Use of pabpc3 as a marker for assessing prognosis of metastatic ovarian cancer

Abstract

The application discloses a use of PABPC3 as a marker for evaluating prognosis of metastatic ovarian cancer, and belongs to the technical field of biological diagnosis and medicine. Specifically, the application obtains a significantly differentially expressed gene PABPC3 by screening differential genes in ovarian cancer in situ and metastatic ovarian cancer in a database and combining the differential genes related to the good or bad prognosis of ovarian cancer in a pan-cancer database. Then, the influence of the gene PABPC3 on the cell viability and migration ability of ovarian cancer cells and the like is explored through cell experiments and in-vivo experiments, and the feasibility of the marker in evaluating the prognosis of ovarian cancer is confirmed. Meanwhile, it is also found that knocking down the expression of the gene PABPC3 can inhibit the metastasis of cancer cells. Therefore, the application provides a new strategy for detecting and treating metastasis of ovarian cancer, and is expected to overcome the defects of traditional detection and treatment methods, and provide a new choice for clinic.

Description

Technical Field

[0001] This invention relates to the use of PABPC3 as a biomarker for assessing the prognosis of metastatic ovarian cancer, and belongs to the fields of biodiagnostics and pharmaceutical technology. Background Technology

[0002] Ovarian cancer is one of the deadliest malignant tumors affecting women. Its persistently high mortality rate is largely due to the aggressive metastatic nature of the disease, leading to most patients being diagnosed at an advanced stage. The challenges of tumor metastasis and drug resistance complicate treatment and significantly reduce survival rates. Therefore, there is an urgent need for diagnostic indicators that can assess the effectiveness of chemotherapy in metastatic ovarian cancer and predict patient prognosis.

[0003] Poly(A)-binding proteins (PABPs) are a family of conserved proteins found in yeast and humans. They are multifunctional protein regulators involved in various aspects of mRNA homeostasis, including polyadenylation, nonsense-mediated decay (NMD), stress response, mRNA translation initiation control, and mRNA quality monitoring, playing a crucial role in promoting translation initiation. Poly(A)-binding protein cytoplasmic 3 (PABPC3, also known as tPABP, poly(A)-binding protein cytoplasmic 3) is a polynucleotide-binding protein found in the cytoplasm. Current research indicates that PABPC3 is expressed in spermatids and round spermatids during spermatogenesis, and its expression levels vary in different types of non-obstructive azoospermia (NOA), suggesting it as a potential biomarker for NOA. There are also reports that PABPC3 can promote the proliferation and migration of osteosarcoma, but its role in ovarian cancer has not yet been reported. Summary of the Invention

[0004] To address the aforementioned issues, this invention compares differentially expressed genes between primary and metastatic ovarian cancer in a database, as well as genes related to prognosis. The intersection of these genes yields the significantly differentially expressed gene PABPC3. Knockout and overexpression of this gene confirm its impact on cell healing and migration. In vivo experiments demonstrate that PABPC3 is highly expressed in ovarian cancer, especially in metastatic lesions. Higher PABPC3 levels are associated with poorer prognosis, promoting tumor progression and significantly affecting tumor cell invasiveness and drug resistance. This confirms that PABPC3 can serve as a prognostic indicator for ovarian cancer.

[0005] The first objective of this invention is to provide the use of the PABPC3 gene as a biomarker for assessing the prognosis of ovarian cancer. In other words, the use of the PABPC3 gene in the preparation of products for assessing the prognosis of ovarian cancer.

[0006] Furthermore, the prognosis includes the risk of ovarian cancer metastasis and / or chemotherapy resistance.

[0007] A second objective of this invention is to provide a kit for assessing the prognosis of ovarian cancer, the kit being capable of detecting the expression level of the PABPC3 gene.

[0008] Furthermore, the kit contains substances essential for quantifying the PABPC3 gene; preferably, the substances essential for quantifying the PABPC3 gene include primers for amplifying the PABPC3 gene.

