Application of OsSPL3 in regulation and control of rice root thickness character

Abstract

The invention relates to the field of plant genetic engineering, in particular to application of a plant development related protein and a coding gene thereof in regulating and controlling a root thickness character. The invention discloses application of a rice OsSPL3 gene. The rice OsSPL3 gene is used for adjusting the root thickness of a plant (rice); the OsSPL3 is knocked out, so that rice roots are thinned; osSPL3 is overexpressed, so that rice roots are thickened.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to application of a plant development-related protein and a coding gene thereof in regulating root thickness traits. Background Art

[0002] Although the root system is crucial to crop growth and yield formation, root traits have not received enough attention compared to aboveground agronomic traits during breeding (Voss-Fels et al., 2018). It is of great significance to study the molecular mechanism of rice root growth regulation.

[0003] Root diameter is an important indicator of root physiological function and plays an important role in regulating root structure. Studies on woody plants have found that root diameter largely determines the efficiency of root absorption of nutrients and water (Gu et al., 2014). Root thickness can increase the mechanical strength of the root to prevent bending. The thicker the root, the stronger the penetration ability, which is conducive to the establishment of a deep root system (Gu et al., 2014; Klein et al., 2020). Elucidating the molecular mechanism of root diameter regulation is of great significance for genetic improvement of root structure.

[0004] At present, only a few genes have been reported to be involved in regulating the thickness of rice roots. Overexpression of the NAC family transcription factor OsNAC5 can enlarge the pith and aerenchyma, leading to thicker stems and roots (Jeong et al., 2013); overexpression of the oval family protein OsOFP19 can also make the roots thicker, but at the same time it will lead to phenotypes such as shorter roots and smaller grains that are not conducive to yield formation (Yang et al., 2018).

[0005] Previous studies have shown that the SBP family gene OsSPL3 has the function of controlling the development of adventitious roots in rice, and OsSPL3 is post-transcriptionally regulated by OsmiR156 (Shao et al., 2019). The invention of CN109868278B, "Application of OsSPL3 in controlling the development of adventitious roots in rice", states that the miRNA target site in the mutant OsSPL3 mutated, resulting in high accumulation of OsSPL3 transcription products and inhibition of adventitious root primordium initiation and development.

[0006] The references mentioned above are as follows:

[0007] Voss-Fels KP et al. (2018). Designer roots for future crops. Trends in Plant Science, 23: 957-960.

[0008] Jeong, JS et al. (2013). OsNAC5 overexpression enlarges root diameter in rice plants leading to enhanced drought tolerance and increased grain yield in the field. Plant Biotechnology Journal, 11: 101-114.

[0009] Klein, SP et al. (2020). Multiple integrated root phenotypes areassociated with improved drought tolerance. Plant physiology, 183: 1011-1025. (Multiple integrated root phenotypes are associated with improved drought tolerance. Plant physiology, 183: 1011-1025);

[0010] GU,J et al.(2018).Root diameter variations explained by anatomy andphylogeny of 50

[0011] Tropical and temperate tree species. Tree Physiology, 34: 415-425. (Explaining root diameter variation using anatomy and phylogeny of 50 tropical and temperate tree species. Tree Physiology, 34: 415-425).

[0012] Yang, C et al. (2018). OsOFP19 modulates plant architecture by integrating the cell division pattern and brassinosteroid signaling. The Plant Journal, 93: 489-501. (OsOFP19 regulates plant architecture by integrating the cell division pattern and brassinosteroid signaling. The Plant Journal, 93: 489-501).

[0013] Shao, Y et al. (2019). OsSPL3, an sbp-domain protein, regulates crown root development in rice. Plant Cell, 31: 1257-1275. Summary of the invention

[0014] The technical problem to be solved by the present invention is to provide an application of OsSPL3 in regulating the thickness trait of rice roots.

[0015] In order to solve the above technical problems, the present invention provides the use of rice OsSPL3 gene: for regulating the thickness of plant roots.

[0016] As an improvement on the use of the rice OsSPL3 gene of the present invention: the nucleotide sequence of the coding region of the rice OsSPL3 gene is shown as SEQ ID NO.2, and the genomic nucleotide sequence of the rice OsSPL3 gene is shown as SEQ ID NO.3.

