A pre-miR-21 post-transcriptional processing splicing inhibitor and its preparation method and application

Abstract

The present invention belongs to the field of biomedicine, and discloses a pre-miR-21 post-transcriptional processing shearing inhibitor, a preparation method and an application thereof. The pre-miR-21 post-transcriptional processing shearing inhibitor is a benzimidazole derivative having a structure shown in the following formula I. The pre-miR-21 post-transcriptional processing shearing inhibitor can bind to pre-miR-21 in vitro and in vivo and inhibit the shearing of its post-transcriptional processing, thereby silencing, modifying and / or improving the expression of miR-21, and ultimately achieving the inhibition of the growth of human breast cancer cells MDA-MB-231 in vivo; the pre-miR-21 post-transcriptional processing shearing inhibitor has good stability, is easy to store, has low cost, and has good anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a pre-miR-21 post-transcriptional processing shearing inhibitor and a preparation method and application thereof. The pre-miR-21 post-transcriptional processing shearing inhibitor is a benzimidazole derivative. Background Art

[0002] In addition to encoding and assembling proteins, RNA is also involved in countless cellular activities. Only 1-2% of the human genome encodes proteins, but about 80% of it is transcribed into RNA. Although most transcribed RNA is non-coding, many non-coding RNAs are functionally involved in regulating cellular activities and disease states. These functional non-coding RNAs are potential therapeutic targets for related diseases.

[0003] Currently, the approach to targeting RNA is to use oligonucleotide compounds that preferentially target unstructured regions, and therefore, the development of therapeutic approaches targeting RNA has focused primarily on the use of oligonucleotides. However, RNA structure has been shown to play a key role in important biological processes and disease states. Since RNA biology is often mediated by the structures it forms, targeting structured RNA may be a potential strategy to address related issues. However, little is known about the interactions between structured RNA and small molecule compounds, which has led to the belief that targeting structured RNA with small molecule compounds is not feasible. However, in recent years, a large number of studies have shown that small molecules have been studied for targeting the three-dimensional structure of the ribosome, ribosomal switches, certain viral RNAs, and repeat expansion of nucleotides, and small molecules are fully capable of targeting RNA.

[0004] One class of structured RNAs that play a role in disease biology is noncoding microRNAs (miRs). They are generated from highly structured precursors. The precursor of pre-miR-21 (pri-miR-21) is processed stepwise in the nucleus by Drosha to pre-miR-21, which is then processed by Dicer in the cytoplasm to produce mature miR-21, which is loaded into the RNA-induced silencing complex (RISC) to regulate gene expression. Many miRs play important roles in human disease biology. For example, studies have shown that miR-21 expression is negatively correlated with the survival of patients with triple-negative breast cancer and is expressed in solid tumors.

[0005] The treatment of major diseases such as tumors, ALS, and Alport syndrome (AS) through the regulation of post-transcriptional processing such as miRNA is a hot frontier in the field of biomedicine at home and abroad at this stage. At present, the methods for downregulating the expression level of miRNA mainly include chemically synthesized oligonucleotides (ASO) and constructing vectors. Chemically synthesized oligonucleotides use antisense miRNA to block the activity of specific miRNAs. For vectors, it is mainly to construct plasmids or viral systems to express siRNAs that are complementary to the stem-loop structure of miRNA precursors. However, these methods are currently mostly in the laboratory stage because of their high prices and cannot be truly used in clinical treatment. Therefore, the development of new means to downregulate miRNA levels has become an extremely urgent research field. Summary of the invention

[0006] In order to solve the shortcomings and deficiencies of the prior art methods for downregulating miR-21, which are expensive and not truly applied in clinical practice, the primary purpose of the present invention is to provide a pre-miR-21 post-transcriptional processing splicing inhibitor; the post-transcriptional processing splicing inhibitor can bind to pre-miR-21 in vitro and in vivo and inhibit its post-transcriptional processing splicing, thereby silencing, modifying and / or improving the expression of miR-21, and ultimately inhibiting the growth of human breast cancer cells MDA-MB-231 in vivo; the pre-miR-21 post-transcriptional processing splicing inhibitor has good stability, is easy to store, has low cost, and has good anti-tumor effect.

[0007] Another object of the present invention is to provide a method for preparing the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0008] Another object of the present invention is to provide the use of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor in the preparation of anti-tumor drugs.

[0009] Another object of the present invention is to provide an anti-tumor drug containing the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A pre-miR-21 post-transcriptional processing splicing inhibitor, wherein the pre-miR-21 post-transcriptional processing splicing inhibitor is a benzimidazole derivative having a structure shown in the following formula I:

[0012] ;

[0013] R1 is an amine substituent; R2, R3, R4, R5, R7, R8, R9, R 10are fluorine, chlorine, bromine, alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl or an amine substituent; R6 is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl; n is 0, 1, 2 or 3.

[0014] Preferably, R2, R3, R4, R5, R7, R8, R9, R 10 They are alkyl, hydrogen, amino, nitro, methoxy, trifluoromethyl or amine substituents respectively; R6 is hydrogen, alkyl or substituted alkyl; n is 0, 1 or 2.

[0015] More preferably, R2, R3, R4, R5, R7, R8, R9, R 10 are alkyl, hydrogen, methoxy, trifluoromethyl or amine substituents; R6 is hydrogen or alkyl; n is 0 or 1.

[0016] More preferably, R2, R3, R4, R5, R7, R8, R9, R 10 are alkyl, hydrogen or amine substituents respectively; R6 is hydrogen; n is 0.

[0017] The pre-miR-21 post-transcriptional processing cleavage inhibitor is more preferably a compound having the following structures shown in Formula II-IV, respectively named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-(Diethylamino)ethyl)quinazoline-2,4-diamine, N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-Morpholinoethyl)quinazoline-2,4-diamine and N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(3-(Dimethylamino)propyl)quinazoline-2,4-diamine;

[0018] ;

[0019] The preparation method of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor is carried out according to the following steps:

[0020] (1) Using substituted o-aminoarylcarboxylic acid as the starting material, it is reacted with urea at high temperature to obtain intermediate 1;

[0021] (2) Intermediate 1 reacts with a chlorinating agent to obtain intermediate 2;

[0022] (3) Intermediate 2 undergoes nucleophilic substitution reaction with an amine substituent under alkaline conditions to obtain intermediate 3;

[0023] (4) Intermediate 3 reacts with a substituted benzimidazole under acidic conditions to obtain a final product, a pre-miR-21 post-transcriptional processing splicing inhibitor; or intermediate 3 reacts with a substituted benzimidazole under nitrogen protection and catalyzed by a palladium catalyst under alkaline conditions to obtain a final product, a pre-miR-21 post-transcriptional processing splicing inhibitor.

