefore, this invention also protects the use of functional products that promote the TRAFD1 gene and its expression products in the preparation of products for treating pancreatic cancer.
[0026] Preferably, the functional product that promotes the TRAFD1 gene and its expression product is selected from any one of the following:
[0027] (i) Targeting TRAFD1 or TRAFD1 transcripts and enhancing the expression of TRAFD1 gene expression products;
[0028] (ii) A construct containing TRAFD1, or a TRAFD1 complementary sequence, and capable of forming an enhanced TRAFD1 gene expression product after being transfected into the body;
[0029] (iii) Immune-associated cells, their differentiated cells, or constructs that overexpress the TRAFD1 gene sequence.
[0030] More preferably, the functional product is a recombinant plasmid overexpressing TRAFD1, or a recombinant cell.
[0031] Compared with the prior art, the present invention has the following beneficial effects:
[0032] This invention discovers that the TRAF-type zinc finger domain containing 1 gene (TRAFD1) can serve as a molecular marker for predicting whether pancreatic cancer patients will benefit from immunotherapy. Furthermore, TRAFD1 promotes the efficacy of immunotherapy by influencing CD8+ T cell activation and effector function, which is of great significance for advancing immunotherapy for pancreatic cancer. Attached Figure Description
[0033] Figure 1 The expression of TRAFD1 in pancreatic cancer tissue and normal pancreatic tissue is shown in the TCGA database.
[0034] Figure 2 The mRNA levels of the TRAFD1 gene were differentially expressed in pancreatic cancer cells and pancreatic cells.
[0035] Figure 3 The pCMV-T7-MCS-3×FLAG-WPRE-Neo plasmid map;
[0036] Figure 4 This was to validate the PCR amplification of the target fragment after transient transfection of the overexpression plasmid.
[0037] Figure 5 Enzyme digestion verification of the transiently transfected overexpression plasmid vector fragment; the markers from top to bottom are 10000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp;
[0038] Figure 6 To validate positive transformants of transient overexpression plasmids; the markers from top to bottom are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.
[0039] Figure 7 Map of pLV3-CMV-MCS-3×FLAG-CopGFP-Puro plasmid;
[0040] Figure 8 To verify the TRAFD1 protein level in pancreatic cancer cells after exogenous overexpression of TRAFD1 by Western blotting;
[0041] Figure 9 To verify the TRAFD1 protein level in pancreatic cancer cells after exogenous overexpression of TRAFD1 by qPCR;
[0042] Figure 10 Verification of the target fragment after PCR amplification of the plasmid that stably expressed the expression plasmid;
[0043] Figure 11 Enzyme digestion verification of the plasmid vector fragment for stable overexpression; Markers from top to bottom are 10000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp;
[0044] Figure 12 To verify the positive transformants of the stable overexpression plasmid;
[0045] Figure 13 To detect the proportion of GZMB and IFNG positivity in CD8+ T cells co-cultured with pancreatic cancer cells overexpressing TRAFD1 in vitro by flow cytometry;
[0046] Figure 14 This shows the proportion of apoptotic tumor cells in pancreatic cancer cells after overexpression of TRAFD1 following co-culture with CD8+ T cells.
[0047] Figure 15 To investigate the effect of TRAFD1 overexpression combined with anti-PD-1 monoclonal antibody on subcutaneous tumor volume in mice. Detailed Implementation
[0048] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0049] Example 1 verifies the expression level of TRAFD1 in pancreatic cancer.
[0050] 1. Public Database Analysis
[0051] This study downloaded gene expression matrices from the TCGA database containing 179 pancreatic cancer tissues and 4 adjacent normal tissues. The annotation information was read, probe names were converted to gene names, and the aggregate function was used to remove duplicate genes. The results are as follows: Figure 1 As shown, TRAFD1 is expressed at low levels in pancreatic cancer tissues compared to adjacent normal tissues.
[0052] 2. RT-qPCR assay to detect differential expression of TRAFD1 gene in pancreatic cancer cells and pancreatic cells.
[0053] 2.1 RNA extraction
[0054] (1) Mouse pancreatic cancer cell lines PANC02, KPC, LTPA and mouse pancreatic duct epithelial cell line MPDEpiC were seeded into 6-well plates, 2 mL of culture medium was added to each well, and the cells were cultured until the density reached 80%.
[0055] (2) Aspirate the culture medium dry, wash twice with an appropriate amount of PBS, add 500 μL of Lysis Buffer to each well, and pipette 10 times. Add an equal volume of anhydrous ethanol to the lysed cells, mix well, and then transfer the liquid to an RNA purification column. Centrifuge at 12000×g for 1 min at room temperature and discard the waste liquid;
[0056] (3) Add 500 μL of Wash Buffer to the RNA centrifuge column, centrifuge at 12000×g for 1 min at room temperature, and discard the waste liquid.
[0057] (4) Reassemble the RNA centrifuge column into the collection tube, centrifuge the empty tube at 12000×g for 1 min at room temperature, and discard the waste liquid.
[0058] (5) Transfer the RNA centrifuge column into a clean 1.5 mL centrifuge tube without RNase, and let it air dry for 2 min.
[0059] (6) Add 20-30 μl of Elution Buffer to the center of the RNA centrifuge column membrane and let it stand at room temperature for 2 min. Centrifuge at 12000 rpm for 1 min at room temperature and measure the concentration of the product.