[0017] As a further improvement of the use of the rice OsSPL3 gene of the present invention: the plant is rice.

[0018] As a further improvement of the use of the rice OsSPL3 gene of the present invention:

[0019] Knocking out OsSPL3 makes rice roots thinner;

[0020] Overexpression of OsSPL3 resulted in thicker rice roots.

[0021] The technical solution provided by the present invention is specifically as follows:

[0022] The invention provides a rice root thickness regulating protein OsSPL3, the amino acid sequence of the protein is as shown in SEQ ID NO.1, the nucleotide sequence of the coding region of the protein is as shown in SEQ ID NO.2, and the genomic nucleotide sequence of the protein is as shown in SEQ ID NO.3.

[0023] The key points of the present invention are to provide an amino acid sequence as shown in SEQ ID NO.1 and a coding region nucleotide sequence as shown in SEQ ID NO.2, and to provide a genomic nucleotide sequence as shown in SEQ ID NO.3. When the nucleotide sequence and the amino acid sequence are known, it is obvious to those skilled in the art how to obtain the nucleotide sequence and the amino acid sequence, as well as the related vectors and host cells.

[0024] Due to the particularity of the nucleotide sequence, any variant of the coding region nucleotide sequence shown in SEQ ID NO.2 and the genomic nucleotide sequence shown in SEQ ID NO.3, as long as it has more than 90% homology with the polynucleotide, belongs to the scope of protection of the present invention. The variant of the polynucleotide refers to mutants, alleles and derivatives driven by tissue-specific promoters generated by adding, replacing, inserting and deleting one or more nucleotides in the polynucleotide sequence.

[0025] Due to the particularity of the amino acid sequence, any fragment or variant of the polypeptide containing the amino acid sequence shown in SEQ NO.1, such as its conservative variant, biologically active fragment or derivative, as long as the homology of the polypeptide fragment or polypeptide variant with the aforementioned amino acid sequence is more than 95%, belongs to the protection scope of the present invention. Specifically, the change may include the deletion, insertion or substitution of amino acids in the amino acid sequence; wherein, for the conservative change of the variant, the replaced amino acid has a similar structure or chemical property to the original amino acid, such as replacing isoleucine with leucine, and the variant may also have non-conservative changes, such as replacing glycine with tryptophan.

[0026] The present invention also provides an application of the rice root thickness regulating gene OsSPL3 in regulating rice root thickness. The application is that after knocking out OsSPL3 using the Crispr-Cas9 system, the rice seed roots become significantly thinner and the root system becomes shallower; and when OsSPL3 is overexpressed, the rice seed roots can be significantly thickened, indicating that OsSPL3 is a positive regulatory factor for rice root thickness, which has great application value for improving rice root traits to improve environmental adaptability and increase yield.

[0027] The present invention also provides a transgenic rice cell constructed after the rice root thickness regulating gene OsSPL3 is mutated.

[0028] The invention provides a rice root thickness regulating protein OsSPL3 and an application thereof. The protein is involved in regulating the thickness of rice roots.

[0029] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: it is different from the previously reported OsSPL3 regulation of rice adventitious root development. The OsSPL3 described in the present invention is a direct positive regulatory factor for the rice root thickness trait. That is, after knocking out the gene, the seminal roots become significantly thinner and the root system becomes shallower. On the contrary, after overexpressing the gene, the rice seminal roots become significantly thicker, thereby promoting rice rooting. Therefore, the content of the present invention has great guiding and application value in the exploration of the molecular mechanism of plant root diameter formation and the breeding practice of ideal root configuration of crops.

[0030] It should be noted that the currently known OsNAC5 and OsOFP19 involved in regulating the thickness of rice roots have no homology with the OsSPL3 protein or coding gene described in the present invention, and do not belong to the same family of proteins or genes. Therefore, the involvement of OsNAC5 and OsOFP19 in regulating the thickness of rice roots cannot provide technical inspiration for the present invention. Moreover, whether OsSPL3 is involved in regulating the thickness of rice roots has not been reported before the application date of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0032] Figure 1 The root thickness phenotype images and statistical analysis of HJ2, crd1, OX156 and MIM156 materials grown for 5 days after germination;

[0033] Figure 1 middle:

[0034] A, The thick main root phenotype of HJ2, crd1, OX156 and MIM156 was observed under a stereomicroscope, with a scale of 1 mm; BC, Cross-section and longitudinal sections of the roots of the corresponding materials in A; the scale is 50 μm; D, Root diameter statistics of the roots of the corresponding materials in A and gene expression analysis of miR156 and OsSPL3.