[0024] The structure of the substituted o-aminoarylcarboxylic acid is shown in Formula V, the structure of the intermediate 1 is shown in Formula VI, the structure of the intermediate 2 is shown in Formula VII, and the structure of the intermediate 3 is shown in Formula VIII:

[0025] ;

[0026] Wherein, R1, R2, R3, R4 and R5 are as defined above.

[0027] The reaction equation for preparing the splicing inhibitor of pre-miR-21 post-transcriptional processing is as follows:

[0028] .

[0029] Among them, n, R1, R2, R3, R4, R5, R6, R7, R8, R9, R 10 As defined above.

[0030] In the step (1), the reaction temperature is 150°C to 300°C, preferably 180°C to 220°C; the reaction time is 12h to 72h, preferably 16h to 24h;

[0031] In the step (2), the reaction temperature is 130°C to 220°C, preferably 150°C to 180°C; the reaction time is 6h to 24h, preferably 8h to 12h; the solvent used in the reaction is acetonitrile, acetone, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methyl pyrrolidone or N,N-dimethylacetamide, preferably N,N-dimethylformamide; the chlorination agent is thionyl chloride, phosphorus oxychloride, phosphorus trichloride or phosphorus pentachloride, preferably phosphorus oxychloride;

[0032] In the step (3), the reaction temperature is 80°C to 160°C, preferably 90°C to 120°C; the reaction time is 1h to 8h, preferably 2h to 4h; the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methyl pyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butanol or isopropanol, preferably ethanol; the base used in the alkaline condition is potassium carbonate, sodium carbonate, sodium bicarbonate, cesium carbonate, potassium acetate, triethylamine, diethylamine, N,N-diisopropylethylamine, pyridine or potassium hydroxide, preferably N,N-diisopropylethylamine;

[0033] In the step (4), the reaction temperature is 80°C to 160°C, preferably 90°C to 120°C; the reaction time is 4h-24h, preferably 8h-12h; the solvent used in the reaction is dichloromethane, chloroform, acetone, acetonitrile, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide, N,N-dimethylformamide, methyl pyrrolidone, N,N-dimethylacetamide, methanol, ethanol, tert-butanol or isopropanol, preferably isopropanol; the acid used in the acidic condition is hydrochloric acid, hydrobromic acid, hydroiodic acid, dilute sulfuric acid or a saturated solution of an acidic gas, and a saturated solution of an acidic gas includes a saturated ethyl acetate solution of hydrogen chloride, a saturated solution of hydrogen chloride, and a saturated solution of hydrogen iodide. A saturated methanol solution of hydrogen or a saturated 1,4-dioxane solution of hydrogen chloride, preferably a saturated 1,4-dioxane solution of hydrogen chloride; the palladium catalyst is palladium acetate, bis(dibenzylideneacetone)palladium, tetrakistriphenylphosphine palladium, [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium or methanesulfonic acid (9,9-dimethyl-4,5-bisdiphenylphosphinoxanthene) (2'-amino-1,1'-biphenyl-2-yl)palladium (II), preferably palladium acetate; the base used in the alkaline condition is potassium acetate, potassium carbonate, sodium carbonate, sodium bicarbonate, sodium hydride, potassium tert-butoxide, sodium tert-butoxide, cesium carbonate, sodium methoxide or sodium ethoxide, preferably cesium carbonate.

[0034] The application of the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor in the preparation of an anti-tumor drug, wherein the anti-tumor drug is a drug for triple-negative breast cancer.

[0035] An anti-tumor drug comprising the above-mentioned pre-miR-21 post-transcriptional processing splicing inhibitor.

[0036] The anti-tumor drug can be prepared into tablets, capsules, injections and other preparations.

[0037] Compared with the prior art, the present invention has the following advantages and effects:

[0038] (1) The present invention focuses on triple-negative breast cancer associated with the expression level of miR-21, and obtains compounds with the structure shown in general formula I. The obtained compounds have not been reported in the literature and are novel in structure.

[0039] (2) There are almost no other pre-miR-21 small molecule inhibitors in the prior art, while the compounds involved in the present invention have a strong inhibitory effect on the splicing of pre-miRNA 21 post-transcriptional processing, and can be used to treat tumors caused by overexpression of miR-21 or other diseases related to abnormal expression of miR-21; specifically, the pre-miR-21 post-transcriptional processing splicing inhibitor can bind to pre-miR-21 in vitro and in vivo and inhibit its post-transcriptional processing splicing, silence, modify and / or improve the expression of miR-21, and ultimately inhibit the growth of human breast cancer cells MDA-MB-231 in vivo.

[0040] (3) The compounds involved in the present invention have good stability, are easy to store, have low cost, and have good anti-tumor effects; the benzimidazole derivatives described in the present invention have novel structures and enrich the research on benzimidazole derivatives in the field of preparing anti-cancer drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 These are the results of in vitro TO-PRO-1 replacement experiments on some products of the present invention.

[0042] Figure 2 The results are of the interaction between some products of the present invention and Pre-miR 21 in vitro.

[0043] Figure 3 The results show the effects of some products of the present invention on the expression of miR-21. DETAILED DESCRIPTION

[0044] The specific implementation of the present invention is further described in detail below in conjunction with the accompanying drawings and examples, but the implementation and protection of the present invention are not limited thereto. It should be pointed out that if there are processes that are not particularly described in detail below, they can be implemented or understood by those skilled in the art with reference to the prior art. The reagents or instruments used without indicating the manufacturer are deemed to be conventional products that can be purchased commercially. The nuclear magnetic resonance hydrogen spectrum of the compound was measured using a Bruker ARX-400; all reagents used were analytically pure or chemically pure.

[0045] The preparation method of the pre-miR-21 post-transcriptional processing splicing inhibitor described in the following Examples 1 to 18, the specific synthesis route is as follows:

[0046] ;

[0047] Among them, n, R1, R2, R3, R4, R5, R6, R7, R8, R9, R 10 As defined above.

