Chimeric bait receptors and uses thereof

Abstract

Provided herein are novel chimeric polypeptides that bind to antigen peptides (e.g., viral antigens or tumor associated antigens) and activate the endogenous phagocytosis signaling pathway. Also provided are compositions and methods for producing such chimeric polypeptides, nucleic acids encoding such chimeric polypeptides, phagocytes that have been modified to express such chimeric polypeptides, and methods for treating various conditions, such as viral infections or cancer.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 315,388, filed on March 1, 2022, the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted electronically in XML format, and the sequence listing is hereby incorporated by reference in its entirety. The XML file was created on February 28, 2023, named 405320-HGXR-001WO.xml, and has a size of 203,056 bytes. Technical Field

[0005] The present disclosure relates to novel chimeric polypeptides that bind antigenic peptides (e.g., viral antigens or tumor-associated antigens) and activate endogenous phagocytic signaling pathways. Also provided are compositions and methods for producing such chimeric polypeptides, nucleic acids encoding such chimeric polypeptides, phagocytic cells that have been modified to express such chimeric polypeptides, and methods for treating various conditions such as viral infections or cancer. Background Art

[0006] Many viruses bind to one or more specific receptors on host cells for attachment, entry, and / or signaling. A single viral receptor may mediate all of the above functions, or a virus may utilize different receptors to mediate each function, thereby providing greater specificity with tissue tropism. In other cases, coordinated virus-receptor interactions are necessary to mediate specific functions such as activation of signaling events. Studies have revealed common viral receptors, including cell adhesion molecules (CAMs) such as integrins, selectins, cadherins, and immunoglobulin superfamily (IgSF) receptors, as well as PtdSer receptors. Viruses including HIV, measles virus, reovirus, rhinovirus, adenovirus, poliovirus, and coxsackievirus B (CVB) utilize IgSF members as receptors, while integrins serve as receptors for reovirus, rotavirus, adenovirus, West Nile virus (WNV), human metapneumovirus (hMPV), foot-and-mouth disease virus (FMDV), herpes simplex virus (HSV), human cytomegalovirus HCMV, and human herpesvirus-8.

[0007] Other viruses bind to less common receptors on host cells for attachment, entry, and / or signaling. For example, SARS-CoV-2 binds to human angiotensin-converting enzyme 2 (ACE2), a membrane-bound enzyme that is part of the renin-angiotensin-aldosterone system.

[0008] The immune system constantly patrols the human body looking for ways to destroy cancerous cells and harmful microorganisms. Under normal circumstances, immune cells can recognize these threats because they recognize specific signals present on the surface of target cells. Immunity provided by antibodies produced against viral antigens through previous infection or vaccination is currently the mainstay of protection against viral infections. However, frequent viral mutations may allow the virus to evade this immunity if the antibodies produced no longer recognize the viral antigens, or bind to them with lower affinity.

[0009] In addition, cancer cells often find ways to evade the immune system and proliferate. The endogenous immune system is usually unresponsive to malignant cells, or can be actively immunosuppressed relative to the body's response to the presence of malignant cells. Despite many recent advances in cancer immunotherapy, the vast majority of cell therapeutics currently focus almost exclusively on T cells. This focus is largely because T cells can be engineered to express synthetic immune receptors that contain extracellular targeting antibodies and intracellular signaling domains, known as chimeric antigen receptors (CARs), which enable T cells expressing such CARs to target tumor-associated antigens. For example, in recent years, T cells expressing CARs for CD19 have been shown to have significant anti-leukemia efficacy, with 90% of patients with acute lymphoblastic leukemia receiving treatment having achieved complete remission. These results are accompanied by strong T cell proliferation, and T cells infiltrate into tumor sites in leukemia patients receiving such treatment are clearly documented. Despite the high remission rate shown in hematopoietic malignancies, the efficacy of CAR T cells against solid tumors and specific lymphoid tumors may be limited. Possible explanations for this include possible impaired ability of T cells to infiltrate solid tumors, poor trafficking, immunosuppressive tumor microenvironment, and less tumor-specific antigen expression on solid tumor cells.

[0010] There is a continuing need for new compositions and methods for treating infections, inflammatory diseases, immune diseases, and various cancers. In view of the problems associated with natural and recombinant antibodies against viruses, there is an unmet need for innate immune mechanisms independent of antibodies to neutralize viruses. Targeting viral receptors on host cells provides an opportunity to prevent and / or treat viral infections. There is also a need for more effective compositions and methods for treating cancers by improving specificity for tumor cells and improving infiltration of tumor sites, both in solid tumors and hematopoietic malignancies. Summary of the invention

[0011] The present disclosure provides chimeric polypeptides, which include a portion that can specifically bind to an antigen and a portion that targets the chimeric polypeptide for endocytosis after binding to the antigen. As described in further detail below, the antigen can be a viral protein, and the portion that can specifically bind to the viral protein can be a binding region that binds to the virus on a host cell. In other embodiments, the antigen can be a tumor-associated antigen (TAA), and the portion that can specifically bind to the TAA can be an antigen binding portion, such as an antibody or a fragment thereof. The portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis can be an intracellular (i.e., cytoplasmic) signaling region of an endocytic receptor. In other embodiments, the portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis can be a ligand of an endocytic receptor.

[0012] In one aspect, a chimeric decoy receptor (CBR) is provided, which includes a) an extracellular portion, which includes a binding region that specifically binds to a virus, wherein the binding region is not an antibody; b) a transmembrane portion; and c) an intracellular portion, which includes an intracellular signaling region of an internalized receptor.

[0013] In some embodiments, the binding region is part of a host protein that enables the virus to attach to the host cell when the binding region is exposed to the virus and the binding region is expressed in the host cell.

[0014] In some embodiments, the binding region includes a portion of a protein selected from the group consisting of angiotensin-converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1. In some embodiments, the binding region includes ACE2 or a fragment thereof. In some embodiments, the binding region includes amino acids 19-358, 19-605, or 19-740 of SEQ ID NO: 2. In some embodiments, the binding region includes at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0015] In some embodiments, the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, and a scavenger receptor.

[0016] In some embodiments, the transmembrane portion comprises a transmembrane portion of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: class A scavenger receptor type I / II (SR AI / II), macrophage receptor with collagen structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, class B scavenger receptor type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like parts 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), scavenger receptor-1 containing a connecting domain (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44 and class L scavenger receptor type I (SR-L1).

[0017] In some embodiments, the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

[0018] In some embodiments, the transmembrane portion comprises a transmembrane portion of a mannose receptor.

[0019] In some embodiments, the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:10.

[0020] In some embodiments, the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:12.

[0021] In some embodiments, the intracellular signaling region of an endocytic receptor comprises an intracellular signaling region of a phagocytic receptor.

[0022] In some embodiments, the transmembrane portion comprises a transmembrane portion of a phagocytic receptor.