[0060] 2.2 Reverse transcription
[0061] The isolated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and reverse transcription procedure are shown in Tables 1 and 2.
[0062] Table 1
[0063]
[0064] Table 2
[0065] Reverse transcription program time 37℃ 15min 85℃ 5 seconds 4℃ Hold
[0066] The transcriptional level of TRAFD1 was detected, with GAPDH used as a control. The primer sequences were as follows:
[0067] TRAFD1 primer sequence: 5'-3': ATGGCCGAGTTTCGAGATGAC;
[0068] 3'-5': ACACACCAATGTTCCTTTGACAG;
[0069] GAPDH primer sequence: 5'-3': AGGTCGGTGTGAACGGATTTG;
[0070] 3'-5': TGTAGACCATGTAGTTGAGGTCA.
[0071] 2.3 Real-time quantitative PCR
[0072] (1) Configure the qPCR reaction system as shown in Table 3.
[0073] Table 3
[0074]
[0075] (2) The amplification procedure is shown in Table 4.
[0076] Table 4
[0077]
[0078] The results are as follows Figure 2 As shown, TRAFD1 is expressed at low levels in pancreatic cancer cells.
[0079] Example 2: Construction of a KPC-OVA cell line transiently overexpressing TRAFD1
[0080] 1. Construction of TRAFD1 overexpression transient transduction vector
[0081] 1.1 Plasmid Design
[0082] A suitable vector, pCMV-T7-MCS-3×FLAG-WPRE-Neo, was selected and modified. The primer sequences used for the target fragment are as follows:
[0083] F1: TTGGTACCGAGCTC GAATTC GCCACCATGGCCGAGTTTCGAGATGACCAG,
[0084] R1: TGGTCTTTGTAGTC GGATCC CTCCTCTTCCTCCTCCGCATCGCCTG.
[0085] In the above sequences, the bolded sequence is the Kozak sequence, and the underlined text indicates the restriction enzyme sites. The upstream restriction enzyme site is EcoRI, and the downstream restriction enzyme site is BamHI. The plasmid map is shown below. Figure 3 As shown.
[0086] 1.2 PCR reaction system and amplification conditions
[0087] Synthesize the target gene and use I-5 TMPCR amplification was performed using 2×High-Fidelity Master Mix high-guarantee polymerase. The specific reaction system and conditions are shown in Table 5, and the amplification program is shown in Table 6.
[0088] Table 5
[0089] <![CDATA[I-5 TM 2×High-Fidelity Master Mix]]> 12.5μL Primer F 1μL Primer R 1μL plasmid template 1μL <![CDATA[ddH2O]]> 9.5μL Total volume 25μL
[0090] Table 6
[0091]
[0092] 1.3 Detection of PCR product size and recovery of PCR products
[0093] After PCR amplification of the target fragment, electrophoresis was performed on a 1% agarose gel, using a DNA marker as a reference, to determine the size of the target gene fragment. The results are as follows: Figure 4 As shown, the observed bands matched the expected positions, and the target fragment size was 1786 bp, indicating successful amplification. The correct target bands were then cut and recovered into sterile 1.5 mL EP tubes, and the DNA target fragments were recovered according to the instructions of the Rapid Agarose Gel DNA Recovery Kit.
[0094] 1.4 Enzyme digestion and recovery of the vector
[0095] In a sterile 0.2 mL EP reaction tube, the enzyme digestion vector pCMV-T7-MCS-3×FLAG-WPRE-Neo was performed. The specific enzyme digestion system is shown in Table 7.
[0096] Table 7
[0097]
[0098] The detection and recovery of the vector digestion results were the same as in Section 1.3. According to the 1% agarose gel electrophoresis results, the observed bands matched the expected positions. The vector pCMV-T7-MCS-3×FLAG-WPRE-Neo produced a 6063bp band after digestion, indicating successful digestion. Figure 5 As shown.
[0099] 1.5 Homologous recombination reaction
[0100] The concentrations of the target fragment (P1 fragment) and the recovered fragment of the vector after double enzyme digestion were detected. Finally, ligation was performed using a reaction system of vector fragment:P1 fragment = 3:1, as shown in Table 8.
[0101] Table 8
[0102]
[0103] Transformation of competent cells with ligation product: Thaw DH5α competent cells on ice after removing them from the -80℃ freezer; add the recombinant product from 3.1.5 to 100 μL of DH5α competent cells (this step is performed on a clean bench), gently rotate to mix, and incubate on ice for 30 min; heat shock at 42℃ for 45 s, then immediately incubate on ice for 2 min; add 900 μL of antibiotic-free LB liquid medium (this step is performed on a clean bench), and incubate at 37℃ and 180 rpm for 30 min; after incubation, centrifuge at 10000 rpm for 1 min, remove the supernatant, add 100 μL of fresh culture medium, gently mix, and spread evenly on LB agar plates containing Amp antibiotic (100 μg / mL), and place at room temperature until the liquid is absorbed; transfer the plates to a 37℃ biochemical incubator, invert, and incubate overnight.
[0104] Colony PCR identification of positive transformants: Four single colonies of the constructed vector were selected for PCR identification. The forward identification primers were: D1: CCCATTGACGTCAATGGGAG, D2: tgcatttacaggtcacctgac; where D1 is located on the CMV promoter of the vector and D2 is located downstream of the target gene; the reaction system is shown in Table 9 and the amplification conditions are shown in Table 10.