[0048] Example 1

[0049] The preparation method of the pre-miR-21 post-transcriptional processing splicing inhibitor in this embodiment specifically comprises the following steps:

[0050] (1) Synthesis of 2,4-quinazolinedione

[0051] Add o-aminobenzoic acid (10 g, 0.073 mol) and urea (43.84 g, 0.73 mol) to an eggplant-shaped bottle, heat to co-melting, maintain the reaction for more than 12 h, and cool the reaction solution to room temperature; then add 200 mL of water to the reaction solution, stir for 0.5 h, adjust the pH to <4 with glacial acetic acid, and solid precipitate; then filter under reduced pressure, wash the filter cake with water three times, and dry the filter cake to obtain 2,4-quinazolinedione, which can be directly used in the next step without further purification, with a yield of 95%.

[0052] (2) Synthesis of 2,4-dichloroquinazoline

[0053] The 2,4-quinazolinedione (11.18 g, 0.069 mol) obtained in step (1) was dissolved in 100 mL of anhydrous N,N-dimethylformamide, and phosphorus oxychloride (32.16 mL, 0.35 mol) was slowly added under ice bath conditions, and the mixture was refluxed for 8 h. According to TLC detection, the reaction of the raw materials was complete, and the reaction solution was poured into 1 L of ice water, where solids precipitated. The mixture was then filtered under reduced pressure, and the filter cake was washed with water three times. The filter cake was dried to obtain 2,4-dichloroquinazoline, which was directly used in the next step without further purification, with a yield of 92%.

[0054] (3) N 1 -(2-Chloroquinazolin-4-yl)-N 2 ,N 2 -Synthesis of diethylethane-1,2-diamine

[0055] The 2,4-dichloroquinazoline (0.50 g, 2.53 mmol) obtained in step (2) was dissolved in 5 mL of anhydrous ethanol, and N,N-diisopropylethylamine (0.53 mL, 3.03 mmol) and N,N-diethylethylenediamine (391 μL, 2.78 mmol) were added in sequence. The mixture was reacted at 90°C for 1 h. After TLC detection, the reaction of the raw materials was completed. The mixture was cooled to room temperature, diluted with an excess of saturated sodium chloride solution, extracted with ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation to obtain N 1 -(2-Chloroquinazolin-4-yl)-N 2 ,N 2 -Diethylethane-1,2-diamine was used directly in the next step without further purification, with a yield of 79%.

[0056] (4) N 2 -(1H-benzo[d]imidazol-2-yl)-N 4Synthesis of -(2-(Diethylamino)ethyl)quinazoline-2,4-diamine

[0057] The N obtained in step (3) 1 -(2-Chloroquinazolin-4-yl)-N 2 ,N 2 -Diethylethane-1,2-diamine (100 mg, 0.36 mmol) and 2-aminobenzimidazole (119.83 mg, 0.90 mmol) were dissolved in 5 mL of isopropanol, and 0.2 mL of a catalytic amount of 1,4-dioxane saturated hydrogen chloride solution was added; the reaction was carried out at 100°C for 12 h. After the reaction was completed by TLC detection, the reaction solution was cooled to room temperature, the solvent was removed by vortexing, and then purified by column chromatography, with the developing solvent being a mixture of dichloromethane and methanol in a volume ratio of 50:1, and the product pre-miR-21 post-transcriptional processing splicing inhibitor was finally obtained with a yield of 42%. The structural characterization data of the product are: 1HNMR (400 MHz, DMSO-d6) δ 8.73 (t, J = 5.7 Hz, 1H), 8.46 (dd, J = 8.1, 1.2 Hz,1H), 8.25 (dd, J = 8.1, 1.1 Hz, 1H), 8.03 (s, 1H), 7.47 (ddd, J = 8.2, 5.7,2.5 Hz, 1H), 7.20 (dd, J = 7.8, 1.2 Hz, 1H), 7.09 (td, J = 7.5, 1.2 Hz, 1H),6.98 – 6.92 (m, 1H), 3.75 (dt, J = 8.2, 6.0 Hz, 2H), 2.80 – 2.74 (m, 2H),2.57 (q, J = 7.1 Hz, 4H), 0.96 (t, J = 7.1 Hz, 6H)._ HRMS (ESI, m / z) calcdfor C21H26N7 [M+H]+, 376.2244; found 376.4819.

[0058] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-(Diethylamino)ethyl)quinazoline-2,4-diamine:

[0059] .

[0060] Example 2

[0061] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by N-(2-aminoethyl)morpholine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 43%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 8.48 (d, J = 8.2 Hz,1H), 8.02 (d, J = 8.3 Hz, 1H), 7.76 – 7.70 (m, 1H), 7.68 (d, J = 8.5 Hz, 1H),7.45 – 7.39 (m, 1H), 7.25 (d, J = 7.9 Hz, 1H), 7.17 – 7.12 (m, 1H), 7.06 –6.99 (m, 1H), 3.82 (t, J = 7.0 Hz, 2H), 3.74 – 3.69 (m, 4H), 2.76 (t, J = 7.0Hz, 2H), 2.61 – 2.54 (m, 4H)._ HRMS (ESI, m / z) calcd for C21H24N7 O[M+H]+,390.2037; found 390.2135.

[0062] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-Morpholinoethyl)quinazoline-2,4-diamine:

[0063] .

[0064] Example 3

[0065] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-(3-aminopropyl)-4-methylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 3%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 8.48 (dd, J = 8.1,1.2 Hz, 1H), 8.02 (dd, J = 8.2, 1.3 Hz, 1H), 7.77 – 7.72 (m, 1H), 7.70 (dd, J= 8.5, 1.5 Hz, 1H), 7.43 (ddd, J = 8.2, 6.6, 1.6 Hz, 1H), 7.25 (dd, J = 7.8,1.2 Hz, 1H), 7.14 (td, J = 7.6, 1.2 Hz, 1H), 7.05 (td, J = 7.7, 1.3 Hz, 1H),3.70 – 3.61 (m, 1H). 2H), 2.51 (dt, J = 5.6, 2.5 Hz, 2H), 2.66 – 2.37 (m, 8H), 2.30 – 2.25 (m, 3H), 1.98 – 1.86 (m, 2H)._ HRMS (ESI, m / z) calcd for C23H29N8[M+H]+, 417.2510; found 417.5336.

[0066] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(3-(4-methylpiperazin-1-yl)propyl)quinazoline-2,4-diamine:

[0067] .