[0023] In some embodiments, the intracellular signaling region of the engulfment receptor comprises an intracellular portion of a protein from the group consisting of: MERTK, dectin-1, and an Fc gamma receptor (FcγR).

[0024] In some embodiments, the transmembrane portion and the intracellular signaling region of the engulfment receptor include the transmembrane portion and the intracellular portion of MERTK. In some embodiments, the transmembrane portion and the intracellular portion of MERTK include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 14.

[0025] In some embodiments, the transmembrane portion and intracellular signaling region of the engulfment receptor include the transmembrane portion and intracellular portion of dectin-1. In some embodiments, the transmembrane portion and intracellular portion of dectin-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 16. In some embodiments, the CBR includes SEQ ID NO: 18.

[0026] In some embodiments, the intracellular signaling region of the engulfment receptor comprises the intracellular portion of an FcγR. In some embodiments, the intracellular portion of an FcγR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.

[0027] In some embodiments, the transmembrane portion and intracellular signaling region of the endocytic receptor include the transmembrane portion and intracellular portion of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44 and SR-L1.

[0028] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of SR AI / II. In some embodiments, the transmembrane portion and intracellular portion of SR AI / II include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.

[0029] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of MARCO. In some embodiments, the transmembrane portion and the intracellular portion of MARCO include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 24.

[0030] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of the SCARA5 receptor. In some embodiments, the transmembrane portion and intracellular portion of the SCARA5 receptor include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 26.

[0031] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SRCL. In some embodiments, the transmembrane portion and the intracellular portion of SRCL include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 28.

[0032] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD36. In some embodiments, the transmembrane portion and the intracellular portion of CD36 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 30.

[0033] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of SR-BI. In some embodiments, the transmembrane portion and intracellular portion of SR-BI include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 32.

[0034] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD68. In some embodiments, the transmembrane portion and the intracellular portion of CD68 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 34.

[0035] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of LOX-1. In some embodiments, the transmembrane portion and the intracellular portion of LOX-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:36.

[0036] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of the SREC. In some embodiments, the transmembrane portion and the intracellular portion of the SREC include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 38.

[0037] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of MEGF10. In some embodiments, the transmembrane portion and the intracellular portion of MEGF10 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 40.

[0038] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SR-PSOX. In some embodiments, the transmembrane portion and the intracellular portion of SR-PSOX include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 42.

[0039] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of FEEL-1. In some embodiments, the transmembrane portion and the intracellular portion of FEEL-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 44.

[0040] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD163. In some embodiments, the transmembrane portion and the intracellular portion of CD163 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 46.

[0041] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of RAGE. In some embodiments, the transmembrane portion and the intracellular portion of RAGE include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 48.

[0042] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD44. In some embodiments, the transmembrane portion and the intracellular portion of CD44 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 50.

[0043] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SR-L1. In some embodiments, the transmembrane portion and the intracellular portion of SR-L1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 52.

[0044] In some embodiments, the CBR further comprises an N-terminal signal peptide. In some embodiments, the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

[0045] In some embodiments, the CBR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of: SEQ ID NOs: 61 to 67.

[0046] Also provided are nucleic acids encoding one or more of the CBRs described herein.

[0047] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 54 to 60.

[0048] Also provided are recombinant vectors encoding one or more CBRs of the present disclosure, and cells comprising one or more CBRs, nucleic acids encoding one or more CBRs and / or vectors capable of expressing one or more CBRs. In certain embodiments, the host cell is a phagocytic cell, such as, for example, a macrophage, a dendritic cell, a mast cell, a monocyte, a neutrophil, a microglia or an astrocyte. Also provided are cell populations comprising two or more cells as described herein.

[0049] Also provided is a pharmaceutical composition comprising a therapeutically effective amount of one or more CBRs, one or more nucleic acids encoding the CBRs, one or more vectors capable of expressing the CBRs, a host cell or host cell population comprising the CBRs, and a pharmaceutically acceptable carrier.

[0050] Also provided is a method for treating or preventing viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more CBRs, one or more nucleic acids encoding CBRs, one or more vectors capable of expressing CBRs, host cells or host cell populations comprising CBRs, or a pharmaceutical composition containing any of the foregoing.

[0051] In some embodiments, the subject is a human.

[0052] In some embodiments, the viral infection is caused by a virus selected from the group consisting of Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae, and Bunyaviridae.

[0053] In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.

[0054] In one aspect, a chimeric engulfment receptor (CPR) is provided, comprising a) an extracellular portion comprising an antigen binding portion, b) a transmembrane portion; and c) an intracellular portion comprising an intracellular signaling region of an endocytic receptor, wherein the CPR does not include a recruitment portion, wherein the recruitment portion is not an intracellular region of an endocytic receptor, and wherein the recruitment portion binds to a cytoplasmic protein of a engulfment signaling pathway.

[0055] In some embodiments, the antigen binding moiety comprises an antibody. In some embodiments, the antibody comprises a single chain variable fragment (scFv) or a monopartite antibody (sdAb) variable portion.

[0056] In some embodiments, the antigen binding portion specifically binds to an antigen selected from the group consisting of: CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, Prostase, PAP, ELF2M, Ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

[0057] In some embodiments, the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, and a scavenger receptor.

[0058] In some embodiments, the transmembrane portion comprises a transmembrane portion of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: class A scavenger receptor type I / II (SR AI / II), macrophage receptor with collagen structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, class B scavenger receptor type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like parts 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), scavenger receptor-1 containing a connecting domain (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44 and class L scavenger receptor type I (SR-L1).

[0059] In some embodiments, the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

[0060] In some embodiments, the transmembrane portion comprises a transmembrane portion of a mannose receptor.

[0061] In some embodiments, the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:10.

[0062] In some embodiments, the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:12.

[0063] In some embodiments, the intracellular signaling region of an endocytic receptor comprises an intracellular signaling region of a phagocytic receptor.

[0064] In some embodiments, the transmembrane portion comprises a transmembrane portion of a phagocytic receptor.

[0065] In some embodiments, the intracellular signaling region of the engulfment receptor comprises an intracellular portion of a protein from the group consisting of: MERTK, dectin-1, and an Fc gamma receptor (FcγR).

[0066] In some embodiments, the transmembrane portion and the intracellular signaling region of the engulfment receptor include the transmembrane portion and the intracellular portion of MERTK. In some embodiments, the transmembrane portion and the intracellular portion of MERTK include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 14.

[0067] In some embodiments, the transmembrane portion and the intracellular signaling region of the engulfment receptor include the transmembrane portion and the intracellular portion of dectin-1. In some embodiments, the transmembrane portion and the intracellular portion of dectin-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 16. In some embodiments, the CBR includes an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 18.

[0068] In some embodiments, the intracellular signaling region of the engulfment receptor comprises the intracellular portion of an FcγR. In some embodiments, the intracellular portion of an FcγR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.

[0069] In some embodiments, the transmembrane portion and intracellular signaling region of the endocytic receptor include the transmembrane portion and intracellular portion of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44 and SR-L1.