[0009] Furthermore, the detection steps include:

[0010] S1. Extract genomic DNA from the sample to be tested and quantify the PABPC3 gene therein;

[0011] S2. Determine the prognosis of ovarian cancer based on the expression level of the PABPC3 gene.

[0012] A third objective of this invention is to provide the application of primers for amplifying the PABPC3 gene in the preparation of kits for assessing the prognosis of ovarian cancer.

[0013] A fourth objective of this invention is to provide the use of a substance that inhibits PABPC3 gene expression in the preparation of ovarian cancer treatment drugs.

[0014] Furthermore, substances that inhibit PABPC3 gene expression include, but are not limited to, siRNA, shRNA, and lentiviruses.

[0015] Furthermore, the ovarian cancer treatment drug is used to prevent or treat ovarian cancer metastasis and / or improve drug resistance developed during ovarian cancer treatment.

[0016] A fifth object of the present invention is to provide a composition for treating ovarian cancer, comprising a substance that inhibits the expression of the PABPC3 gene; optionally, it further comprises a pharmaceutically acceptable carrier.

[0017] Furthermore, the composition is a pharmaceutical composition.

[0018] Furthermore, the pharmaceutical composition also contains pharmaceutically usable excipients.

[0019] Furthermore, the excipients include one or more of the following: fillers, excipients, stabilizers, diluents, binders, disintegrants, lubricants, flow aids, wetting agents, effervescent agents, colorants, sweeteners, flavorings, preservatives, dispersants, film-forming agents, plasticizers, pore-forming agents, light-blocking agents, retardants, and solvents.

[0020] Furthermore, the composition comprises 0.1-100% of the active ingredient (a substance that inhibits PABPC3 gene expression) and 99.9-0% of excipients.

[0021] The beneficial effects of this invention are:

[0022] Currently, there are no clearly effective biomarkers for ovarian cancer metastasis used in clinical practice. This invention, through extensive screening, discovered a new detection index—PABPC3. PABPC3 is used as an indicator of chemotherapy resistance and prognosis in metastatic ovarian cancer, thereby characterizing the patient's chemotherapy resistance and potential prognostic issues. This allows clinicians to adopt personalized or different chemotherapy regimens to reduce the likelihood of chemotherapy resistance and improve patient survival. Furthermore, this invention also found that knocking out PABPC3 in cancer cells reduces its expression level, which can decrease the healing ability of cancer cells and inhibit their migration. This suggests potential for its application in ovarian cancer treatment and makes it a strong candidate for therapeutic drugs. Attached Figure Description

[0023] Figure 1 These are differentially expressed genes identified through single-cell sequencing of ovarian cancer samples combined with pan-cancer data from the TCGA database.

[0024] Figure 2 To analyze the differences in survival rates among patients with different PABPC3 expression levels.

[0025] Figure 3-4 To reduce the effect of PABPC3 on ovarian cancer cell migration in the SKOV3 ovarian cancer cell line.

[0026] Figure 5-6 To investigate the effect of PABPC3 gene overexpression on ovarian cancer cell migration in the ID8 ovarian cancer cell line.

[0027] Figure 7 To assess the migration ability of ovarian cancer cell lines overexpressing PABPC3 in mice.

[0028] Figure 8 The results show the cell viability of ovarian cancer cells with different expression levels of ID8 after chemotherapy treatment.

[0029] Figure 9 To investigate the difference in the activity of ID8 cells in ovarian cancer cells overexpressing PABPC3 after treatment with different chemotherapy drugs.

[0030] Figure 10 To assess the survival of ovarian cancer patients after chemotherapy using cases from a public database.