[0068] Example 4

[0069] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-cyclopropylcarbonylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 21%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 8.48 (d, J = 8.2 Hz,1H), 8.02 (d, J = 8.3 Hz, 1H), 7.76 – 7.70 (m, 1H), 7.68 (d, J = 8.5 Hz, 1H),7.45 – 7.39 (m, 1H), 7.25 (d, J = 7.9 Hz, 1H), 7.17 – 7.12 (m, 1H), 7.06 –6.99 (m, 1H), 4.08 – 4.00 (m, 4H), 4.00 – 3.94 (m, 2H), 3.81 (t, J = 5.2 Hz,2H), 2.00 (tt, J = 7.9, 4.7 Hz, 1H), 0.95 – 0.90 (m, 2H), 0.87 (dt, J = 8.0,3.0 Hz, 2H)._ HRMS (ESI, m / z) calcd for C23H24N7 O[M+H]+, 414.2037; found414.5637.

[0070] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named (4-(2-((1H-benzo[d]imidazol-2-yl)amino)quinazolin-4-yl)piperazin-1-yl)(cyclopropyl)methanone:

[0071] .

[0072] Example 5

[0073] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-methylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 20%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 8.24 (d, J = 7.9 Hz, 1H), 7.75(d, J = 8.1 Hz, 1H), 7.62 – 7.56 (m, 2H), 7.29 (ddd, J = 8.2, 5.8, 2.4 Hz,1H), 7.18 (d, J = 7.7 Hz, 1H), 7.07 (t, J = 7.5 Hz, 1H), 6.96 (t, J = 7.7 Hz,1H), 3.74 (q, J = 6.6, 5.0 Hz, 4H), 2.61 (t, J = 4.9 Hz, 4H), 2.35 (d, J =3.7 Hz, 3H)._ HRMS (ESI, m / z) calcd for C20H22N7 [M+H]+, 360.1931; found360.9179.

[0074] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(1H-benzo[d]imidazol-2-yl)-4-(4-methylpiperazin-1-yl)quinazolin-2-amine:

[0075] .

[0076] Example 6

[0077] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by N,N-dimethyl-1,3-propylenediamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 13%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 8.48 (dd, J = 8.1,1.2 Hz, 1H), 8.02 (dd, J = 8.2, 1.3 Hz, 1H), 7.77 – 7.72 (m, 1H), 7.70 (dd, J= 8.5, 1.5 Hz, 1H), 7.43 (ddd, J = 8.2, 6.6, 1.6 Hz, 1H), 7.25 (dd, J = 7.8,1.2 Hz, 1H), 7.14 (td, J = 7.6, 1.2 Hz, 1H), 7.05 (td, J = 7.7, 1.3 Hz, 1H),3.72 (t, J = 7.1 Hz, 2H), 2.66 – 2.60 (m, 2H), 2.36 (s, 6H), 2.03 (p, J = 7.3Hz, 2H)._ HRMS (ESI, m / z) calcd for C20H24N7 [M+H]+, 362.2088; found362.5773.

[0078] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(3-(Dimethylamino)propyl)quinazoline-2,4-diamine:

[0079] .

[0080] Example 7

[0081] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 4-methyl-1-piperazineethylamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 12%. The structural characterization data of the product are: 1H NMR (400 MHz, DMSO-d6) δ 8.73 (t, J = 5.7 Hz, 1H), 8.46 (dd, J = 8.1, 1.2 Hz, 1H), 8.25 (dd, J = 8.1, 1.1 Hz, 1H), 8.03 (s, 1H),7.47 (ddd, J = 8.2, 5.7, 2.5 Hz, 1H), 7.20 (dd, J = 7.8, 1.2 Hz, 1H), 7.09(td, J = 7.5, 1.2 Hz, 1H), 6.98 – 6.92 (m, 1H), 3.81 (t, J = 6.4 Hz, 2H),2.95 – 2.77 (m, 8H), 2.76 (s, 2H), 2.54 (s, 3H)._ HRMS (ESI, m / z) calcd forC22H27N8 [M+H]+, 403.2353; found 403.1464.

[0082] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2- (1H-Benzo[d]imidazol-2-yl)-N 4 -(2-(4-methylpiperazin-1-yl)ethyl)quinazoline-2,4-diamine:

[0083] .

[0084] Example 8

[0085] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 4-pyridinemethylamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 20%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 8.55 – 8.45 (m, 2H), 8.43 (dd, J = 8.1, 1.2 Hz, 1H), 8.02 (dd, J = 8.2, 1.3 Hz, 1H), 7.77 – 7.72 (m, 1H),7.70 (dd, J = 8.5, 1.5 Hz, 1H), 7.51 – 7.44 (m, 2H), 7.43 (ddd, J = 8.2, 6.6,1.6 Hz, 1H), 7.25 (dd, J = 7.8, 1.2 Hz, 1H), 7.14 (td, J = 7.6, 1.2 Hz, 1H),7.05 (td, J = 7.7, 1.3 Hz, 1H), 4.73 (s, 2H). _ HRMS (ESI, m / z) calcd forC21H18N7 [M+H]+, 368.1618; found 368.1564.

[0086] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(1H-benzo[d]imidazol-2-yl)-N 4 -(2-(Diethylamino)ethyl)quinazoline-2,4-diamine:

[0087] .

[0088] Example 9

[0089] The other steps were the same as those in Example 1, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-cyclopropylmethylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 8%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 8.34 (d, J = 8.0 Hz, 1H),7.89 (d, J = 8.3 Hz, 1H), 7.71 (d, J = 4.3 Hz, 2H), 7.40 (dt, J = 8.4, 4.1Hz, 1H), 7.22 (t, J = 7.2 Hz, 1H), 7.16 – 7.10 (m, 1H), 7.03 (t, J = 7.7 Hz,1H), 3.88 (t, J = 4.8 Hz, 4H), 2.90 (t, J = 4.8 Hz, 4H), 2.47 (d, J = 6.7 Hz,2H), 0.99 – 0.94 (m, 1H), 0.65 – 0.57 (m, 2H), 0.27 – 0.18 (m, 2H). _ HRMS(ESI, m / z) calcd for C23H26N7 [M+H]+, 400.2244; found 400.2214.

[0090] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(1H-benzo[d]imidazol-2-yl)-4-(4-(cyclopropylmethyl)piperazin-1-yl)quinazolin-2-amine:

[0091] .