[0035] Figure 2 To phenotype thick root mutants in two rice subspecies;

[0036] Figure 2 middle:

[0037] A, Wild-type Kas and lcrn1 Kas Phenotypic photos of mutants and longitudinal and cross-sectional views of roots of corresponding materials; B, wild-type HJ2 and lcrn1 HJ2 Photos of mutant phenotypes and longitudinal and cross-sectional views of roots of corresponding materials.

[0038] Figure 3 for the identification and phenotypic analysis of HJ2, spl3-1, and lcrn1;

[0039] Figure 3 middle:

[0040] A, schematic diagram of the gene structure of OsSPL3, a rice root thickness regulating gene, and sequencing identification of spl3-1 and lcrn1; B, real-time fluorescence quantitative PCR analysis of the expression level of OsSPL3 in HJ2, spl3-1 and lcrn1; CF, observation and statistical analysis of the root thickness phenotype of HJ2, spl3-1 and lcrn1.

[0041] Figure 4 To verify the function of OsSPL3, a rice root thickness regulatory gene, in the japonica rice variety XS134;

[0042] Figure 4 middle:

[0043] A, Identification of the spl3-2 mutant in the XS134 background; B, Root thickness phenotype analysis of XS134, spl3-2 and OXSPL3 materials; C, Real-time fluorescence quantitative PCR analysis of the expression level of OsSPL3 in XS134, spl3-2 and OXSPL3 materials; D, Root phenotype analysis of XS134, spl3-2 and OXSPL3 materials, with arrows indicating the end position of the maximum root length; E, F are statistical analyses of the root structure phenotypes and adventitious root number and root length-related traits of XS134 and OXSPL3 strains, with a scale of 3 cm. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0045] Example 1: Identification and phenotypic analysis of rice root thickness trait mutant lines

[0046] 1. Rice culture conditions and nutrient solution formula

[0047] The rice culture conditions are as follows:

[0048] Daytime temperature: 28-30℃, nighttime temperature: 20-22℃; photoperiod: 7:00-19:00; relative humidity: 65%; photoperiod density: 250-300μmol m-2s-1; pH value of rice nutrient solution: 5.5-5.8. The nutrient solution is changed every 7 days.

[0049] The formula of rice nutrient solution is as shown in Table 1 below:

[0050] Table 1

[0051]

[0052]

[0053] 2. Identification of rice root thickness mutant lines

[0054] Wild-type rice Heijing 2 (HJ2), Kasalath (Kas) and mutants crd1, OX156, MIM156, lcrn1 (including the lcrn1 mutant in two rice subspecies, indica Kas and japonica: lcrn1 Kas and lcrn1 HJ2) and other seeds are taken out from the warehouse according to the number, and the seeds are immersed in 0.66% dilute nitric acid and placed at room temperature (the room temperature in the present invention is 24-26°C) for 16 hours to break the seed dormancy. Rinse with clean water three times to remove excess dilute nitric acid. Thereafter, the seeds are immersed in clean water and germinated in a 37°C oven for about two days (changing the water every 12 hours) until the seeds turn white. The white seeds are sown according to the number on a mesh floating board floating on the rice nutrient solution (10 liters / trough, refer to Table 1 for the nutrient solution formula), and the culture conditions are as described above. After 5 days of culture, the wild-type material is placed on one side of the observation vessel (black plastic tray), and other mutant materials are placed in the observation vessel according to the number, and the difference in root thickness between them and the wild type is observed, and photos, measurements and records are made.

[0055] illustrate:

[0056] Wild-type and mutant materials such as HJ2, crd1, OX156 and MIM156 are from the article published by the inventor's research group (Zhu et al., 2019); materials such as Kas and lcrn1Kas are from the article published by the inventor's research group (Shao et al., 2019).