[0031] Figure 11To analyze the relationship between PABPC3 expression levels and prognosis in clinically derived ovarian cancer metastatic samples. Detailed Implementation

[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0033] The solution involved in this invention is as follows:

[0034] Currently, treatment for ovarian cancer mainly includes surgery, chemotherapy, and targeted therapy. Surgery is usually the first-line treatment, aiming to remove as much of the tumor as possible, especially for early-stage patients, where a total hysterectomy and bilateral salpingo-oophorectomy may achieve a cure. Postoperative recurrence and metastasis of ovarian cancer are among the main factors contributing to the high mortality rate. Although surgery can remove the tumor to a certain extent, many patients still face the risk of recurrence after surgery. For advanced or recurrent ovarian cancer, cytoreductive surgery is usually performed to reduce the tumor burden, combined with chemotherapy, especially regimens based on platinum-based chemotherapy drugs (such as cisplatin and carboplatin).

[0035] Ovarian cancer recurrence typically manifests as distant metastasis, particularly to the liver, abdominal cavity, and lymph nodes. Because ovarian cancer symptoms are often subtle in the early stages, many patients are already in advanced stages when obvious symptoms appear, significantly reducing treatment effectiveness. The metastatic mechanisms of ovarian cancer are complex, primarily occurring through peritoneal dissemination, lymphatic metastasis, and hematogenous metastasis. During metastasis, tumor cells interact with the surrounding tumor microenvironment, promoting cell migration and invasion. Furthermore, metastatic ovarian cancer often develops resistance to chemotherapy, resulting in limited treatment efficacy, and survival rates significantly decrease after recurrence. Due to the widespread spread of the tumor and the development of drug resistance, patients with advanced ovarian cancer often face low survival rates.

[0036] Existing research on the metastatic mechanisms of ovarian cancer largely focuses on the initial stages of tumor development, while the gene changes, intercellular interactions, and dynamic changes in the tumor microenvironment during metastasis remain poorly understood. In particular, systematic research and in-depth exploration of biomarkers are lacking regarding gene expression, epigenetic changes, and immune escape mechanisms in metastatic lesions. Currently, clinical diagnostic methods for ovarian cancer metastasis mainly include imaging examinations, tumor marker detection, and tissue biopsy. Imaging examinations primarily include CT scans, MRI, and ultrasound, used to assess tumor size, location, and peritoneal metastasis. However, in occult metastatic types such as peritoneal metastasis, this can easily lead to missed or misdiagnosis. Furthermore, due to the high heterogeneity of ovarian cancer, tissue biopsy may not fully reflect the complexity of metastasis, resulting in inaccurate identification of metastatic lesions. Therefore, there is an urgent need for a biomarker that can characterize chemotherapy resistance and potential prognostic issues in these patients, prompting clinicians to adopt personalized or different chemotherapy regimens to reduce the likelihood of chemotherapy resistance and improve patient survival.

[0037] Based on the above problems, in this invention:

[0038] Differentially expressed genes (PABPC3) were identified in metastatic ovarian cancer through single-cell sequencing of ovarian cancer samples combined with pan-cancer data from the TCGA database. Survival analysis revealed that ovarian cancer patients with high PABPC3 expression had lower survival rates. PABPC3 was knocked down in the SKOV3 ovarian cancer cell line, and Transwell and scratch assays were performed to verify that low PABPC3 expression restricted ovarian cancer cell migration. Conversely, overexpression of the PABPC3 gene promoted the migration of ovarian cancer cells in another ID8 cell line. Further validation in animal models showed that ovarian cancer cell lines overexpressing PABPC3 exhibited more significant migration ability in mice, with larger tumor areas in liver and lung tissues.

[0039] To investigate whether PABPC3 affects chemotherapy resistance in ovarian cancer, the CCK8 assay was used to detect the activity of ovarian cancer cells after treatment with chemotherapeutic drugs such as carboplatin, paclitaxel, and PRAP1 inhibitors. The results showed that ovarian cancer cells with high PABPC3 expression exhibited stronger drug resistance. Next, using ovarian cancer patient cases from a public database, we assessed their survival after chemotherapy. We found that after treatment with drugs such as carboplatin and paclitaxel, higher PABPC3 levels in patients were associated with a worse prognosis. Furthermore, we performed PABPC3 histochemical staining on some clinically derived samples, dividing patients into high-expression and low-expression groups based on the PABPC3 levels in their tissues. The survival curves also showed significant differences, with patients exhibiting high PABPC3 expression having a worse prognosis.