[0092] Example 10

[0093] The other steps were the same as those in Example 1, except that the 2-aminobenzimidazole raw material in step (4) was replaced by 2-(1H-benzo[d]imidazol-2-yl)ethylamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 9%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J =8.3, 1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1,3.2 Hz, 2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2Hz, 2H), 3.95 (t, J = 6.6 Hz, 2H), 3.75 (dt, J = 8.2, 6.0 Hz, 2H),3.22 (t, J= 6.6 Hz, 2H), 2.80 – 2.74 (m, 2H), 2.57 (q, J = 7.1 Hz, 4H), 0.96 (t, J =7.1 Hz, 6H)._ HRMS (ESI, m / z) calcd for C23H30N7 [M+H]+, 404.2557; found404.5492.

[0094] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl)-N 4 -(2-(Diethylamino)ethyl)quinazoline-2,4-diamine:

[0095] , .

[0096] Embodiment 11

[0097] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by N-(2-aminoethyl)morpholine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 12%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J = 8.3,1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1, 3.2 Hz,2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2 Hz, 2H),4.02 (t, J = 6.6 Hz, 2H), 3.75 (t, J = 6.8 Hz, 2H), 3.66 – 3.60 (m, 4H), 3.26 (t, J = 6.6 Hz, 2H), 2.67 (t, J = 6.8 Hz, 2H), 2.51 (t, J = 4.6 Hz, 4H)._HRMS (ESI, m / z) calcd for C23H28N7O[M+H]+, 418.2350; found 418.5497.

[0098] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl)-N 4 -(2-Morpholinoethyl)quinazoline-2,4-diamine:

[0099] .

[0100] Example 12

[0101] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-(3-aminopropyl)-4-methylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 19%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J =8.3, 1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1,3.2 Hz, 2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2Hz, 2H), 3.95 (t, J = 6.6 Hz, 2H), 3.70 – 3.61 (m, 2H),3.22 (t, J = 6.6 Hz,2H),2.51 (dt, J = 5.6, 2.5 Hz, 2H), 2.66 – 2.37 (m, 8H), 2.30 – 2.25 (m, 3H),1.98 – 1.86 (m, 2H). _ HRMS (ESI, m / z) calcd for C25H33N8 [M+H]+, 445.2823; found 445.8834.

[0102] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl)-N 4 -(3-(4-methylpiperazin-1-yl)propyl)quinazoline-2,4-diamine:

[0103] .

[0104] Example 13

[0105] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-cyclopropylcarbonylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 34%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 7.78 (dd, J = 8.3,1.4 Hz, 1H), 7.58 (ddd, J = 8.4, 6.9, 1.4 Hz, 1H), 7.44 (dd, J = 6.0, 3.1 Hz,2H), 7.42 – 7.35 (m, 1H), 7.20 – 7.16 (m, 2H), 7.15 – 7.11 (m, 1H), 3.95 (t,J = 6.6 Hz, 2H), 3.89 (d, J = 5.2 Hz, 2H), 3.71 (d, J = 5.2 Hz, 4H), 3.63 (d,J = 5.7 Hz, 2H), 3.22 (t, J = 6.6 Hz, 2H), 1.97 (ddt, J = 6.5, 4.9, 2.5 Hz,1H), 0.92 (dt, J = 5.3, 2.7 Hz, 2H), 0.85 (td, J = 5.1, 2.6 Hz, 2H)._ HRMS(ESI, m / z) calcd for C25H28N7O[M+H]+, 442.2350; found 442.3460.

[0106] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named (4-(2-(2-(1H-benzo[d]imidazol-2-yl)ethyl)amino)quinazolin-4-yl)piperazin-1-yl)(cyclopropyl)methanone:

[0107] .

[0108] Embodiment 14

[0109] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-methylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 16%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J = 8.3, 1.3 Hz,1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1, 3.2 Hz, 2H),7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2 Hz, 2H), 3.95(t, J = 6.6 Hz, 2H), 3.74 (q, J = 6.6, 5.0 Hz, 4H),3.22 (t, J = 6.6 Hz, 2H),2.84 (t, J = 6.8 Hz, 2H). 4.9 Hz, 4H), 2.35 (d, J = 3.7 Hz, 3H)._ HRMS (ESI, m / z) calcdfor C22H26N7 [M+H]+, 388.2244; found 388.4579.

[0110] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(2-(1H-benzo[d]imidazol-2-yl)ethyl)-4-(4-methylpiperazin-1-yl)quinazolin-2-amine:

[0111] .

[0112] Embodiment 15

[0113] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced with N,N-dimethyl-1,3-propylenediamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 22%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J = 8.3,1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1, 3.2 Hz,2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2 Hz, 2H),3.95 (t, J = 6.6 Hz, 2H), 3.72 (t, J = 7.1 Hz, 2H),3.22 (t, J = 6.6 Hz, 2H),2.66 – 2.60 (m, 2H), 2.36 (s, 6H), 2.03 (p, J = 7.3 Hz, 2H)._ HRMS (ESI, m / z)calcd for C22H28N7 [M+H]+, 390.2401; found 390.9408.

[0114] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl)-N 4 -(3-(Dimethylamino)propyl)quinazoline-2,4-diamine:

[0115] .

[0116] Example 16

[0117] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 4-methyl-1-piperazineethylamine in an equal molar ratio, and the final product, a splicing inhibitor of post-transcriptional processing of pre-miR-21, was obtained with a yield of 28%. The structural characterization data of the product are: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J = 8.3,1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1, 3.2 Hz,2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2 Hz, 2H),3.95 (t, J = 6.6 Hz, 2H), 3.81 (t, J = 6.4 Hz, 2H), 3.22 (t, J = 6.6 Hz, 2H),2.95 – 2.77 (m, 8H), 2.76 (s, 2H), 2.54 (s, 3H)._ HRMS (ESI, m / z) calcd forC24H31N8 [M+H]+, 431.2666; found 431.7320.

[0118] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl ester)-N 4 -(2-(4-methylpiperazin-1-yl)ethyl)quinazoline-2,4-diamine:

[0119] .