[0070] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of SR AI / II. In some embodiments, the transmembrane portion and intracellular portion of SR AI / II include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.

[0071] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of MARCO. In some embodiments, the transmembrane portion and the intracellular portion of MARCO include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 24.

[0072] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of the SCARA5 receptor. In some embodiments, the transmembrane portion and intracellular portion of the SCARA5 receptor include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 26.

[0073] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SRCL. In some embodiments, the transmembrane portion and the intracellular portion of SRCL include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 28.

[0074] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD36. In some embodiments, the transmembrane portion and the intracellular portion of CD36 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 30.

[0075] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor include the transmembrane portion and intracellular portion of SR-BI. In some embodiments, the transmembrane portion and intracellular portion of SR-BI include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 32.

[0076] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD68. In some embodiments, the transmembrane portion and the intracellular portion of CD68 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 34.

[0077] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of LOX-1. In some embodiments, the transmembrane portion and the intracellular portion of LOX-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:36.

[0078] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of the SREC. In some embodiments, the transmembrane portion and the intracellular portion of the SREC include at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of SEQ ID NO: 38.

[0079] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of MEGF10. In some embodiments, the transmembrane portion and the intracellular portion of MEGF10 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 40.

[0080] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SR-PSOX. In some embodiments, the intracellular portion of SR-PSOX includes an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 42.

[0081] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of FEEL-1. In some embodiments, the transmembrane portion and the intracellular portion of FEEL-1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 44.

[0082] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD163. In some embodiments, the transmembrane portion and the intracellular portion of CD163 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 46.

[0083] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of RAGE. In some embodiments, the transmembrane portion and the intracellular portion of RAGE include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 48.

[0084] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of CD44. In some embodiments, the transmembrane portion and the intracellular portion of CD44 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 50.

[0085] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor include the transmembrane portion and the intracellular portion of SR-L1. In some embodiments, the transmembrane portion and the intracellular portion of SR-L1 include an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 52.

[0086] In some embodiments, the recruitment moiety is selected from the group consisting of: a) a p85-recruiting moiety that binds to the p85 regulatory subunit of phosphatidylinositol 3-kinase (PI3K); b) an SH3 moiety derived from Crk, Cdc25, phospholipase, Ras, Vav, GRB2, FAK, Pyk2, TRIP10 or Gads; and c) a proline-rich peptide sequence from C3G, p41, PEP, p4'7, HPK1, SLP-1, CD3.ε, PAK, AIP4 or Sos, wherein the proline-rich peptide sequence binds to a protein containing an SH3 moiety. In some embodiments, the recruitment moiety is a p85-recruiting moiety, and wherein the p85-recruiting moiety is derived from CD19, Gab2, IREM-1, PDGF receptor, CSFR-1, c-Kit, ErbB3 or CD7.

[0087] In some embodiments, the CPR further comprises an N-terminal signal peptide. In some embodiments, the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

[0088] In some embodiments, the CPR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of: SEQ ID NOs: 86 to 103.

[0089] Also provided are nucleic acids encoding one or more of the CPRs described herein.

[0090] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NOs: 68 to 85.

[0091] Also provided are recombinant vectors encoding one or more CPRs disclosed herein, as well as cells comprising one or more CPRs, nucleic acids encoding one or more CPRs, and / or vectors capable of expressing one or more CPRs. In some embodiments, the host cell is a phagocytic cell, such as, for example, a macrophage, a dendritic cell, a mast cell, a monocyte, a neutrophil, a microglia, or an astrocyte. Also provided are cell populations comprising two or more cells described herein.

[0092] Also provided is a pharmaceutical composition comprising a therapeutically effective amount of one or more CPRs, one or more nucleic acids encoding the CPRs, one or more vectors capable of expressing the CPRs, a host cell or host cell population comprising the CPRs, and a pharmaceutically acceptable carrier.

[0093] Also provided is a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more CPRs, one or more nucleic acids encoding CPRs, one or more vectors capable of expressing CPRs, host cells or host cell populations comprising CPRs, or a pharmaceutical composition containing any of the foregoing. In some embodiments, the subject is a human.

[0094] In one aspect, a decoy macrophage engager (BME) is provided, comprising a) a binding region that specifically binds to a virus, wherein the binding region is not an antibody; and b) a ligand for an endocytic receptor.

[0095] In one aspect, a decoy macrophage engager (BME) is provided, comprising a) a binding region that specifically binds to a virus, wherein the binding region is part of a host protein that causes the virus to attach to the host cell when the binding region is exposed to the virus and the binding region is expressed in a host cell; and b) a ligand for an endocytic receptor.

[0096] In some embodiments, the binding region comprises a portion of a protein selected from the group consisting of angiotensin converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1.

[0097] In some embodiments, the binding region includes ACE2 or a fragment thereof. In some embodiments, the binding region includes amino acids 19-358, 19-605, or 19-740 of SEQ ID NO: 2. In some embodiments, the binding region includes at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0098] In some embodiments, the endocytic receptor is a mannose receptor.

[0099] In some embodiments, the endocytic receptor is a phagocytic receptor. In some embodiments, the phagocytic receptor is selected from the group consisting of MERTK, dectin-1, and an Fcγ receptor (FcγR).

[0100] In some embodiments, the endocytic receptor is a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0101] In some embodiments, the ligand is selected from the group consisting of: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptides, high-density cholesterol (HDL), lectins, selectins, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA also known as hyaluronic acid) and microtubule-associated protein Tau (MAPT).

[0102] In some embodiments, the ligand is soluble CD163. In some embodiments, the ligand includes an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% with the amino acid sequence of SEQ ID NO:105.

[0103] In some embodiments, the BME comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:107.

[0104] In some embodiments, the BME further comprises IgG Fc.

[0105] Also provided are nucleic acids encoding one or more of the BMEs described herein.

[0106] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO:106.

[0107] Also provided are recombinant vectors encoding one or more BMEs of the disclosure, as well as cells comprising one or more BMEs, nucleic acids encoding one or more BMEs, and / or vectors capable of expressing one or more BMEs. Also provided are cell populations comprising two or more cells described herein.

[0108] Also provided is a pharmaceutical composition comprising a therapeutically effective amount of one or more BMEs and a pharmaceutically acceptable carrier.

[0109] Also provided is a method of treating or preventing a viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more BMEs or a pharmaceutical composition thereof.

[0110] In some embodiments, the subject is a human.

[0111] In some embodiments, the viral infection is caused by a virus selected from the group consisting of Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae, and Bunyaviridae.

[0112] In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.

[0113] In one aspect, an antigen macrophage engager (AME) is provided, which includes a) an antibody that binds to an antigen expressed on the surface of a cancer cell; and b) a ligand for an endocytic receptor.

[0114] In some embodiments, the antibody comprises a single-chain variable fragment (scFv) or a monopartite antibody (sdAb) variable portion.