[0105] Table 9
[0106] colonies Monoclonal upstream primer D1 0.5μL Downstream primer D2 0.5μL TaKaRaTaqMax 5μL <![CDATA[ddH2O]]> 4μL Total volume 10μL
[0107] Table 10
[0108]
[0109] Electrophoresis was performed using a 1% agarose gel, with the DNA marker serving as a reference. Figure 6 The observed bands matched the expected positions, and the identified product size was 453 bp, indicating that the colony contained the target gene.
[0110] 1.6 Plasmid identification and sequencing
[0111] At least two single clones matching the target fragment size were inoculated into LB liquid medium containing 1‰ Amp resistance and cultured overnight. Plasmids were then extracted, following these steps:
[0112] (1) Centrifuge the bacterial solution at 13,000 rpm for 1 min and discard the waste liquid.
[0113] (2) Lyse the bacterial pellet thoroughly with 500 μL Buffer P1 and 5 μL CWBlue.
[0114] (3) Add 500 μL Buffer P2 and lyse at room temperature for 5 min.
[0115] (4) Column equilibration: Add 200 μL of Buffer PS to the adsorption column (Spin Columns DL) that has been loaded into the collection tube, centrifuge at 13000 rpm for 2 min, and discard the waste liquid.
[0116] (5) Add 500 μL Buffer E3, immediately invert and mix 8-10 times until a white flocculent precipitate appears, and let stand at room temperature for 5 minutes.
[0117] (6) Centrifuge at 13,000 rpm for 5 min, collect the supernatant, add the supernatant to the filter column (Endo-Remover FM), centrifuge at 13,000 rpm for 1 min to filter, and transfer the filtrate in the collection tube to the centrifuge tube.
[0118] (7) Add 0.3 times the volume of the supernatant of isopropanol and mix well. Transfer the mixture to a Spin Columns DL adsorption column.
[0119] (8) Centrifuge at 13,000 rpm for 1 min and discard the waste liquid.
[0120] (9) Add 750 μL Buffer PW, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and centrifuge again for 1 min.
[0121] (10) Prepare a 1.5 mL centrifuge tube, add 100 μL of Buffer EB to the adsorption column, incubate at room temperature for 5 min, and centrifuge at 13,000 rpm for 2 min. Store the plasmid at -20℃.
[0122] The sequencing results of the TRAFD1 sequence in the recombinant plasmid are shown below. Sequence alignment confirms that the recombinant plasmid constructed in this invention is correct.
[0123] TRAFD1 sequence: atggccgagtt tcgagatgac caggcttcta ggctgtgtga caactgcaagaaggaaattc ctgtatttaa ttttaccatc catgaaatcc actgtcaaag gaacattggt gtgtgccctgtctgcaagga accgttcccc aaatctgaca tggacattcacatggctgca gagcactgtc aggtgacctgtaaatgcaac aagaagttgg agaagaggca gttaaagcag catgcggagacagagtgtcc cctgcggctcgccgtctgcc agcactgtga tctggagctt tctgttgtca agttgaagga gcatgaggattactgtggagcccggacaga gctgtgtggc agctgtgggc gcaacgtgct tgtgaaggag ctgaagactcaccccgaagt ctgtgggagagtggaggagg aaaagagaac ggaggctgcc atccctccgg aggcttacgacgagccctgg agtcaggaca gaatctggatcgcatcccag ctcctcagac aaatcgaggc tctggacccgcccatgaggc tccctggaag gcccctgcaa gcctttgaggcagacccctt ctacagtagg actaccagccagaggagcat ggcagcccag tttccagttc aaaataatct ttttgaagaa caagaaaggcaggaaaggaacagaagccgg cagtccccaa aggacagcgc tgagaataac gcacacttgg acttcatgttggccttgagtctgcagaatg agggacaggc caccagcatg gtagagcagg gcttctggga gtctgtgcctgaggctgatc cggctcgtgctgggcccaca tctctaggtg acataaaggg tgctgctgac gagattctgctgccgtgtga gttctgtgag gagctgtacc cagaggaactgctcattgaccatcagacaa gctgcaacccttctcatgcc ttacgttcac tcaatacggg cagctcttcc atcaggggtg tggaagatcctggtaccatcttccagaact ttctacaaca agcaacaagt aaccagtttg acactttaat gggcctgagc agttcagctgctgtggaagacagcatcatc atcccctgtg agttctgtgg ggtgcagctg gaagaggagg tgctgttctaccatcaggac cagtgtgaccaacgcccagc cacagcaaac caccgtgcag tggagggcat cccagcccaggattcgcagc cagaaaacac ttcagcagagctgtccagga ggcgggtcaa acaccaggga gacctgtcatctggttacat ggatgatgtc aagccggaat cagtgaaaggccccacctac tcgatgtctc ctaacaggaccatgaacaat gtggcttcct gcaaccgact gttgaactta ccgtcagggc ccaggtctgactgccagcgtagccctcccg gtgtgctgaa actcaacaac tctgatagcc aggacatccg tgggcagatgcggggcagccagaatgggcc catagcatcc gggcacgctc cagtgatcca ctctattcaa aatctctatccagaaaactt tgcgccctct tttcctcatggatcccctgg gaggtacgga gctgg.