[0040] In summary, this invention, through discovery-validation experiments, demonstrates the applicability of PABPC3 as a biomarker for assessing chemotherapy and prognosis in metastatic ovarian cancer. Specifically, it reveals that the level of PABPC3 in ovarian cancer significantly affects metastasis; high levels of PABPC3 promote the metastasis of ovarian cancer cells to other organs, while inhibiting PABPC3 levels significantly reduces the migration ability of ovarian cancer cell lines. In commonly used mouse models, cell lines highly expressing PABPC3 have been found to exhibit higher proliferative activity and migration ability. Treatment of ovarian cancer cell lines with chemotherapeutic drugs revealed higher drug resistance in cell lines highly expressing PABPC3. Immunohistochemical staining of clinically derived ovarian cancer tissues with PABPC3, dividing clinical cases into high-expression and low-expression groups, demonstrates that patients with high PABPC3 expression have worse prognoses and survival, indicating that PABPC3 can indeed serve as a novel indicator for the assessment and diagnosis of metastatic ovarian cancer and has promising clinical application prospects.

[0041] Therefore, PABPC3 can be used as an indicator to assess the metastatic characteristics and prognosis of ovarian cancer. Higher levels of PABPC3 in patients indicate a higher risk of metastasis and chemotherapy resistance. Clinically, appropriate preventive and treatment measures can be taken for patients with high PABPC3 expression levels.

[0042] This invention provides the use of the PABPC3 gene as a biomarker for assessing the prognosis of ovarian cancer.

[0043] Preferably, the prognosis includes the risk of ovarian cancer metastasis or chemotherapy resistance.

[0044] Based on the above findings, the present invention provides a kit for assessing the prognosis of ovarian cancer, the kit being able to detect the expression level of the PABPC3 gene.

[0045] Preferably, the kit contains substances essential for quantifying the PABPC3 gene, such as primers for amplifying the PABPC3 gene.

[0046] Preferably, the detection steps include, but are not limited to:

[0047] S1. Extract genomic DNA from the sample and quantify the PABPC3 gene within it;

[0048] S2. Determine the prognosis of ovarian cancer based on the expression level of the PABPC3 gene.

[0049] Preferably, the quantification method includes, but is not limited to, real-time quantitative PCR (qPCR).

[0050] Preferably, the kit or primers of the present invention can detect the PABPC3 gene in different species as needed, preferably human, with the human PABPC3 gene ID: 5042. If the kit or primers of the present invention need to be used to detect other target species, those skilled in the art can find sequences homologous to the genes listed in the present invention in the target species and set primers according to conventional methods to achieve detection.

[0051] This invention also provides the application of substances that inhibit PABPC3 gene expression in the preparation of ovarian cancer treatment drugs.

[0052] Preferably, the substance that inhibits PABPC3 gene expression includes, but is not limited to, siRNA, shRNA, lentivirus, etc. More preferably, the substance targets and reduces the expression of the PABPC3 gene in tumor cells.

[0053] Preferably, the ovarian cancer treatment drug is used to prevent or treat ovarian cancer metastasis and / or improve drug resistance developed during ovarian cancer treatment.

[0054] The present invention also provides a composition for treating ovarian cancer. Preferably, the composition is a pharmaceutical composition containing the aforementioned substance that inhibits PABPC3 gene expression, and may also contain other active ingredients, as well as a pharmaceutically acceptable carrier. Typically, these substances are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is typically about 5-8, preferably about 6-8, and the pH value may vary depending on the properties of the formulated substances, which can be adjusted as needed by a skilled technician. The formulated pharmaceutical composition can be administered via conventional routes, including (but not limited to): intratumoral, intravenous, or local administration.