[0057] CRD1, an Xpo1 domain protein, regulates miRNA accumulation and crownroot development in rice;

[0058] OsSPL3,an SBP-Domain Protein,Regulates Crown Root Development inRice.

[0059] OsSPL3 was overexpressed in crd1, MIM156 and lcrn1 compared with the corresponding wild type; while OsSPL3 was interfered with expression in OX156 compared with the corresponding wild type.

[0060] 3. Phenotypic analysis of rice root thickness mutant lines

[0061] After the seeds germinated for 5 days, root tissues of HJ2, crd1, OX156 and MIM156 were collected to extract total RNA, reverse transcribe and perform OsSPL3 expression detection according to conventional RT-qPCR detection methods. The results showed that:

[0062] The expression of OsSPL3 gene in crd1 and MIM156 materials was significantly induced compared with that in the control HJ2, and the root thickness was significantly thickened; while the expression of OsSPL3 gene in OX156 material was significantly inhibited compared with that in the control HJ2, and the root thickness was significantly thinned ( Figure 1 ).

[0063] Furthermore, it was found that the gain-of-function mutant of OsSPL3, lcrn1, in two rice subspecies (indica Kas and japonica HJ2) Kas and lcrn1 HJ2 The root diameter of the genus was significantly thicker than that of the wild type ( Figure 2 ). These results suggest that OsSPL3 may be a potential positive regulator of rice root diameter traits.

[0064] The methods for total RNA extraction and first-strand cDNA synthesis from root tissue are as follows:

[0065] (1) Turn on the centrifuge and precool to 4°C;

[0066] (2) Label the centrifuge tube and add 1 ml of Trizol reagent (1 ml / 100 mg tissue);

[0067] (3) Grind the rice roots into fine powder in liquid nitrogen and immediately transfer them to a centrifuge tube containing Trizol reagent. After vigorous shaking, place them at room temperature for 5-10 minutes.

[0068] (4) Centrifuge at 12000 rpm for 10 min at 4°C and transfer 800 μl of the supernatant to another 1.5 ml centrifuge tube;

[0069] (5) Add 200 μl of chloroform, shake thoroughly, and leave at room temperature for 10 min until the liquid separates;

[0070] (6) Centrifuge at 12,000 rpm for 10 min at 4°C and transfer 600 μl of the supernatant to another 1.5 ml centrifuge tube;

[0071] (7) Add 600 μl of isopropanol, mix gently, and incubate at -20°C for 30 min;

[0072] (8) Centrifugation at 12,000 rpm for 15 min at 4°C;

[0073] (9) Discard the supernatant and wash gently with 70% ethanol (prepared with DEPC water);

[0074] (10) Centrifuge at 10,000 rpm for 5 min at 4°C, discard the supernatant, and repeat the wash;

[0075] (11) Centrifuge at 10,000 rpm for 5 min at 4°C, discard the supernatant, place on a clean bench to dry the remaining liquid, add 50-100 μl of DEPC water to dissolve, determine the concentration, and the sample can be used immediately for subsequent reverse transcription experiments;

[0076] (12) The first-strand cDNA was synthesized according to the method provided by the full-form gold reverse transcription kit AU341-022.

[0077] The quantitative primer sequences for OsSPL3 are as follows (5' to 3'):

[0078] OsSPL3 QRT-F: AGCCACAACCAGAAGCAATTTCC

[0079] OsSPL3 QRT-R:CTTGCCTGTTGCCTTGCATCAC

[0080] The RT-qPCR reaction system and procedure are as follows:

[0081] RT-qPCR reaction system (384-well plate):

[0082] cDNA template: 0.1 μl;

[0083] 2×Master: 2.5 μl;

[0084] Upstream / downstream primer: 0.1μl / 0.1μl;

[0085] RNase-free H2O: 2.2 μl.