[0115] In some embodiments, the antigen binding portion specifically binds to an antigen selected from the group consisting of: CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, Prostase, PAP, ELF2M, Ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

[0116] In some embodiments, the endocytic receptor is a mannose receptor.

[0117] In some embodiments, the endocytic receptor is a phagocytic receptor.In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion of a protein from the group consisting of: MERTK, and an Fc gamma receptor (Fc gamma R).

[0118] In some embodiments, the endocytic receptor is a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of: SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0119] In some embodiments, the ligand is selected from the group consisting of: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptides, high-density cholesterol (HDL), lectins, selectins, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA also known as hyaluronic acid) and microtubule-associated protein Tau (MAPT).

[0120] In some embodiments, the ligand is soluble CD163. In some embodiments, the ligand includes an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% with the amino acid sequence of SEQ ID NO:105.

[0121] Also provided are nucleic acids encoding one or more of the AMEs described herein.

[0122] Also provided are recombinant vectors encoding one or more AMEs of the present disclosure, as well as cells comprising one or more AMEs, nucleic acids encoding one or more AMEs, and / or vectors capable of expressing one or more AMEs. Also provided are cell populations comprising two or more cells described herein.

[0123] Also provided is a pharmaceutical composition comprising a therapeutically effective amount of one or more AMEs and a pharmaceutically acceptable carrier.

[0124] Also provided is a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more AMEs or a pharmaceutical composition thereof. In some embodiments, the subject is a human. BRIEF DESCRIPTION OF THE DRAWINGS

[0125] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the present disclosure and, together with the description, serve to explain the principles of the present disclosure.

[0126] Figure 1 Schematic diagram comparing antibody recognition of the virus (left) with chimeric decoy receptor (CBR) recognition of the virus (right). The mutated virus (labeled "Mut") cannot be recognized by the antibody. However, both the wild-type virus and the mutant virus are recognized by the extracellular "bait" part of the chimeric decoy receptor (e.g., ACE2).

[0127] Figure 2 is a set of fluorescence microscopy images showing phagocytosis of SARS-CoV-2 spike protein-coated beads or uncoated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing ACE2 (19-740AA) bait.

[0128] FIG. 3A to FIG. 3B Flow cytometric plots showing phagocytosis of SARS-CoV-2 spike-coated beads or uncoated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing ACE2 (19-740AA) decoy ( Figure 3A ). Summary of flow cytometry results ( Figure 3B ). Mean ± SEM (n = 3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p < 0.0001.

[0129] FIG. 4A to FIG. 4B Flow cytometric plots showing phagocytosis of B.1.1.7 spike-coated beads or WT SARS-CoV-2 spike-coated beads or uncoated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing ACE2 (19-740AA) bait ( Figure 4A ). Summary of flow cytometry results ( Figure 4B ). Mean ± SEM (n = 3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p < 0.0001.

[0130] FIG. 5A to FIG. 5BFlow cytometric plots showing phagocytosis of B.1.617.2 spike-coated beads or WT SARS-CoV-2 spike-coated beads or uncoated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing ACE2 (19-740AA) bait ( Figure 5A ). Summary of flow cytometry results ( Figure 5B ). Mean ± SEM (n = 3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p < 0.0001.

[0131] Figure 6 is a schematic diagram of the neutralization assay. Lentivirus carrying the GFP transfer plasmid was pseudotyped with the protrusion envelope protein to generate protrusion-LV. The protrusion-LV particles were pre-incubated with Thp1 effector cells expressing the CBR construct. After pre-incubation for 30 min to 2 hr, the cells were centrifuged and the supernatant was collected and incubated with HEK293T cells expressing the hACE2 receptor on the cell surface (ACE2-293). GFP was determined by flow cytometry + frequency to test the neutralization effect.

[0132] FIG. 7A to FIG. 7B Results from neutralization assays are shown. Flow cytometry of ACE2-293 target cells transduced after pre-incubation of virus with effector cells for 30 minutes ( Fig. 7A ). Summary of flow cytometry results ( Figure 7B ). Mean ± SEM (n = 2). One-way ANOVA followed by Holm-Sidak post-hoc analysis was performed for each MOI and compared with the mean of the control (no effector cells with virus). For MOI 0.1, ** / *** are compared with the control (no effector cells with virus).

[0133] Figure 8 It is a set of schematic diagrams of various chimeric decoy receptors (CBRs) and chimeric engulfment receptors (CPRs) provided by the present disclosure. The CBR construct includes ACE2 as a bait for viruses (e.g., SARS-COV-2), and the CPR construct includes anti-FLT3 scFv. The extracellular bait (e.g., ACE2) or antigen binding portion (e.g., anti-FLT3 scFv) is fused to the intracellular signaling domain of one of the following engulfment receptors: MERTK, MEGF10, Dectin-1, or CD163.

[0134] Figures 9A to 9CRepresentative flow cytometry plots showing phagocytosis of protrusion-coated and uncoated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with a MEGF10-based B4-AC construct containing an ACE2 (19-740AA) bait ( Fig.9A ). Summary of flow cytometry results ( Fig. 9B ). Mean ± SEM (n = 3). Two-way ANOVA followed by Tukey post hoc analysis. Microscope images of UTD and B4-AC Thp1 cells showing cell aggregation ( Fig. 9C ).

[0135] FIG. 10A to FIG. 10B Results from neutralization assays are shown. Representative flow cytometry images of ACE2-293 target cells transduced after pre-incubation of virus with effector cells for 2 hrs ( Fig. 10A ). Summary of flow cytometry results ( Fig. 10B ). Mean ± SEM (n = 2). One-way ANOVA followed by Holm-Sidak post hoc analysis.

[0136] Fig.11 is a set of schematic diagrams of various exemplary chimeric engulfment receptor (CPR) constructs provided by the present disclosure. The CPR constructs include anti-CD19 scFv or anti-CD20 scFv fused to the intracellular signaling domain of one of the following engulfment receptors: mannose receptor (F4), MERTK, MEGF10, Dectin-1, or CD163.

[0137] Fig.12 is a schematic diagram of an exemplary bait macrophage engager (BME) construct provided by the present disclosure, in which soluble CD163 (sCD163) is fused to ACE2 (19-740). DETAILED DESCRIPTION

[0138] The present disclosure provides novel chimeric decoy receptors (CBRs) to program immune cells (e.g., macrophages) responsible for innate immunity, to eliminate viral infections by destroying viruses that cause viral infections. The CBRs provided herein contain a portion of a protein that binds to a virus to infect human cells, and a portion of the protein acts as a decoy for the virus, thereby allowing immune cells to destroy it subsequently. Compared with other existing methods for combating viral infections, the major advantages of these CBRs include: persistence (e.g., insensitivity to mutations of target viruses due to the use of decoys); efficiency (e.g., CBRs are made from portions of naturally occurring proteins / receptors responsible for phagocytosis or endocytosis of macrophages, and give immune cells the ability to destroy invading pathogens); and versatility (CBRs are modular synthetic receptors that can be reconfigured to attack almost any virus, bacteria, or mammalian cells (including malignant cells)).