[0124] 1.7 Plasmid transfection of pancreatic cancer cells
[0125] One day in advance, seed the KPC-OVA cell line (denoted as KPC-OVA-TRAFD1, with a control group KPC-OVA-Vector) into 6-well plates. Transfect the cells when they reach 70%–80% confluency on the second day. The specific steps are as follows:
[0126] (1) Transfect according to the plasmid:liposome ratio of 1:2. Take two 1.5mL EP tubes, add 250μL of Opti-MEM to each tube, add 10μg of liposome transfection reagent to tube A, and add 5μg of the above-mentioned plasmid to be transfected to tube B. Add the solution from tube A to the solution from tube B, mix well and let stand at room temperature for 20min.
[0127] (2) Discard the old culture medium in each well and add fresh culture medium. Then, add the mixed solution from step (1) dropwise into the well. After 6 hours, change the medium to serum-containing medium. After 48 hours, pancreatic cancer cell lines overexpressing TRAFD1 were obtained.
[0128] 1.8 Detection of TRAFD1 protein levels in pancreatic cancer cells after exogenous overexpression of TRAFD1
[0129] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by Western blot, and the specific steps are as follows:
[0130] 1.8.1 Protein Sample Extraction and Preparation
[0131] (1) KPC-OVA-Vector and KPC-OVA-TRAFD1 pancreatic cancer cells were seeded into 6-well plates, and 2 mL of culture medium was added to each well. The cells were cultured until the density reached 80%.
[0132] (2) Use a cell scraper and RIPA lysis buffer to scrape the adherent cells off the culture dish, then transfer the cell suspension to a 1.5 mL EP tube and lyse on ice for 30 min.
[0133] (3) Centrifuge at 4℃ and 12000rpm for 20min. After centrifugation, transfer the supernatant to a new centrifuge tube.
[0134] 1.8.2 BCA protein quantification
[0135] Prepare standard systems of different concentrations according to the BCA instructions, and add them to the corresponding wells according to the gradient, with 3 replicates for each gradient. Add the test samples to the corresponding wells. After adding the BCA mixture, incubate at 37°C for 30 min and measure the protein concentration. Dilute the protein to a uniform concentration with 5× Loading Buffer and ddH2O, boil at 98°C for 10 min, cool to room temperature, and then store at -20°C.
[0136] 1.8.3 Electrophoresis
[0137] Prepare 1× electrophoresis buffer, add 3-5 μL of marker to each well, and keep the sample loading volume consistent for both the control and experimental groups. Adjust the parameters: 80V for 30 min, then 120V for 60 min for electrophoresis.
[0138] 1.8.4 Transfer of film
[0139] Pour in the transfer buffer, ensuring the filter paper and sponge are completely wetted. Take a 0.45 μm PVDF membrane and activate it in methanol for 5 min. Place the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in the transfer holder in that order. Place the transfer holder into the transfer tank, red against white and black against black. Pour in 1x transfer buffer and incubate at 250 mA for 90 min.
[0140] 1.8.5, Closed
[0141] Seal with TBST containing 5% skim milk, place on a shaker, and shake slowly at room temperature for 1 hour.
[0142] 1.8.6 Antibody Incubation
[0143] (1) Dilute the primary antibody with the dilution buffer according to the dilution ratio of 1:1000 for anti-TRAFD1 antibody and 1:8000 for anti-GAPDH antibody, and incubate the primary antibody at 4°C overnight.
[0144] (2) Wash 3 times with TBST, dilute the secondary antibody at a ratio of 1:5000, and incubate at room temperature for 1 hour.
[0145] 1.8.7 Exposure and Development
[0146] TBST was used for 3 washes. ECL developer was prepared at a 1:1 ratio and exposed using a chemiluminescence imaging system.
[0147] Western blot analysis showed that the overexpression efficiency of TRAFD1 in pancreatic cancer cells was relatively high in the TRAFD1 overexpression group. Figure 8 (Right image).
[0148] 1.9 Detection of TRAFD1 mRNA levels in pancreatic cancer cells after exogenous overexpression of TRAFD1
[0149] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by qPCR, and the specific steps are as follows:
[0150] 1.9.1 RNA Extraction
[0151] (1) KPC-OVA-Vector and KPC-OVA-TRAFD1 pancreatic cancer cells were seeded into 6-well plates, and 2 mL of culture medium was added to each well. The cells were cultured until the density reached 80%.
[0152] (2) The RNA extraction procedure is the same as 2.1 in Example 1.
[0153] 1.9.2 Reverse Transcription
[0154] The isolated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and procedure were the same as step 2.2 of Example 1.
[0155] 1.9.3 Real-time quantitative PCR
[0156] The primers, qPCR reaction system, and amplification procedure used are the same as steps 2.3 of Example 1.
[0157] The overexpression group showed a significant increase in TRAFD1 mRNA expression, proving the overexpression was successful. Figure 9 A).
[0158] Example 3: Construction of a stable KPC cell line overexpressing TRAFD1
[0159] 1. Construction of TRAFD1 overexpression vector
[0160] 1.1 Plasmid Design
[0161] A suitable vector, pLV3-CMV-MCS-3×FLAG-CopGFP-Puro, was selected and modified. The primer sequences used for the target fragment are as follows:
[0162] F1: CTGATACGAACTCG GAATTC GCCACCATGGCCGAGTTTCGAGATGACCAG,
[0163] R1: TGGTCTTTGTAGTC GGATCC CTCCTCTTCCTCCTCCGCATCGCCTG;
[0164] Note: Underlined sequences are homologous arms, bolded sequences are Kozak sequences, and underlined font indicates restriction enzyme sites. The upstream restriction enzyme site is EcoRI, and the downstream restriction enzyme site is BamHI.