[0120] Embodiment 17

[0121] The other steps are the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) is replaced by 4-pyridinemethylamine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, is obtained with a yield of 8%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 8.55 – 8.45 (m, 2H), 7.97 (dd, J = 8.3, 1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.51 – 7.44 (m,2H), 7.41 (dd, J = 6.1, 3.2 Hz, 2H), 7.38 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H),7.19 (dd, J = 6.1, 3.2 Hz, 2H), 4.73 (s, 2H),3.95 (t, J = 6.6 Hz, 2H),3.22 (t, J = 6.6 Hz, 2H)._ HRMS (ESI, m / z) calcd for C23H22N7 [M+H]+, 396.1931; found 396.1233.

[0122] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N 2 -(2-(1H-benzo[d]imidazol-2-yl)ethyl)-N 4 -(Pyridin-4-ylmethyl)quinazoline-2,4-diamine:

[0123] .

[0124] Embodiment 18

[0125] The other steps were the same as those in Example 10, except that the N,N-diethylethylenediamine raw material in step (3) was replaced by 1-cyclopropylmethylpiperazine in an equal molar ratio, and the final product, a pre-miR-21 post-transcriptional processing splicing inhibitor, was obtained with a yield of 18%. The structural characterization data of the product are as follows: 1H NMR (400 MHz, Methanol-d4) δ 7.97 (dd, J = 8.3, 1.3 Hz, 1H), 7.72 (ddd, J = 8.4, 7.1, 1.3 Hz, 1H), 7.48 (dd, J = 6.1, 3.2 Hz,2H), 7.41 (s, 1H), 7.34 (t, J = 7.6 Hz, 1H), 7.19 (dd, J = 6.1, 3.2 Hz, 2H),3.95 (t, J = 6.6 Hz, 2H), 3.88 (t, J = 4.8 Hz, 4H),3.22 (t, J = 6.6 Hz, 2H),2.91 (t, J = 4.8 Hz, 2H). 4H), 2.47 (d, J = 6.7 Hz, 2H), 0.99 – 0.94 (m, 1H), 0.65– 0.57 (m, 2H), 0.27 – 0.18 (m, 2H)._ HRMS (ESI, m / z) calcd for C25H30N7 [M+H]+, 428.2557; found 428.7093.

[0126] The above structural characterization data can determine the structural formula of the product obtained in this example as follows, named N-(2-(1H-benzo[d]imidazol-2-yl)ethyl)-4-(4-(cyclopropylmethyl)piperazin-1-yl)quinazolin-2-amine:

[0127] .

[0128] Example 19: Study on the In vitro Pre-miR-21 Inhibitory Activity of Some Products of the Present Invention

[0129] Experimental instruments and materials:

[0130] Shanghai Lingguang Technology Co., Ltd. F98 fluorescence spectrophotometer, cuvette, Pre-miR-21, TO-PRO-1, Na2HPO4, NaCl, ethylenediaminetetraacetic acid (EDTA), HCl, DMSO.

[0131] Among them, Pre-miR-21 was purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequence is as follows:

[0132] UAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGU

[0133] Experimental methods:

[0134] Before screening, the EC of TO-PRO-1 to Pre-miR-21 was determined 50 :Pre-miR-21 was folded in SB1 (screening buffer 1, containing 8mM Na2HPO4, pH 7.0, 185mM NaCl, 0.1mM EDTA), placed at 95℃ for 2min, and then quickly cooled in an ice bath for 10min; then BSA was added to a final concentration of 40µg / mL to obtain SB2 (screening buffer 2). Pre-miR-21 was dropped into 100nM TO-PRO-1 prepared in SB2, and the fluorescence intensity was measured after each addition of Pre-miR-21 under the conditions of excitation wavelength of 485nm and emission wavelength of 535nm. The obtained curve was fitted to a single-site binding model. EC 50 The value is: 219±76nM.

[0135] EC binding to TO-PRO-1 50 The corresponding Pre-miR-21 concentration was used for the TO-PRO-1 displacement experiment. Pre-miR-21 was folded as described above. SB2 was first added to the cuvette and its fluorescence intensity was measured; then TO-PRO-1 was added to a final concentration of 100 nM and its fluorescence intensity was measured. BC ; Then add Pre-miR-21 to the cuvette to a final concentration of 220 nM, and measure its fluorescence intensity I NC ; Then, the pre-miR-21 post-transcriptional processing shear inhibitors obtained in Examples 1 to 18 above were added to the cuvettes to a final concentration of 100 μM, and the fluorescence intensity I was measured. The fluorescence intensity was measured using a F98 fluorescence spectrophotometer from Shanghai Lingguang Technology Co., Ltd., with an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The fluorescence change was normalized to a percentage response (% displacement rate) according to the following formula:

[0136]

[0137] Where I is the median fluorescence intensity of each sample, I NC is the median fluorescence intensity when no compound is added, I BC The median fluorescence intensity when only SB2 and TO-PRO-1 were added was shown. Each fluorescence intensity was tested 5 times.

[0138] The results of the in vitro TO-PRO-1 replacement experiment of the product of the present invention are as follows Figure 1 As shown, the test results show that the product obtained in Example 1 exhibits an excellent TO-PRO-1 replacement rate (80%), and the products obtained in Example 2 and Example 6 exhibit good TO-PRO-1 replacement rates, both of which are 75%. The higher TO-PRO-1 replacement rate indicates that the above compounds have the potential to have a strong binding effect with Pre-miR-21. In order to further determine their binding affinity with Pre-miR-21, the three compounds with a TO-PRO-1 replacement rate ≥ 75% (i.e., the products obtained in Example 1, Example 2, and Example 6) were selected for isothermal titration calorimetry experiments.

[0139] Example 20: Study on the in vitro Pre-miR-21 inhibitory activity of some products of the present invention

[0140] Experimental instruments and materials:

[0141] MicroCa PEAQ-ITC isothermal titration calorimeter, calorimeter cell, syringe, Pre-miR-21 SB1 (screening buffer 1; 8mM Na2HPO4, pH 7.0, 185mM NaCl, 0.1mM EDTA), Pre-miR-21, distilled water.

[0142] Among them, Pre-miR-21 was purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequence is shown in Example 19.