[0055] The pharmaceutical compositions of the present invention contain a safe and effective amount (e.g., 0.001-99 wt%, preferably 0.01-90 wt%, more preferably 0.1-80 wt%) of the aforementioned substance of the present invention that inhibits PABPC3 gene expression, and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): fillers, excipients, stabilizers, diluents, binders, lubricants, surfactants, or combinations thereof. The pharmaceutical formulation should be matched to the route of administration. The pharmaceutical compositions of the present invention can be formulated into injectable forms, for example, prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other excipients. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount. Furthermore, the peptides of the present invention can also be used with other therapeutic agents.

[0056] When using a drug combination, a safe and effective amount of the drug is administered to an individual. The specific dosage should also take into account factors such as the route of administration and the patient's health condition, all of which are within the scope of a skilled physician's expertise.

[0057] Example 1: Screening of differentially expressed genes

[0058] To investigate changes in gene expression levels after ovarian cancer metastasis, single-cell data from ovarian cancer were classified and grouped. Epithelial cell populations were selected for further analysis, divided into orthotopic and metastatic groups. Differentially expressed genes were screened using bioinformatics analysis, resulting in 4348 genes. Simultaneously, TCGA pan-cancer data analysis was used to identify genes with significant prognostic differences, yielding 323 differentially expressed genes. The genes at the intersection of these two groups were then sorted according to p-value. The results showed that PABPC3 was the most significantly differentially expressed gene, ranking first. Figure 1 By analyzing the expression levels of the PABPC3 gene, ovarian cancer patients in the TCGA database were divided into two groups for survival analysis. The results showed that patients with higher PABPC3 expression had a worse prognosis. Figure 2 This suggests that PABPC3 may be a target gene that can affect patient prognosis.

[0059] Example 2: PABPC3 knockdown slows down the migration of ovarian cancer cells.

[0060] Analysis was performed using the human ovarian cancer cell line SKOV3. First, PABPC3 gene expression was knocked down using siRNA technology to reduce the level of PABPC3 in the cell line. SKOV3 cells were seeded in six-well plates and cultured to 30-40% confluence before siRNA transfection. The siRNA solutions used for transfection were siPABPC3#1 (sequence: GCGTATGTGAACTTCCAGCAT) and siPABPC3#2 (sequence: GCCACTAAAGCAGTTACAGAA). Using Lipofectamine 2000 transfection reagent, the siRNA and transfection reagent were mixed in Opti-MEM serum-free medium and incubated for 15 minutes to form a transfection complex. This complex was then added to the cells, and the cells were cultured for another 24 hours. After 24 hours, the medium was replaced with complete medium containing 10% fetal bovine serum (FBS), and the cells were cultured for another 48 hours. Transfection efficiency was verified by real-time quantitative PCR (RT-qPCR), confirming the reduction in PABPC3 gene expression levels.

[0061] Next, the effect of PABPC3 knockdown on cell migration was assessed using a Transwell migration assay. Transfected SKOV3 cells (PABPC3 knockdown group and control group) were resuspended in serum-free McCoy's 5A medium, and 1 × 10⁴ cells were seeded per well into the upper chamber of a 24-well Transwell chamber (Corning, 3422). 600 μL of McCoy's 5A medium containing 10% FBS was added to the lower chamber as a chemokine to promote cell migration. The chambers were incubated for 42 hours, during which time cells were allowed to migrate to the lower layer. After incubation, the upper layer of medium was discarded, and the chambers were washed three times with PBS. Cells were then fixed with 75% ethanol for 10 minutes and stained with crystal violet for 5 minutes. Finally, unmigrated cells in the upper layer were removed with a moistened cotton swab, and the number of cells that migrated to the lower layer was counted in five random fields under a microscope. To further verify the effect of PABPC3 on cell migration, a scratch assay was performed. An appropriate amount of SKOV3 cells was seeded into 12-well plates, just enough to cover the entire bottom of the culture dish. After cell attachment, serum-free medium was added, and a scratch was gently made in each well using a pipette tip, creating a clearly defined scratch area. Wound healing was observed at 0, 24, and 48 hours after scratching. At each time point, images of the wound-healing area were taken using a microscope, and the degree of wound closure was recorded. The results showed that knocking down PABPC3 significantly reduced the cell's wound-healing ability. Figure 3 This indicates a significant reduction in cell migration ability. Figure 4 These two experiments demonstrate that knocking down PABPC3 significantly weakens the migration ability of SKOV3 cells, reduces the number of migrating cells, and decreases wound healing ability, further proving the important role of PABPC3 in the migration of ovarian cancer cells.