[0139] The CBR described herein includes an extracellular portion, which includes a binding region that specifically binds to a virus ("viral bait"); a transmembrane portion; and an intracellular portion, which includes an intracellular signaling region of an endocytic receptor. Typically, the virus binding region is not an antibody, but a receptor or protein on a host cell, to which the virus binds to infect the host cell. After the virus binds to the extracellular viral bait, the intracellular signaling region is activated, causing endocytosis of the virus. Therefore, CBR is particularly useful in methods for treating or preventing viral infections (e.g., SARS-CoV-2 infections) in subjects in need thereof.

[0140] The CBRs of the present disclosure can be reconfigured to replace the extracellular viral bait with an extracellular portion including an antigen binding portion. These reconfigured CBRs are referred to herein as chimeric engulfment receptors (CPRs) and are also provided by the present disclosure. These CPRs can be used to target any antigen, such as a tumor-associated antigen (TAA), to destroy any cell expressing the antigen on the surface. Therefore, these CPRs are particularly useful in methods of treating cancer in subjects in need thereof.

[0141] Also provided herein are decoy macrophage adapters (BME) and antigen macrophage adapters (AME), which are similar to CBR and CPR, respectively, in which the transmembrane part and the intracellular part are replaced by the ligand of the endocytic receptor. In other words, BME includes a binding region ("virus bait") that specifically binds to the virus and a ligand of the endocytic receptor, and AME includes an antigen binding portion and a ligand of the endocytic receptor. BME and AME play a role by inducing endocytosis of viruses or antigen presenting cells after the ligand portion binds to the endocytic receptor. Therefore, BME is particularly useful in methods for treating or preventing viral infections (e.g., SARS-CoV-2 infections) in subjects in need thereof, and AME is particularly useful in methods for treating cancer in subjects in need thereof.

[0142] definition

[0143] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by a person skilled in the art to which the claimed subject belongs. It should be understood that the general description above and the following detailed description are exemplary and illustrative only, and not limiting of any claimed subject matter. In this application, unless otherwise specifically stated, the use of the singular includes the plural. It must be noted that, as used in the specification and the appended claims, the singular forms "a / an" and "the" include plural indicators unless the context clearly indicates otherwise. In this application, unless otherwise stated, the use of "or" refers to "and / or". In addition, the use of the term "including" and other forms such as "include", "includes" and "included" is not restrictive. The section titles used herein are for organizational purposes only and should not be interpreted as limiting the described subject matter.

[0144] As used herein, the terms "about" and "approximately" when used to modify a numerical value or numerical range, mean that deviations of 5% to 10% above the value or range (e.g., up to 5% to 10% above) and 5% to 10% below the value or range (e.g., up to 5% to 10% below) are still within the intended meaning of the recited value or range.

[0145] As used herein, the term "extracellular" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are located outside of a cell.

[0146] As used herein, the term "transmembrane" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are embedded in the plasma membrane of a cell.

[0147] As used herein, the term "intracellular" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are located in the cytoplasm of a cell. The terms "cytoplasmic" and "intracellular" are interchangeable.

[0148] "Binding affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., CBR) and its binding partner (e.g., viral protein). Unless otherwise indicated, as used herein, "binding affinity" refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., CBR and viral protein). The affinity of a molecule X for its partner Y can generally be expressed by the dissociation constant (K D Affinity can be measured and / or expressed in a variety of ways known in the art, including but not limited to the equilibrium dissociation constant (K D ) and equilibrium association constant (K A ). D According to k off / k on The quotient of K A According to k on / k off Calculate the quotient of k on is the association rate constant, and k off k is the dissociation rate constant. on and k off It can be determined by techniques known to those of ordinary skill in the art, such as using As used herein, "lower affinity" refers to a larger K D .

[0149] For example, "specifically binds to" may be used to refer to the ability of a receptor to specifically bind to a particular ligand (e.g., an antigen or viral protein), and such binding is understood by those skilled in the art. For example, an antibody or antibody fragment that specifically binds to an antigen may bind to other antigens, usually with lower affinity, such as by, for example, Or as determined by other immunoassays known in the art (see, e.g., Savage et al., (1999) Immunity. 10(4):485-92, which is incorporated herein by reference in its entirety).

[0150] As used herein, "epitope" is a term in the art and refers to a local region of an antigen (e.g., a peptide or peptide-MHC complex) to which a CPR can bind. In certain embodiments, the epitope to which a CPR binds can be determined, for example, by NMR spectroscopy, X-ray diffraction crystallography, ELISA assays, hydrogen / deuterium exchange coupled to mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), flow cytometric analysis, mutagenesis mapping (e.g., site-directed mutagenesis mapping), and / or structural modeling. For X-ray crystallography, crystallization can be accomplished using any of the methods known in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4):339-350; McPherson A, (1990) Eur J Biochem 189:1-23; Chayen NE, (1997) Structure 5:1269-1274; McPherson A, (1976) J Biol Chem 251:6300-6303, each of which is incorporated herein by reference in its entirety). TCR:antigen crystals can be studied using well-known X-ray diffraction techniques and can be refined using computer software such as X-PLOR (Yale University, 1992, published by Molecular Simulations, Inc.; see, e.g., Meth Enzymol (1985) Vols. 114 and 115, edited by Wyckoff HW et al.; US2004 / 0014194); and BUSTER (Bricogne G, (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1):37-60; Bricogne G, (1997) Meth Enzymol 276A:361-423, edited by Carter CW; and Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10):1316-1323), each of which is incorporated herein by reference in its entirety. Mutagenesis mapping studies can be accomplished using any method known to those skilled in the art. Descriptions of mutagenesis techniques (including alanine scanning mutagenesis techniques) are described in, e.g., Champe M et al., (1995) J Biol Chem 270:1388-1394 and Cunningham BC & Wells JA, (1989) Science 244:1081-1085, each of which is incorporated herein by reference in its entirety.In a specific embodiment, alanine scanning mutagenesis studies are used to determine the epitope of the antigen. In a specific embodiment, hydrogen / deuterium exchange coupled to mass spectrometry is used to determine the epitope of the antigen. In certain embodiments, the antigen is a peptide-MHC complex. In certain embodiments, the antigen is a peptide presented by an MHC molecule.

[0151] As used herein, the terms "treat," "treating," and "treatment" refer to therapeutic or preventive measures as described herein. In some embodiments, the "treatment" method employs administering a CBR or CPR, or a cell expressing a CBR or CPR, to a subject suffering from a disease or condition or susceptible to such a disease or condition to prevent, cure, delay, alleviate the severity of the disease or condition or a recurring disease or condition, or to ameliorate one or more symptoms thereof, or to prolong the survival of the subject beyond the expected survival in the absence of such treatment.