[0165] 1.2 PCR reaction conditions
[0166] Synthesize the target gene and use I-5 TM PCR amplification was performed using 2×High-Fidelity Master Mix high-guarantee polymerase. The specific reaction system and conditions are shown in Table 5, and the amplification program is shown in Table 6.
[0167] 1.3 PCR product size and recovery
[0168] After PCR amplification of the target fragment, electrophoresis was performed on a 1% agarose gel, using a DNA marker as a reference to determine the size of the target gene fragment. The correct target bands were then cut and recovered into sterile 1.5 mL EP tubes. The DNA target fragment was recovered according to the instructions of the rapid agarose gel DNA recovery kit, following the specific steps outlined in the kit's instructions. The final purified target gene product was obtained. The 1% agarose gel electrophoresis results showed that the observed bands matched the expected positions, and the target fragment size was 1786 bp. Figure 10 As shown, this proves that the target fragment was successfully amplified by PCR.
[0169] 1.4 Enzyme digestion and recovery of the vector
[0170] In a sterile 0.2 mL EP reaction tube, the enzyme digestion vector pLV3-CMV-MCS-3×FLAG-CopGFP-Puro was performed, as shown in Table 7. The 1% agarose gel electrophoresis results showed that the observed bands were in the expected positions. The digestion of the vector pLV3-CMV-MCS-3×FLAG-CopGFP-Puro produced an 8278 bp band. Figure 11 As shown.
[0171] 1.5 Homologous recombination reaction
[0172] The target fragment (P1 fragment) recovered in Section 1.3 and the vector fragment recovered in Section 1.4 were linked in a reaction system with a ratio of vector fragment to target fragment of 3:1, as shown in Table 8.
[0173] Transformation of competent cells with ligation product: (1) Take DH5α competent cells out of the -80℃ freezer in advance and thaw them on ice; (2) Add the recombinant product in 4.1.5 to 100 μL of DH5α competent cells, gently rotate to mix, and incubate on ice for 30 min; (3) Heat shock in a 42℃ water bath for 45 s, and then immediately incubate on ice for 2 min; (4) Add 900 μL of antibiotic-free LB liquid medium, and revive at 37℃ and 180 rpm for 30 min; (5) After revival, centrifuge at 10000 rpm for 1 min, remove the supernatant, add 100 μL of fresh culture medium, gently mix, and spread evenly on LB plates containing Amp antibiotic (100 μg / mL), and place at room temperature until the liquid is absorbed; (6) Transfer the plate to a 37℃ biochemical incubator, invert it, and incubate overnight.
[0174] Colony PCR identification of positive transformants: Four single colonies from the constructed vector were selected for PCR identification, following the same steps as in Section 1.5 of Example 2. The 1% agarose gel electrophoresis results showed that the observed bands were in the expected positions, and the identified products were 433 bp in size. Figure 12 As shown, this proves that the colony contains the target fragment.
[0175] 1.6 Plasmid identification and sequencing
[0176] Single clones (at least 2) that meet the target fragment size are inoculated into LB liquid medium containing 1‰ Amp resistance and cultured overnight. Plasmids are extracted, following the same steps as in Example 2.
[0177] The sequencing results of the TRAFD1 sequence in the recombinant plasmid are shown below. Sequence alignment confirms that the recombinant plasmid constructed in this invention is correct.
[0178] TRAFD1 sequence: atggccgagtt tcgagatgac caggcttcta ggctgtgtga caactgcaagaaggaaattc ctgtatttaa ttttaccatc catgaaatcc actgtcaaag gaacattggt gtgtgccctgtctgcaagga accgttcccc aaatctgaca tggacattcacatggctgca gagcactgtc aggtgacctgtaaatgcaac aagaagttgg agaagaggca gttaaagcag catgcggagacagagtgtcc cctgcggctcgccgtctgcc agcactgtga tctggagctt tctgttgtca agttgaagga gcatgaggattactgtggagcccggacaga gctgtgtggc agctgtgggc gcaacgtgct tgtgaaggag ctgaagactcaccccgaagt ctgtgggagagtggaggagg aaaagagaac ggaggctgcc atccctccgg aggcttacgacgagccctgg agtcaggaca gaatctggatcgcatcccag ctcctcagac aaatcgaggc tctggacccgcccatgaggc tccctggaag gcccctgcaa gcctttgaggcagacccctt ctacagtagg actaccagccagaggagcat ggcagcccag tttccagttc aaaataatct ttttgaagaa caagaaaggcaggaaaggaacagaagccgg cagtccccaa aggacagcgc tgagaataac gcacacttgg acttcatgttggccttgagtctgcagaatg agggacaggc caccagcatg gtagagcagg gcttctggga gtctgtgcctgaggctgatc cggctcgtgctgggcccaca tctctaggtg acataaaggg tgctgctgac gagattctgctgccgtgtga gttctgtgag gagctgtacc cagaggaactgctcattgaccatcagacaa gctgcaacccttctcatgcc ttacgttcac tcaatacggg cagctcttcc atcaggggtg tggaagatcctggtaccatcttccagaact ttctacaaca agcaacaagt aaccagtttg acactttaat gggcctgagc agttcagctgctgtggaagacagcatcatc atcccctgtg agttctgtgg ggtgcagctg gaagaggagg tgctgttctaccatcaggac cagtgtgaccaacgcccagc cacagcaaac caccgtgcag tggagggcat cccagcccaggattcgcagc cagaaaacac ttcagcagagctgtccagga ggcgggtcaa acaccaggga gacctgtcatctggttacat ggatgatgtc aagccggaat cagtgaaaggccccacctac tcgatgtctc ctaacaggaccatgaacaat gtggcttcct gcaaccgact gttgaactta ccgtcagggc ccaggtctgactgccagcgtagccctcccg gtgtgctgaa actcaacaac tctgatagcc aggacatccg tgggcagatgcggggcagccagaatgggcc catagcatcc gggcacgctc cagtgatcca ctctattcaa aatctctatccagaaaactt tgcgccctct tttcctcatggatcccctgg gaggtacgga gctgg.