[0062] Example 3: Overexpression of PABPC3 can promote the migration of ovarian cancer cells.

[0063] Analysis was performed using the murine ovarian cancer cell line ID8. First, the PABPC3 plasmid (PABPC3 being human, Gene ID: 5042) was transfected into the ID8 cell line via lentiviral transfection to achieve PABPC3 overexpression. HEK293T cells were packaged using a lentiviral vector containing the PABPC3 gene, and the viral supernatant was collected and transfected into ID8 cells. When the cell density reached 30-40%, viral fluid was added for transfection. Forty-eight hours later, ID8 cell lines stably overexpressing PABPC3 were selected using puromycin, and the overexpression effect was verified by Western blot.

[0064] Next, the effect of PABPC3 overexpression on the migration ability of ID8 cells was evaluated using a Transwell migration assay. ID8 cells overexpressing PABPC3 and control cells (untransfected or transfected with empty vector) were resuspended in serum-free DMEM medium, and 1 × 10⁴ cells were seeded per well into the upper chamber of a 24-well Transwell chamber (Corning, 3422). 600 μL of medium containing 10% FBS was added to the lower chamber. The chambers were incubated for 30 hours. After incubation, the supernatant was discarded, and the chambers were washed three times with PBS. Cells were then fixed with 75% ethanol for 10 minutes and stained with crystal violet for 5 minutes. Five random fields of view were selected under a microscope, and the number of cells that migrated to the lower chamber was counted. Furthermore, a scratch assay was used to further verify the effect of PABPC3 overexpression on cell migration. An appropriate amount of ID8 cells was seeded into a six-well plate, covering the entire bottom of the culture dish. After cell adhesion, the medium was replaced with serum-free DMEM, and a clear scratch was made in each well using a pipette tip. Wound healing was observed at 0, 4.5, 9, and 13.5 hours. At each time point, images of the wound-healing area were taken under a microscope, and the degree of wound closure was recorded. Results showed that overexpression of PABPC3 significantly enhanced wound healing ability. Figure 5 This indicates that overexpression of PABPC3 promotes the migration ability of ID8 cells. Furthermore, overexpression of PABPC3 significantly enhanced the migration ability of ID8 cells and increased the number of migrating cells. Figure 6 The improved wound healing ability further demonstrates the promoting effect of PABPC3 on the migration of ovarian cancer cells.

[0065] Example 4: Overexpression of PABPC3 can promote ovarian cancer development in vivo.

[0066] A tumor metastasis model was established using nude mice. First, luciferase-labeled ID8 cells and ID8 cell lines overexpressing PABPC3 were injected intraperitoneally into nude mice to establish an ovarian cancer metastasis model. ID8 cells overexpressing PABPC3 and control ID8 cells (untransfected or empty vector-transfected cells) were injected intraperitoneally into nude mice, with 5 × 10⁶ cells injected into each mouse, and mice were randomly divided into groups (n = 6 mice / group). Luciferase activity was measured on days 12, 22, and 29 post-injection. Before each measurement, mice were injected with luciferin (Meilunbio, MB1834-2), and fluorescence images were captured using an IVIS imaging system (Perkin Elmer, IVIS Lumina XR III) to assess luciferase activity. Regular measurements of luciferase activity showed that the luciferase activity in the PABPC3-overexpressing group increased significantly over time, while the fluorescence intensity in the control group increased only slowly. This indicates that ID8 cells overexpressing PABPC3 have a stronger metastatic ability and faster metastasis rate in mice. On day 29, mice were sacrificed and various organs were removed for tumor counting. Particular attention was paid to liver tissue, and histological analysis was performed using H&E staining. Staining results showed that the group overexpressing PABPC3 had larger tumor areas in the liver and more significant tumor metastasis. Figure 7 These results indicate that overexpression of PABPC3 significantly enhances the metastatic ability of ovarian cancer cells in vivo.