[0143] Experimental methods:

[0144] In this example, an isothermal titration calorimetry experiment was performed using a MicroCa PEAQ-ITC isothermal titration calorimeter at 25°C. The Pre-miR-21 to be titrated was diluted with Pre-miR-21 SB1 to a concentration of 10 μM and then loaded into the sample pool. The compounds obtained in Example 1, Example 2 and Example 6 were diluted to a concentration of 400 μM with Pre-miR-21 SB1 to obtain a sample solution, which was loaded into a syringe. Subsequently, the sample solution was added in 30 steps, with 1.2 μL added in each step (due to the long wait before the start of the experiment, the compound in the sample solution at the front end of the syringe was diluted to less than 400 μM, so only 0.4 μL of compound dilution was added in the first step). The MicroCa PEAQ-ITC analysis software was used to analyze the curve fitting and enzyme kinetic parameters, and the binding affinity of the compound to Pre-miR-21 was measured with the Kd value as an indicator, wherein the smaller the Kd value, the stronger the binding affinity of the compound to Pre-miR-21. .

[0145] The results of the interaction of the compound obtained by the present invention with Pre-miR 21 in vitro are as follows Figure 2As shown, the test results show that the compounds of the present invention have a certain binding affinity with Pre-miR-21, especially the compound obtained in Example 1 shows a good binding affinity with Pre-miR-21, with a Kd of 9.82 μM. The compounds obtained in Example 2 and Example 6 show a moderate binding affinity with Pre-miR-21, with Kd of 16.3 μM and 13.8 μM, respectively. The good binding affinity of the compounds with Pre-miR-21 indicates that they can potentially inhibit the shearing of the post-transcriptional processing of PremiR-21, thereby silencing, modifying and / or improving the expression of miR-21, and ultimately inhibiting the growth of human breast cancer cells MDA-MB-231 in vivo. In order to further determine whether the compounds with high binding affinity to Pre-miR-21 can interfere with the shearing of the post-transcriptional processing of Pre-miR-21, thereby downregulating the expression level of miR-21, qPCR experiments were performed on the above compounds.

[0146] Example 21: Study on the splicing inhibition activity of post-transcriptional processing of Pre-miR-21 of some products of the present invention

[0147] Experimental materials: MDA-MB-231 cells, 10 mM mother solution of the compound obtained in Example 1, 10 mM mother solution of the compound obtained in Example 2, 10 mM mother solution of the compound obtained in Example 6, miR-21 Fwd Primer, miR-21 Rev Primer, β-actin Fwd Primer, β-actin Rev Primer, DEPC water, etc.

[0148] Among them, the upstream and downstream primers of miR-21 and the upstream and downstream primers of the internal reference gene β-actin were purchased from Shanghai Jierui Bioengineering Co., Ltd., and the sequences are as follows:

[0149] miR-21 Fwd Primer: CCAGTGAAGATGTGTTCAGCT

[0150] miR-21 Rev Primer: GCACAGCCAGTAGAAGTAGAT

[0151] β-actin Fwd Primer:GCGAGAAGATGACCCAGATC

[0152] β-actin Rev Primer:GGATAGCACAGCCTGGATAG

[0153] Experimental methods:

[0154] MDA-MB-231 breast cancer cells were inoculated in two 6-well plates, with a cell number of about 500,000. After culturing for 24 hours in DMEM containing 10% FBS at a molar percentage, 10 mM of the mother solution of the compound obtained in Example 1, 10 mM of the mother solution of the compound obtained in Example 2, or 10 mM of the mother solution of the compound obtained in Example 6 were added to make the final concentrations 0, 2, and 4 μM, respectively. After culturing for 72 hours, total RNA was extracted from the cells using an RNA extraction kit, and reverse transcription was performed using AMV reverse transcriptase to obtain cDNA. qPCR was used to detect miR-21 expression. Specific method of qPCR:

[0155] 1. Prepare primers (the target gene primers include the upstream primer miR-21 Fwd Primer and the downstream primer miR-21Rev Primer, and the internal reference gene primers include the upstream primer β-actin Fwd Primer and the downstream primer β-actinRev Primer): use DNA stabilizer (DNA buffer or DEPC water) to prepare 100 μM storage solution, vortex to mix, and store at -20℃;

[0156] 2. Use DNA buffer to dilute the upstream and downstream primers to 5 μM (working solution).

[0157] 3. The volume of each well of qPCR is 10μL, including: 5μL enzyme and other reagent kit liquid, 1μL primer (including 0.5μL upstream primer + 0.5μL downstream primer), 2μL cDNA, 2μL DEPC water

[0158] 4. Prepare the solution. The universal solution can be prepared at one time:

[0159] Use a 200 μL ep tube to prepare a mix solution: DEPC water + primer + enzyme and other reagent kit solutions, vortex, centrifuge, and then place on an ice box;

[0160] 5. Design and preparation of cDNA concentration:

[0161] This time, the concentration of 50ng / well was selected for the experiment. Since the volume of cDNA in 10μL is 2μL, DEPC water needs to be used to prepare the concentration of 50ng÷2μL=25ng / μL. For example, the concentration of cDNA master solution after reverse transcription is 1000ng / 10μL, that is, 100ng / μL, so it needs to be diluted four times, that is, 30μL DEPC water + 10μL cDNA master solution. Vortex to ensure mixing, centrifuge, and then place on an ice box for sample loading;

[0162] 6. Add cDNA and mix solution to the qPCR plate. After adding samples, centrifuge at 2200 rpm for 1 min, transfer to the ice box and put it on the qPCR machine;

[0163] 7. After the reaction procedure is completed, the Ct value of each sample is obtained. The Ct value of the blank control group is used as the control, and the average Ct value of the blank control group is calculated. The Ct value of the fluorescence quantitative results of other experimental groups minus the Ct value of the blank control group is ΔCt. The ΔCt of the blank control group is used as the correction number to calculate the 2-ΔΔCt value, and the 2-ΔΔCt value is used as the relative expression amount of miR-21.

[0164] The results of the effects of some products of the present invention on the expression of miR-21 are as follows Figure 3 As shown, the test results show that the compounds obtained in Examples 1, 2, and 6 of the present invention can all downregulate the expression of miR-21. The results of the in vitro activity study of the above compounds binding to Pre-miR-21 show that the compounds obtained in Examples 1, 2, and 6 can bind to Pre-miR-21, thereby affecting the shearing of Pre-miR-21 post-transcriptional processing, thereby downregulating the expression of miR-21. In order to further determine whether the compounds can induce tumor cell apoptosis by downregulating the expression of miR-21, the compounds obtained in Examples 1, 2, and 6 above were subjected to CCK8 experiments to determine their inhibitory activity on MDA-MB-231 human breast cancer cells.