[0179] 2. Viral infection of pancreatic cancer cells
[0180] 2.1 Lentiviral Packaging
[0181] Transfection was performed when the HEK293T cell density in a 10cm culture dish reached approximately 90%. The specific steps are as follows:
[0182] (1) Based on the amount of transfection reagent required for each dish of cells, take 60 μL of liposome transfection reagent and 1.5 mL of Opti-MEM into centrifuge tube A, mix gently, and let stand at room temperature for 5 min.
[0183] (2) Take 15 μg of the target gene plasmid, 10 μg of psPAX2 plasmid, 5 μg of pMD2.G plasmid and 1.5 mL of Opti-MEM and mix them evenly in centrifuge tube B;
[0184] (3) Add the solution from step (1) to the plasmid mixture solution from step (2) and incubate at room temperature for 20 min;
[0185] (4) Discard the old culture medium in the culture dish, add 12 mL of fresh culture medium, and slowly add the transfection complex from step (3) into the culture medium;
[0186] (5) 48 h after transfection, the cell culture medium was collected, filtered through a 0.45 μm microporous membrane, dispensed into 2 mL aliquots, and the virus titer was measured before freezing at -80 °C.
[0187] 2.2 Viral infection of KPC cells
[0188] (1) Seed the cells to be infected into 6-well plates, add complete culture medium and culture until the cell confluence reaches 30-40% and start transfection.
[0189] (2) Remove the culture medium, add 1 mL of fresh culture medium and 2.4 μL of polybrene (10 μg / μL) to each well, then add 2 mL of the lentivirus solution obtained above, mix gently, and incubate for 48 h. Then add 3 μg / mL puromycin to select cells. After 72 h, obtain the stable TRAFD1-expressing cell line KPC-TRAFD1-OE and the control cell line KPC-Vector.
[0190] 2.3 Detection of TRAFD1 protein levels in pancreatic cancer cells after stable overexpression of TRAFD1
[0191] The overexpression efficiency of TRAFD1 in KPC cells was detected by Western blot, and the specific steps are as follows:
[0192] 2.3.1 Protein Sample Extraction and Preparation
[0193] (1) The pancreatic cancer cells obtained in step 2.2 were seeded into 6-well plates, and 2 mL of culture medium was added to each well. The cells were cultured until the density reached 80%.
[0194] (2) Protein sample extraction and preparation are the same as in Example 2, section 1.8.1.
[0195] 2.3.2. BCA protein quantification, electrophoresis, membrane transfer, blocking, antibody incubation, and exposure development are the same as steps 1.8 in Example 2;
[0196] Western blot analysis showed that the overexpression efficiency of TRAFD1 in pancreatic cancer cells was relatively high in the TRAFD1 overexpression group. Figure 8 (Left image).
[0197] 2.4. Detection of TRAFD1 mRNA levels in pancreatic cancer cells after exogenous overexpression of TRAFD1
[0198] The overexpression efficiency of TRAFD1 in KPC-OVA cells was detected by qPCR, and the specific steps are as follows:
[0199] 1.9.1 RNA Extraction
[0200] (1) The pancreatic cancer cells obtained in step 2.2 were seeded into 6-well plates, and 2 mL of culture medium was added to each well. The cells were cultured until the density reached 80%.
[0201] (2) The RNA extraction procedure is the same as 2.1 in Example 1.
[0202] 1.9.2 Reverse Transcription
[0203] The isolated RNA was reversibly transcribed into cDNA using a reverse transcription kit. The reverse transcription system and procedure were the same as step 2.2 of Example 1.
[0204] 1.9.3 Real-time quantitative PCR
[0205] The primers, qPCR reaction system, and amplification procedure used were the same as in step 2.3 of Example 1; the TRAFD1 mRNA expression in the TRAFD1 overexpression group was significantly increased, proving that the overexpression was successful. Figure 9 B).
[0206] Example 4: Activation and cytotoxic function of CD8+ T cells co-cultured with cells overexpressing TRAFD1 in vitro.