[0067] Example 5: Overexpression of PABPC3 can increase chemotherapy resistance in ovarian cancer cells.

[0068] To investigate the effect of PABPC3 on chemotherapy resistance in ovarian cancer cells, we treated ID8 cells and ID8 cell lines overexpressing PABPC3 with commonly used first-line chemotherapy drugs carboplatin and paclitaxel, as well as olaparib, a PARP inhibitor widely used in ovarian cancer treatment in recent years. ID8 cells overexpressing PABPC3 and control ID8 cells were seeded in 96-well plates, and different concentrations of the drug were applied when the cells reached 70-80% confluence. The drug concentration gradients were carboplatin (0, 10, 20, 50 μg / mL), paclitaxel (0, 0.01, 0.02, 0.05 μg / mL), and olaparib (0, 10, 20, 50 μM). All cell groups were cultured in the presence of the drug for 24 hours, then replaced with normal culture medium and cultured until day 4. Cell viability after drug treatment was assessed using the CCK8 assay. The specific procedure involved adding CCK8 reagent (New Semiconductor, C6005) 24 hours and 4 days after drug treatment, and incubating at 37°C for 1 hour. The absorbance (OD value) of each well was then measured at 450 nm using a microplate reader, and the cell viability of each group was calculated. On day 4, 24 hours after treatment, the cell viability of the PABPC3 overexpression group was significantly higher than that of the control group, indicating that PABPC3 overexpression significantly enhanced cell survival. Figure 8 Furthermore, within 48 hours of different drug treatments, ID8 cells overexpressing PABPC3 showed higher cell viability in the paclitaxel, carboplatin, and olaparib treatment groups, especially at higher drug doses, where the difference in viability was particularly pronounced. Figure 9 Compared with the control group, cells overexpressing PABPC3 showed stronger drug resistance, further demonstrating the important role of PABPC3 in chemotherapy resistance of ovarian cancer cells.

[0069] Example 6: The impact of PABPC3 levels on prognosis in clinical patients

[0070] To further investigate the role of PABPC3 in clinical prognosis, we analyzed overall survival data of chemotherapy patients based on PABPC3 levels. Using a sample of ovarian cancer patients from our database, we found that patients with high PABPC3 expression had significantly shorter overall survival regardless of whether they received carboplatin, docetaxel, or a combination of carboplatin and paclitaxel. Figure 10 ).

[0071] Furthermore, to further validate our findings, we established a cohort of 66 patients with metastatic ovarian cancer. Immunohistochemical staining was performed on tissues from metastatic lesions of clinical patients (clinical samples were obtained from ovarian cancer patients at the First Affiliated Hospital of Soochow University) to investigate the expression level of PABPC3 in the tissues. During tissue sectioning, standard paraffin embedding and sectioning techniques were first employed, followed by immunohistochemical staining using an anti-PABPC3 antibody. Samples were grouped according to PABPC3 expression (low PABPC3 and high PABPC3), and progression-free survival was analyzed. Results showed that compared to the low PABPC3 expression group, the high PABPC3 expression group had a significantly shorter progression-free survival. Figure 11 This further demonstrates the important role of PABPC3 in ovarian cancer metastasis and suggests its potential as a prognostic indicator for poor ovarian cancer.

[0072] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of a substance that inhibits PABPC3 gene expression in the preparation of drugs for treating ovarian cancer, characterized in that, The substance that inhibits PABPC3 gene expression is siRNA, and the siRNA sequence is GCGTATGTGAACTTCCAGCAT or GCCACTAAAGCAGTTACAGAA.

2. The application according to claim 1, characterized in that, The ovarian cancer treatment drug also contains a pharmaceutically acceptable carrier.

Images