[0152] As used herein, the term "effective amount" in the context of administering a therapy to a subject refers to that amount of the therapy that achieves the desired prophylactic or therapeutic effect.

[0153] As used herein, the term "subject" includes any human or non-human animal. In one embodiment, the subject is a human or non-human animal. In one embodiment, the subject is a human.

[0154] The determination of the "percentage of identity" between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be accomplished using a mathematical algorithm. A specific, non-limiting example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin S and Altschul SF, (1990) PNAS 87:2264-2268, as modified in Karlin S and Altschul SF, (1993) PNAS 90:5873-5877, each of which is incorporated herein by reference in its entirety. Such algorithms are incorporated into the NBLAST and XBLAST programs of Altschul SF et al., (1990) J Mol Biol 215:403, which is incorporated herein by reference in its entirety. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameter set (e.g., with score = 100, word length = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. BLAST protein searches can be performed with the XBLAST program parameter set (e.g., with score = 50, word length = 3) to obtain amino acid sequences homologous to protein molecules described herein. In order to obtain gapped alignments for comparison purposes, gap BLAST can be used as described in AltschulS F et al., (1997) Nuc Acids Res 25:3389-3402, which is incorporated herein by reference in its entirety. Alternatively, PSI BLAST can be used to perform iterative searches that detect distance relationships between molecules. Same as above. When utilizing BLAST, gap BLAST, and PSI BLAST programs, the default parameters of the corresponding programs (e.g., XBLAST and NBLAST) can be used (see, e.g., National Center for Biotechnology Information (NCBI) on the World Wide Web, ncbi.nlm.nih.gov). Another specific, non-limiting example of a mathematical algorithm for sequence comparison is the algorithm of Myers and Miller, (1988) CABIOS 4:11-17, which is incorporated herein by reference in its entirety. This algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package.When utilizing the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 may be used.

[0155] The percent identical between two sequences can be determined using techniques similar to those described above, with or without tolerance of gaps. In calculating the percent identical, typically only exact matches are counted.

[0156] As used herein, the term "operably linked" refers to a polynucleotide sequence element or an amino acid sequence element being connected in a functional relationship. For example, when a polynucleotide sequence is in a functional relationship with another polynucleotide sequence, the polynucleotide sequence is operably connected. In some embodiments, if a transcriptional regulatory polynucleotide sequence (e.g., a promoter, enhancer, or other expression control element) affects the transcription of a polynucleotide sequence encoding a protein, the transcriptional regulatory polynucleotide sequence is operably connected to the polynucleotide sequence encoding the protein. Operably connected elements may be continuous or non-continuous. In addition, in the context of a polypeptide, "operably linked" refers to a physical connection (e.g., directly or indirectly connected) between amino acid sequences (e.g., different segments, regions, or domains) to provide the activity of the polypeptide. In the present disclosure, each segment, region, or domain of a chimeric polypeptide of the present disclosure may be operably connected to retain the correct folding, processing, targeting, expression, binding, and other functional properties of the chimeric polypeptide in a cell. Unless otherwise indicated, the various regions, domains, and segments of a chimeric polypeptide of the present disclosure may be operably connected to each other. The operably linked regions, domains and segments of the chimeric polypeptides of the present disclosure may be contiguous or non-contiguous (eg, linked to each other by a linker).

[0157] As used herein, the term "polynucleotide" refers to a polymer of DNA or RNA. A polynucleotide sequence may be single-stranded or double-stranded; contain natural, non-natural or altered nucleotides; and contain natural, non-natural or altered internucleotide linkages, such as phosphoramidate linkages or phosphorothioate linkages, rather than the phosphodiester found between nucleotides of an unmodified polynucleotide sequence. Polynucleotide sequences include, but are not limited to, all polynucleotide sequences obtained by any means available in the art, including, but not limited to, recombinant means, such as cloning polynucleotide sequences from a recombinant library or a cell genome, using common cloning techniques and polymerase chain reaction, etc., as well as by synthetic means.

[0158] The terms "protein" and "polypeptide" are used interchangeably herein and refer to a polymer of amino acids linked by one or more peptide bonds. As used herein, "amino acid sequence" refers to information describing the relative order and identity of the amino acid residues that make up a polypeptide.

[0159] As used herein, the term "functional fragment" with respect to a protein or polypeptide refers to a reference protein fragment that retains at least one specific function. Not all functions of the reference protein need to be retained by the protein functional fragment. In some cases, one or more functions are selectively reduced or eliminated.

[0160] As used herein, the term "modification" with respect to a polynucleotide sequence refers to a polynucleotide sequence comprising at least one nucleotide substitution, change, inversion, addition or deletion compared to a reference polynucleotide sequence. As used herein, the term "modification" with respect to an amino acid sequence refers to an amino acid sequence comprising at least one amino acid residue substitution, change, inversion, addition or deletion compared to a reference amino acid sequence.

[0161] As used herein, the term "derived from" with respect to a polynucleotide sequence refers to a polynucleotide sequence that has at least 85% sequence identity with a naturally occurring reference nucleic acid sequence from which it is derived. The term "derived from" with respect to an amino acid sequence refers to an amino acid sequence that has at least 85% sequence identity with a naturally occurring reference amino acid sequence from which it is derived. As used herein, the term "derived from" does not indicate any specific process or method for obtaining a polynucleotide or amino acid sequence. For example, a polynucleotide or amino acid sequence can be chemically synthesized.

[0162] As used herein, the term "recombinant" or "engineered" nucleic acid molecule refers to a nucleic acid molecule that has been altered by human intervention. As a non-limiting example, a cDNA is a recombinant DNA molecule, such as any nucleic acid molecule produced by in vitro polymerases, or to which a linker has been attached, or which has been incorporated into a vector, such as a cloning vector or an expression vector.

[0163] As used herein, the term "host protein" refers to a cell-associated protein that a virus binds to during the process of infecting a cell. For example, for SARS-CoV-2, at least one host protein includes human angiotensin-converting enzyme 2 (ACE2). In some embodiments, the host protein can be an antibody or other immune system protein that specifically binds to a virus during the process of clearing the virus from an organism. In some embodiments, the host protein cannot be an antibody or other immune system protein that specifically binds to a virus during the process of clearing the virus from an organism.

[0164] As used herein, the term "vector" refers to a nucleic acid molecule or sequence capable of transferring or transporting another nucleic acid molecule. The transferred nucleic acid molecule is usually connected to the vector nucleic acid molecule, for example, inserted into the vector nucleic acid molecule.

[0165] Phagocytosis

[0166] Phagocytosis generally refers to the process of engulfment of cells or large particles (>0.5 μm), in which the binding of target cells or particles, engulfment of target cells or particles, and degradation of internalized target cells or particles occur. In certain embodiments, phagocytosis includes the formation of phagosomes surrounding internalized target cells or particles, and the fusion of phagosomes with lysosomes to form phagolysosomes, in which the contents are degraded. Therefore, "phagocytosis" includes the process of "efferocytosis", which specifically refers to the engulfment of apoptotic or necrotic cells in a non-inflammatory manner.