[0165] Example 22: Study on the inhibitory activity of some products of the present invention on MDA-MB-231 human breast cancer cells

[0166] Experimental Materials:

[0167] MDA-MB-231 cells, 96-well cell culture plates, CO2 incubator, pipette, microplate reader, CCK-8 kit, etc.

[0168] Experimental methods:

[0169] 1. Preparation of single cell suspension and counting

[0170] For MDA-MB-231 cells growing in suspension, first directly centrifuge to collect cells in the logarithmic growth phase. For cells growing on the wall, trypsin is used to digest them first, and then centrifuge to collect the cells. Subsequently, the collected cells are resuspended in serum-containing culture medium and counted using a hemocytometer. Finally, the cells are diluted to a concentration of 5,000 to 50,000 cells per ml to prepare a single cell suspension.

[0171] 2. Cell seeding

[0172] First, the single cell suspension needs to be evenly inoculated into each well of a 96-well cell culture plate, and 100 μL of the single cell suspension is added to each well. Six replicate wells are set for each concentration group.

[0173] 3. Dosing and incubation

[0174] First, place the 96-well cell culture plate in an incubator for pre-culture for about 12 hours (at 37°C and 5% carbon dioxide). Once the cells successfully attach and show good adhesion, the culture medium can be aspirated, and then the compounds obtained in Examples 1, 2, and 6 with a final concentration of 40 μM, 20 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.625 μM, 0.3125 μM, 0.15625 μM, and 0 μM are added to each well of the culture plate, and then put it back into the incubator for incubation for 72 hours.

[0175] IV. CCK8 Incubation

[0176] First, add 10 μL of CCK-8 solution to each well. After adding the reagent, gently shake the culture plate to ensure thorough mixing. Next, place the treated culture plate in the incubator and incubate for 1.5 hours.

[0177] 5. Determine the absorbance OD value

[0178] The absorbance value (OD value) at a wavelength of 450nm was measured using an ELISA instrument. The survival rate of MDA-MB-231 breast cancer cells or the inhibition rate of the compound on the growth of MDA-MB-231 breast cancer cells was calculated. The drug concentration (IC 50 Value). Survival rate (%) = OD of drug-treated well / OD of control well × 100%. Inhibition rate (%) = (OD of control well-OD of drug-treated well) / OD of control well × 100%. The experiment was repeated three times or more, and the average value and standard deviation were calculated.

[0179] The test results show that the compounds of the present invention have a certain inhibitory effect on the proliferation and growth of MDA-MB-231 breast cancer cells (Table 1), especially the compounds obtained in Example 1 and Example 6 show a good inhibitory effect on MDA-MB-231 breast cancer cells. 50 The compound obtained in Example 2 showed a moderate inhibitory effect on MDA-MB-231 breast cancer cells, IC 50 It is 11.94μM.

[0180] Table 1 Antitumor activity test results of some compounds

[0181]

[0182] The synthesis method of the present invention can efficiently and conveniently obtain various benzimidazole compounds. Therefore, the present invention can provide a convenient approach and a rich material basis for the discovery of lead compounds of anti-tumor drugs.

[0183] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A pre-miR-21 post-transcriptional processing splicing inhibitor, characterized in that: The pre-miR-21 post-transcriptional processing shear inhibitor is a compound having the structure shown in the following formula III-IV, respectively named N 2 -(1 H -benzo[d]imidazol-2-yl)- N 4 -(2-Morpholinoethyl)quinazoline-2,4-diamine and N 2 -(1 H -benzo[d]imidazol-2-yl)- N 4 -(3-(Dimethylamino)propyl)quinazoline-2,4-diamine; 。 2. The method for preparing the pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1, characterized in that Follow these steps: (1) Add 0.073 mol of anthranilic acid and 0.73 mol of urea to an eggplant-shaped bottle, heat until they are fused together, maintain the reaction for more than 12 hours, and cool the reaction solution to room temperature; then add 200 mL of water to the reaction solution, stir for 0.5 hours, adjust the pH to <4 with glacial acetic acid, and solid precipitate; then filter under reduced pressure, wash the filter cake with water three times, and dry the filter cake to obtain 2,4-quinazolinedione; (2) 0.069 mol of 2,4-quinazolinedione obtained in step (1) was dissolved in 100 mL of anhydrous N,N-dimethylformamide, and 0.35 mol of phosphorus oxychloride was slowly added under ice bath conditions, and the reaction was refluxed for 8 h. After TLC detection, the reaction of the raw materials was completed, and the reaction solution was poured into 1 L of ice water, and solid was precipitated. Then, the reaction mixture was filtered under reduced pressure, and the filter cake was washed with water three times, and the filter cake was dried to obtain 2,4-dichloroquinazoline. (3) 2.53 mmol of 2,4-dichloroquinazoline obtained in step (2) was dissolved in 5 mL of anhydrous ethanol, and 3.03 mmol of N,N-diisopropylethylamine and 2.78 mmol of N-(2-aminoethyl)morpholine or N,N-dimethyl-1,3-propanediamine were added in sequence. The reaction was carried out at 90° C. for 1 h. After TLC detection, the reaction of the raw materials was completed. The mixture was cooled to room temperature, diluted with excess saturated sodium chloride solution, extracted with ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation to obtain N 4 -(2-morpholinoethyl)quinazoline-2,4-diamine or N 4 -(3-(Dimethylamino)propyl)quinazoline-2,4-diamine; (4) 0.36 mmol of N obtained in step (3) was added 4 -(2-morpholinoethyl)quinazoline-2,4-diamine or N 4 -(3-(dimethylamino)propyl)quinazoline-2,4-diamine, and 0.90 mmol 2-aminobenzimidazole were dissolved in 5 mL isopropanol, and 0.2 mL catalytic amount of saturated hydrogen chloride solution of 1,4-dioxane was added; the reaction was reacted at 100°C for 12 h; TLC detected that the reaction was complete, the reaction solution was cooled to room temperature, the solvent was removed by vortexing, and then purified by column chromatography, the developing solvent was a mixture of dichloromethane and methanol in a volume ratio of 50:1, and finally the product pre-miR-21 post-transcriptional processing splicing inhibitor was obtained.

3. Use of the pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1 in the preparation of anti-tumor drugs, characterized in that: The anti-tumor drug is a drug for triple-negative breast cancer.

4. An anti-tumor drug comprising the pre-miR-21 post-transcriptional processing splicing inhibitor according to claim 1.

Images