[0207] I. Isolation of CD8+ T cells from the spleen of OT-1 mice: (1) Sterilize surgical instruments, pipette tips, centrifuge tubes, etc. by autoclaving; (2) Sacrifice OT-1 mice and disinfect them by immersing them in alcohol. In a laminar flow hood, open the abdominal cavity of the mouse, remove the spleen, place it in a petri dish, grind the mouse spleen with a 20 mL syringe stopper, rinse the cell sieve with pre-cooled PBS, collect the filtrate, centrifuge at 400 g for 5 min, and discard the supernatant; (3) Resuspend the spleen cells in 2 mL of red blood cell lysis buffer, lyse at room temperature for 5 min, add 10 mL of PBS, centrifuge at 400 g for 5 min, and discard the supernatant; (4) Filter again through a 70 μm filter, collect the filtrate into a 50 mL centrifuge tube, filter again through a 40 μm filter, collect the filtrate, centrifuge at 400 g for 5 min, add PBS to resuspend, and count; (5) Transfer 500 μL of cell suspension (5 × 10⁻⁶ cells) to a centrifuge tube.7 (6) Add 100 μL of washed TBD-Streptavidin to the bottom of the EP tube, mix well, and incubate at 4°C for 10 min. Add 1 mL of PBS, mix by pipetting up and down 5 times, place the sorting flow cytometer containing cells on a magnetic rack, and let stand for 5 min. (7) Transfer the supernatant to a new EP tube and centrifuge at 400g for 5 min. (8) Discard the supernatant after centrifugation and collect the cells. Store the obtained cells in a 37°C incubator containing 5% CO2 for later use. The culture medium is RPMI 1640 containing 10% FBS, 500 μM β-mercaptoethanol, 10 mM HEPES, 1% penicillin and streptomycin, and IL-2 (50 U / mL). At the same time, the obtained OT-1 mouse CD8+ T cells are treated with Dynabeads. TM Mouse T-Activator CD3 / CD28 activation.
[0208] II. Flow cytometry verification that co-culturing KPC-OVA cell line overexpressing TRAFD1 with CD8+ T cells in vitro promotes CD8+ T cell activation
[0209] KPC-OVA tumor cells were transfected with the TRAFD1 transient overexpression plasmid for 48 h, and then the pretreated cells were co-cultured with OT-IT cells at a ratio of 1:2.5 for 24 h. After 24 h, the expression of GZMB and IFNG in CD8+ T cells was detected. This invention uses flow cytometry to detect the expression of GZMB and IFNG; the specific steps are as follows:
[0210] (1) Collect cell culture supernatant from different groups, centrifuge at 400g for 5min to collect cell pellet, wash cells twice with PBS, and finally resuspend cells in 100μL PBS.
[0211] (2) Add PE-anti-CD8 antibody and FITC-anti-CD3 antibody to the flow cytometer and incubate on ice for 30 min;
[0212] (3) Add 1 mL of LFOxp3 fixation / permeabilization working solution to each tube and vortex. Incubate at 4°C or room temperature in the dark for 30-60 min. Add 2 mL of 1X permeabilization buffer to each tube. Centrifuge the sample at 300-400 g for 5 min at room temperature and discard the supernatant.
[0213] (4) Resuspend the cells in 100 μL of 1X permeabilization buffer.
[0214] (5) Add APC / Cyanine7-anti-GZMB antibody and BV605-anti-IFNG antibody, and incubate at room temperature in the dark for at least 30 minutes.
[0215] (6) Add 2 mL of 1X membrane rupture buffer to each tube. Centrifuge the sample at 300-400 g for 5 min at room temperature and discard the supernatant.
[0216] (7) Add 2 mL of 1X permeabilization buffer or flow cytometry staining buffer to each tube.
[0217] (8) Centrifuge the sample at 300-400g for 5 min at room temperature and discard the supernatant. Resuspend the stained cells with an appropriate amount of flow cytometry staining buffer and collect the sample on a flow cytometer.
[0218] The results are as follows Figure 13 As shown, Figure 13 The proportion of GZMB and IFNG positive cells after co-culturing CD8+ T cells and LLC cells in vitro was detected by flow cytometry. The results showed that, compared with the control group, the proportion of GZMB+CD8 T cells and IFNG+CD8 T cells was higher after co-culturing KPC-OVA cell line overexpressing TRAFD1 with CD8+ T cells.
[0219] III. Apoptosis Experiment Verification: Co-culturing CD8+ T cells with cells overexpressing TRAFD1 in vitro promotes CD8+ T cell killing function.
[0220] Experimental procedure: (1) KPC-OVA tumor cells were transfected with TRAFD1 transient overexpression plasmid for 48 h; (2) The two cell types were co-cultured at a ratio of CD8+ T cells / tumor cells of 2.5:1 for 48 h; (3) The supernatant was aspirated, and the cells were digested with trypsin without EDTA and centrifuged at 300 g at 4℃ for 5 min to collect the cells; (4) The cells were washed twice, each time centrifuged at 300 g at 4℃ for 5 min. 1×10 5 (5) Centrifuge, discard the supernatant, and resuspend the cells in 100 μL of 1× Binding Buffer. (6) Add 5 μL of Annexin V-FITC and 10 μL of PI Staining Solution, and mix gently. (7) Incubate in the dark at room temperature for 10-15 min. (8) Add 400 μL of 1× Binding Buffer, mix well, and place on ice. Detect the sample within 1 h using flow cytometry or fluorescence microscopy.
[0221] The results are as follows Figure 14 As shown, after co-culturing with OT-1CD8+ T cells, the proportion of apoptotic tumor cells in TRAFD1-overexpressing cells significantly increased.