[0167] There are two main types of phagocytosis, which are affected by the target, cell type and surrounding environment. Antimicrobial phagocytosis removes and degrades pathogenic microorganisms, induces pro-inflammatory signaling through cytokine and chemokine secretion, and recruits immune cells to initiate an effective inflammatory response. This type of phagocytosis is generally referred to as "inflammatory phagocytosis" (or "immunogenic phagocytosis"). However, in some cases, such as in some persistent infection situations, anti-inflammatory responses may occur with the absorption of microorganisms. Antimicrobial phagocytosis is usually performed by professional phagocytes of the myeloid system (such as immature dendritic cells (DC) and macrophages) and by tissue-resident immune cells.

[0168] In contrast, phagocytosis (e.g., efferocytosis) of damaged autologous apoptotic cells or cell fragments is generally a non-inflammatory (also referred to as "non-immunogenic") process. Billions of damaged, dying, and unwanted cells undergo apoptosis every day. Unwanted cells include, for example, excess cells produced during development, senescent cells, infected cells (intracellular bacteria or viruses), transformed or malignant cells, and cells irreversibly damaged by cytotoxic agents. Phagocytic cells specifically and rapidly clear apoptotic cells without causing damage to surrounding tissues or inducing a pro-inflammatory immune response. The steps to clear apoptotic cells include: (1) release of a "find me" signal from apoptotic cells to recruit phagocytes to the location of the apoptotic cells; (2) "eat me" signals exposed on the surface of apoptotic cells are bound by phagocytes through specific receptors; (3) cytoskeletal rearrangement to engulf apoptotic cells; and (4) digestion of ingested apoptotic cells and induction of specific phagocytic responses (e.g., secretion of anti-inflammatory cytokines).

[0169] The terms "phagocytic cell" and "phagocyte" are used interchangeably herein and refer to cells capable of phagocytosis (e.g., ingestion of microorganisms and foreign matter), for example, capable of engulfing large particle masses (e.g., from about 0.1 μm in diameter up to about 2 mm or about 1 mm in diameter; about 0.5 μm in diameter to about 1 mm in diameter, etc.), particularly including up to the size of microbial cells or mammalian cells (e.g., tumor cells). As described above, phagocytosis encompasses engulfing cells, pathogens, and various particles by surrounding them with effector cell membranes. Thus, phagocytes protect the body by ingesting harmful foreign matter, bacteria, and dead or dying cells. These cells are essential for fighting infection and for subsequent immunity.

[0170] There are several types of phagocytes. Exemplary phagocytes include macrophages, mononuclear cells (tissue cells and monocytes), polymorphonuclear leukocytes (neutrophils) and dendritic cells. The phagocytes of humans and other jawed vertebrates are divided into "professional" and "non-professional" groups based on their efficiency in participating in phagocytosis. Professional phagocytes include various types of leukocytes (such as neutrophils, monocytes, macrophages, mast cells and dendritic cells). The main difference between professional phagocytes and non-professional phagocytes is that professional phagocytes have molecules called receptors on their surface, and receptors can detect harmful objects that are not usually present in the body, such as bacteria. Therefore, professional phagocytes can recognize a variety of phagocytic targets and can ingest them at a higher rate than non-phagocytic cells.

[0171] Dendritic cells (DC) refer to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. DCs are known as "professional" antigen presenting cells and have a strong ability to sensitize MHC-restricted T cells. DCs can be identified by function, phenotype and / or gene expression pattern, particularly cell surface phenotype. These cells are characterized by their unique morphology, high levels of surface MHC-II class expression, and the ability to present antigens to CD4+ and / or CD8+ T cells (particularly naive T cells).

[0172] Neutrophils and macrophages are representatives of fully differentiated phagocytes. While neutrophils that leave the bone marrow are fully differentiated, macrophages differentiate from circulating monocytes in extravascular tissues. Monocytes exhibit a lower phagocytic response compared to neutrophils and macrophages and must respond to activation and differentiation signals to achieve optimal phagocytic capacity. The monocyte to macrophage differentiation process is well characterized and can be performed in vitro or in vivo.

[0173] Macrophages are of particular interest. These immune cells can enter tumors and travel to cancers that are inaccessible to other parts of the immune system. Macrophages are key effectors of the innate immune system and are responsible for ingesting debris and pathogens. There is growing evidence that macrophages are abundant in the tumor microenvironment of multiple cancers, where they can adopt either a classically activated (M1, anti-tumor) or alternatively activated (M2, pro-tumor) phenotype. Macrophages are potent effectors of the innate immune system and are able to perform at least three distinct anti-tumor functions: phagocytosis, cytotoxicity, and antigen presentation to orchestrate adaptive immune responses. While T cells require antigen-dependent activation via T cell receptors or chimeric immune receptors, macrophages can be activated in a variety of ways. Direct macrophage activation is antigen-independent and relies on mechanisms such as pathogen-associated molecular pattern recognition via Toll-like receptors (TLRs). Macrophages are uniquely able to penetrate solid tumors, whereas other immune cells such as T cells are physically excluded or inactivated. This suggests that engineered macrophages may enhance existing T cell-based therapies.

[0174] Chimeric polypeptide

[0175] The present disclosure provides chimeric polypeptides, which include a portion that can specifically bind to an antigen and a portion that targets the chimeric polypeptide for endocytosis after binding to the antigen. As described in further detail below, the antigen can be a viral protein, and the portion that can specifically bind to the viral protein can be a binding region that binds to the virus on a host cell. In other embodiments, the antigen can be a tumor-associated antigen (TAA), and the portion that can specifically bind to the TAA can be an antigen binding portion, such as an antibody or a fragment thereof. The portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis can be an intracellular (i.e., cytoplasmic) signaling region of an endocytic receptor. In other embodiments, the portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis can be a ligand of an endocytic receptor.

[0176] In one aspect, the present disclosure provides a chimeric decoy receptor (CBR), which includes a) an extracellular portion that is capable of specifically binding to a viral protein, b) a transmembrane portion, and c) an intracellular portion that contains an intracellular signaling region of an endocytic receptor. In some embodiments, the extracellular portion is not an antibody. In some embodiments, the extracellular portion specifically binds to a viral protein that binds to a host cell and attaches the virus to the host cell. In some embodiments, the intracellular portion contains an intracellular signaling region of an endocytic receptor selected from a phagocytic receptor or a scavenger receptor. The transmembrane portion can be any transmembrane portion that can express a CBR on the surface of a cell (particularly a phagocytic cell). In some embodiments, the transmembrane portion can be a transmembrane portion of an endocytic receptor. In some embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from the same endocytic receptor. In other embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from different endocytic receptors. In other embodiments, the transmembrane portion is not derived from an endocytic receptor.