[0086] RT-qPCR reaction procedure (384-well plate):

[0087]

[0088] 4. Cytological analysis of root thickness traits

[0089] In order to analyze the cytological mechanism of OsSPL3 regulating root thickness, the root tips of the corresponding materials were resin sliced. The sheath nodes of HJ2, Kas, crd1, OX156, MIM156 and lcrn1 obtained from 5-day germination were fixed in a 4% paraformaldehyde aqueous solution at room temperature overnight, then washed three times with 0.1M PBS (20 minutes each time), transferred to a 1% osmium acid aqueous solution at room temperature overnight, and then washed three times with 0.1M PBS (20 minutes each time). The water in the tissue was replaced with an acetone aqueous solution with a gradient volume concentration. The acetone concentration used was 30% acetone (1h) → 40% acetone (1h) → 50% acetone (1h) → 60% acetone (1h) → 70% acetone (overnight) → 80% acetone (1h) → 90% acetone (1h) → 95% acetone (1h) → 100% acetone (1h) → 100% acetone (1h) → 100% acetone (1h). Then, resins with different concentration gradients were used to replace the acetone in the tissue. The ratio of resin to acetone (volume ratio) used was 2 / 3 acetone + 1 / 3 Spurr's resin (2h) → 1 / 2 acetone + 1 / 2 Spurr's resin (2h) → 1 / 3 acetone + 2 / 3 Spurr's resin (2h) → pure Spurr's resin infiltration overnight → embedding → polymerization overnight (70°C incubator). The polymerized resin block was sliced ​​longitudinally at the root tip using a resin slicer (slice thickness was 3 μm) → the slices were spread onto a glass slide → stained with methylene blue → washed with water to remove the remaining color → baked → observed and photographed under an optical microscope. Through longitudinal and transverse resin slice observation, it was found that the number of cortical layers in materials such as crd1 and MIM156 was significantly more than that in the control group HJ2; while the number of cortical layers in the OX156 mutant material was significantly reduced ( Figure 1 B and C), lcrn1 Kas and lcrn1 HJ2 The roots of the materials were also significantly thicker than those of the corresponding control materials ( Figure 2 ), the results showed that OsSPL3 mainly regulates the number and thickness of cortical roots.

[0090] Example 2: Functional verification of rice root thickness regulating gene OsSPL3

[0091] 1. Development of OsSPL3 artificial knockout mutants using Crispr-cas9 technology

[0092] The Crispr-cas9 vector was constructed by specific target design, and the Crispr vector of OsSPL3 constructed and sequenced correctly was transferred into Agrobacterium (EHA105), and the OsSPL3 artificial knockout mutant was developed in HJ2 and XS134 backgrounds, respectively. The one obtained in HJ2 background was named spl3-1, and the one obtained in XS134 background was named spl3-2.

[0093] You can refer to the CRISPR-P program (http: / / skl.scau.edu.cn / ) to design the CRISPR target primers for OsSPL3. The specific target primers designed in this case are as follows (5' to 3'):

[0094] Target 1: AATCAAAACTTGCAGGTGT

[0095] Target 2:TCTAGCTCAGAGATTGGGTA

[0096] The mutation pattern and sequence of OsSPL3 artificial knockout mutants are as follows Figure 3 Middle A and Figure 4 As shown in A.

[0097] 2. Creation of OsSPL3 overexpression materials

[0098] In order to explore the potential application value of OsSPL3 in regulating rice root thickness, the genomic DNA and cDNA of lcrn1 were used as templates to amplify the native promoter and coding nucleotide sequence of OsSPL3 (the coding nucleotide sequence is shown in SEQ ID NO.2, and the native promoter sequence is shown in SEQ ID NO.3). The recovered and purified amplified fragments were connected into the pCAMBIA1300-eGFP binary vector using homologous recombinase (purchased from Novozyme Biotech Co., Ltd.) to obtain the OsSPL3 overexpression vector. The constructed and sequenced OsSPL3 overexpression vector was transferred into Agrobacterium (EHA105) for transformation of wild-type XS134. The resulting vector was named OXSPL3.