[0222] Example 5: Effect of TRAFD1 overexpression combined with anti-PD-1 monoclonal antibody on subcutaneous tumors in mice
[0223] I. Establishment of a mouse subcutaneous tumor model
[0224] Six to eight-week-old wild-type C57 BL / 6J mice were used in each group. When the KPC stable transgenic line constructed in step 4 reached 70%-80% confluence, the mouse PDAC cells were washed, harvested, and resuspended in PBS. Approximately 2.5 × 10⁻⁶ cells were resuspended in 100 μL of PBS. 5 One cell was subcutaneously injected into the ventral side of C57 BL / 6 mice. One week after tumor implantation, the tumors were measured weekly, and the length and width of the tumors were recorded to plot tumor growth curves.
[0225] II. Effects of TRAFD1 overexpression combined with anti-PD-1 monoclonal antibody on subcutaneous tumors in mice
[0226] When the maximum tumor length reached approximately 5.0 mm, mice were randomly assigned to four different treatment groups: (i) KPC-Vector; (ii) KPC-Vector + anti-PD-1 monoclonal antibody; (iii) KPC-TRAFD1-OE; and (iv) KPC-TRAFD1-OE + anti-PD-1 monoclonal antibody. Figure 15 A. Mice were given intraperitoneal injections of anti-PD-1 monoclonal antibody (200 μg / mouse) every 2 days for 3 consecutive days. Tumors were harvested and weighed on day 16.
[0227] The results are as follows Figure 15 As shown in B and 15C, with the extension of time after injection, overexpression of TRAFD1 combined with anti-PD-1 monoclonal antibody significantly reduced the tumor growth rate.
[0228] Example 6: Detection of the activation rate of tumor-infiltrating CD8+ T cells after TRAFD1 overexpression
[0229] 1. Digestion of tumor tissue
[0230] (1) Tumor tissues from both the KPC-Vector and KPC-TRAFD1-OE groups were removed, placed in a petri dish, and minced to 0.1 mm using scissors. 3 Add to a culture medium containing DNAse I (0.2 mg / mL), type IV collagenase (1 mg / mL), and hyaluronidase (0.2 mg / mL), and circulate digest at 37°C for 1–2 hours.
[0231] (2) Collect the filtrate and filter it once with a 70μm filter screen. After collecting the filtrate, filter it once with a 40μm filter screen and centrifuge at 500g for 5min.
[0232] (3) Add 5 mL of red blood cell lysis buffer to resuspend the cells and lyse at room temperature for 10 min.
[0233] (4) Centrifuge at 500g for 5 min, then resuspend in PBS.
[0234] 2. Isolation of lymphocytes
[0235] (1) Slowly add the cell suspension and percoll at a volume ratio of 2:1 into a centrifuge tube pre-filled with percoll working solution and centrifuge at 20°C for 20 min.
[0236] (2) After density gradient sorting is completed, take the cells in the layers and count them.
[0237] 3. Flow cytometry staining and detection
[0238] (1) Prepare each flow cytometer tube to contain 1×10 6 100 μL of cell suspension containing each cell was used, with a single-staining tube for each antibody: anti-CD3-, anti-CD8-, anti-GZMB-PE-Cy7, and Zombie Aqua FixableViability.
[0239] (2) Staining: Stain with Zombie Aqua Fixable Viability for 15 min, add FACS buffer, and centrifuge at 300g for 5 min;
[0240] (3) Sealing: Add 0.5 μg TruStain fcX to each tube. TM (anti-mouse CD16 / 32) Antibody pre-incubates cells on ice for 10 min.
[0241] (4) Extracellular staining: Add fluorescently labeled primary antibodies (BV421-CD45, PE-anti-CD8 antibody, FITC-anti-CD3 antibody) to the prepared cell suspension. Incubate on ice in the dark for 30 min. Wash with FACS buffer at 300g for 5 min.
[0242] (5) Fixation and permeabilization: Fix and permeabilize the cell suspension according to the Thermofisher fixation and permeabilization kit. Add 1 mL of Foxp3 fixation / permeabilization working solution to each tube, vortex, and incubate at 4°C in the dark for 30-60 min. Add 2 mL of 1X permeabilization buffer to each tube, centrifuge the sample at 300-400 g for 5 min at room temperature, and discard the supernatant. Resuspend the cells in 100 μL of 1X permeabilization buffer.
[0243] (6) Add fluorescently labeled antibody APC / Cyanine7-anti-GZMB antibody to detect intracellular antigens and incubate at room temperature in the dark for at least 30 minutes.
[0244] (7) Add 2 mL of 1X membrane rupture buffer to each tube. Centrifuge the sample at 300-400 g for 5 min at room temperature and discard the supernatant.
[0245] (8) Add 2 mL of 1X permeabilization buffer or flow cytometry staining buffer to each tube. Centrifuge the samples at 300 g for 5 min at room temperature and discard the supernatant.
[0246] (9) Resuspend the stained cells with an appropriate amount of flow cytometry staining buffer and collect samples on a flow cytometer.
[0247] The results are as follows Figure 15 As shown in Figure D, CD8+ T cells in tumor tissues of TRAFD1-overexpressing mice exhibit higher activation levels.
[0248] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. The application of an anti-PD-1 monoclonal antibody combined with a functional product that promotes the expression of the TRAFD1 gene and its product in the preparation of a product for treating pancreatic cancer, characterized in that, The functional product is a recombinant plasmid overexpressing TRAFD1, or a recombinant cell.