[0099] 3. The specific steps of Agrobacterium (EHA105)-mediated genetic transformation are as follows:

[0100] (1) Select the transformed single clones in step 1 or step 2 and place them in a 50 ml centrifuge tube containing 20 ml of Agrobacterium culture medium. Incubate the culture overnight at 28°C and 250 rpm until the OD value of the culture medium reaches 0. 600 At about 1.0, 4°C, 4000 rpm, centrifuge for 10 min to collect the bacteria;

[0101] (2) Prepare Agrobacterium suspension with 30 ml of AAM bacterial solution containing 200 μmol / L acetosyringone (As) and adjust the OD of the bacterial solution to 600 The final concentration is 0.6; put 50-80 0.3-0.5 cubic centimeters of HJ2 or XS134 callus tissues, shake and infect on a horizontal shaker at room temperature for 5 minutes, take out the callus tissues, and place them on sterile filter paper to drain;

[0102] (3) The callus tissue was transferred to a co-culture medium covered with sterile filter paper. After culturing in the dark at room temperature for 3 days, the callus was collected and washed twice with sterile water containing 300 mg / L carbenicillin sodium (Carb), each time shaking on a horizontal shaker for 30 minutes. Finally, it was placed on sterile filter paper to drain for 2 hours;

[0103] (4) The drained callus was transferred to a selection medium containing 300 mg / L carbenicillin sodium and 50 mg / L hygromycin for the first round of selection and cultured at 28°C under light for 14 days;

[0104] (5) Select the initial calli with resistance and transfer them to a medium containing 300 mg / L carbenicillin sodium and 50 mg / L hygromycin for a second round of selection. Culture them at 28°C under light for 14 days. At this time, granular resistant callus tissue can be seen growing.

[0105] (6) Pick 2-3 resistant calli from the same callus and place them on the differentiation medium. Cover the differentiation tank lid and culture them at 25°C under light (16h / 8h photoperiod, light intensity of 2000lx) for about 30 days until the callus tissue differentiates into seedlings. When the seedlings grow to about 5-10 cm, they can be directly transplanted to the rice culture conditions described in Example 1 for culture and identification.

[0106] (7) Using primers that specifically amplify hygromycin, T0 transgenic seedlings were amplified to identify transgenic positive seedlings. The primer sequences that specifically amplify hygromycin are as follows (5' to 3'):

[0107] Hyg F:CGAGTACTTCTACACAGCCATC

[0108] Hyg R: TAGCGAGAGCCTGACCTATT;

[0109] (8) Continue to cultivate the T0 generation transgenic positive seedlings obtained by identification until the seeds are harvested.

[0110] 4. Root Thickness Phenotype Analysis of OsSPL3 Knockout and Overexpression Materials

[0111] Sequencing analysis revealed that the coding sequence of the spl3-1 mutant was deleted for a large fragment (71 bp); the coding sequence of the spl3-2 mutant was deleted for bases (target site 1 was deleted for 15 bp, target site 2 was deleted for 1 bp), and both spl3-1 and spl3-2 caused the premature termination of OsSPL3 coding ( Figure 3 Middle A and Figure 4 The transgenic seeds were germinated and the root thickness phenotype was observed. The results showed that the roots of the two mutants, spl3-1 (HJ2 background) and spl3-2 (XS134 background), were significantly thinner than those of the corresponding wild-type control materials ( Figure 3 Middle C to F, Figure 4 (middle B).

[0112] The expression of OsSPL3 was detected by the same RT-qPCR detection method as above, and combined with phenotypic analysis, it was found that the expression of OsSPL3 in the OXSPL3 line was significantly higher than that in the control XS134. The root diameter of the OXSPL3 line was significantly thicker than that of the control XS134. In addition, the number of adventitious roots decreased, but the root length increased significantly compared with the control ( Figure 4 These results further confirmed that OsSPL3 directly regulates rice root diameter and also indicated that regulating the expression of OsSPL3, such as using a root-specific expression promoter to drive OsSPL3, could regulate rice root diameter and root architecture, thereby facilitating the breeding of new varieties with ideal root architecture.

[0113] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Use of rice OsSPL3 gene, characterized in that: Used to adjust the root thickness of plants.

2. The use of the rice OsSPL3 gene according to claim 1, characterized in that: The nucleotide sequence of the coding region of the rice OsSPL3 gene is shown in SEQ ID NO.2, and the genomic nucleotide sequence of the rice OsSPL3 gene is shown in SEQ ID NO.

3.

3. The use of the rice OsSPL3 gene according to claim 1 or 2, characterized in that: The plant is rice.

4. The use of the rice OsSPL3 gene according to claim 3, characterized in that: Knocking out OsSPL3 makes rice roots thinner; Overexpression of OsSPL3 resulted in thicker rice roots.

Images