[0177] As a proof of concept, an exemplary CBR of the present disclosure was developed for programming macrophages to neutralize the SARS-CoV-2 virus by phagocytosis. The exemplary CBR contains an angiotensin-converting enzyme 2 (ACE2) portion, to which the SARS-CoV-2 virus binds to infect cells. When macrophages express the CBR, the ACE2 portion is presented on the cell surface as a bait for the virus. It has been shown that macrophages expressing CBRs for SARS-CoV-2 selectively engulf 1) beads with SARS-CoV-2 spike envelope proteins from multiple variants attached; and 2) live lentivirus carrying SARS-COV-2 virus (pseudotype) spike envelope proteins.

[0178] Thus, in some embodiments, the extracellular portion of the CBR of the present disclosure contains an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, the CBR of the present disclosure contains a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, multiple EGF-like moieties 10 (MEGF10), and CD163, and c) an intracellular signaling region of an endocytic receptor selected from the group consisting of mannose receptor, MERTK, dectin-1, MEGF10, and CD163.

[0179] In some embodiments, the CBRs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of a mannose receptor, and c) an intracellular signaling region of a mannose receptor.

[0180] In some embodiments, the CBRs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of MERTK, and c) an intracellular signaling region of MERTK.

[0181] In some embodiments, the CBRs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of dectin-1, and c) an intracellular signaling region of dectin-1.

[0182] In some embodiments, the CBRs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of MEGF10, and c) an intracellular signaling region of MEGF10.

[0183] In some embodiments, the CBRs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of CD163, and c) an intracellular signaling region of CD163.

[0184] In some embodiments, the CBR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 to 67.

[0185] In another aspect, the present disclosure provides a chimeric engulfment receptor (CPR) comprising a) an extracellular portion including an antigen binding portion, b) a transmembrane portion, and c) an intracellular portion containing an intracellular signaling region of an endocytic receptor. In some embodiments, the extracellular portion is an antibody or a fragment thereof (such as a single-chain variable fragment (scFv) or a single-part antibody (sdAb) variable portion). In some embodiments, the extracellular portion specifically binds to a tumor-associated antigen (TAA). In some embodiments, the intracellular portion contains an intracellular signaling region of an endocytic receptor selected from an engulfment receptor or a scavenger receptor. The transmembrane portion may be any transmembrane portion capable of expressing a CBR on the surface of a cell (particularly a phagocytic cell). In some embodiments, the transmembrane portion may be a transmembrane portion of an endocytic receptor. In some embodiments, the transmembrane portion and the intracellular portion of the CBR may be derived from the same endocytic receptor. In other embodiments, the transmembrane portion and the intracellular portion of the CBR may be derived from different endocytic receptors. In other embodiments, the transmembrane portion is not derived from an endocytic receptor.

[0186] In some embodiments, a CPR of the present disclosure does not include a recruitment moiety, the moiety is not an endocytic receptor intracellular region, and the moiety binds to a cytoplasmic protein of a phagocytic signaling pathway.

[0187] The exemplary CPR disclosed herein is designed to target cancer cells for phagocytosis. The exemplary CPR contains an scFv specifically bound to an antigen selected from FLT3, CD19 or CD20. Similar to the CBR described above, when macrophages express CPR, scFv is presented on the cell surface as a bait for cancer cells expressing tumor-associated antigens (such as FLT3, CD19 or CD20). Therefore, macrophages expressing CPR provide an alternative to conventional chimeric antigen receptors (CAR)-T and / or T cell receptors (TCR)-T cells currently being developed as cancer therapeutics. For example, in recent years, T cells expressing CARs for CD19 have been shown to have significant anti-leukemia efficacy, with 90% of acute lymphoblastic leukemia patients receiving treatment having been completely relieved. These results are accompanied by strong T cell proliferation, and clearly record the infiltration of T cells in leukemia patients treated in this way into the tumor site. Despite showing high response rates in hematopoietic malignancies, CAR-T cells may have limited efficacy against solid tumors and certain lymphoid neoplasms. Possible explanations for this include possible impaired ability of T cells to infiltrate solid tumors, poor trafficking, immunosuppressive tumor microenvironment, and less tumor-specific antigen expression on solid tumor cells.

[0188] In contrast, macrophages are uniquely able to be enriched in the tumor microenvironment where T cells are usually excluded. Therefore, the use of CPR-expressing macrophages disclosed herein provides a unique and potentially synergistic approach to existing CAR-T therapies. In addition, CPR-expressing macrophages can serve as bait for metastatic cancer cells to spread throughout the body. Therefore, the present disclosure provides the use of CPRs to treat cancer, and will be further described herein.

[0189] In some embodiments, the extracellular portion of the CPR of the present disclosure contains an antigen binding portion that specifically binds to a tumor-associated antigen, including, but not limited to, an antigen selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, prostate enzymes, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide (e.g., O-glycans composed of a single N-acetylgalactosamine-GalNAc, referred to as Tn antigens) and IGLL1. In certain embodiments, the extracellular portion of the CPR disclosed herein contains an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20 and FLT3. In certain embodiments, the antigen-binding portion is a scFv.

[0190] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20 and FLT3, b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, multiple EGF-like moieties 10 (MEGF10) and CD163, and c) an intracellular signaling region of an endocytic receptor selected from the group consisting of mannose receptor, MERTK, dectin-1, MEGF10 and CD163.

[0191] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of a mannose receptor, and c) an intracellular signaling region of a mannose receptor.

[0192] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of MERTK, and c) an intracellular signaling region of MERTK.

[0193] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of dectin-1, and c) an intracellular signaling region of dectin-1.

[0194] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of MEGF10, and c) an intracellular signaling region of MEGF10.

[0195] In some embodiments, the CPR of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of CD163, and c) an intracellular signaling region of CD163.

[0196] In some embodiments, the CPR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 86 to 103.

[0197] In another aspect, the present disclosure provides a decoy macrophage adapter (BME) comprising a) a binding region that specifically binds to a virus, and b) a ligand for an endocytic receptor. In some embodiments, the binding region is not an antibody. In some embodiments, the binding region specifically binds to a viral protein that binds to a host cell and attaches the virus to the host cell. In some embodiments, the ligand is a ligand for an endocytic receptor selected from a phagocytic receptor or a scavenger receptor. In some embodiments, the ligand is one or more of the following: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptide, high-density cholesterol (HDL), lectin, selectin, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA also known as hyaluronic acid), microtubule-associated protein Tau (MAPT), or a fragment of any ligand described herein.

[0198] The exemplary BME of the present disclosure was developed to neutralize the SARS-CoV-2 virus by phagocytosis. The exemplary BME contains an ACE2 portion fused to a soluble CD163 (sCD163). sCD163 is a natural scavenger that participates in the recycling of iron by recruiting macrophages. Therefore, BME containing ACE2 and sCD163 can be used as a substitute for neutralizing antibodies against SARS-CoV-2. BME will recruit macrophages through CD163 instead of recruiting immune cells through Fc.

[0199] Thus, in some embodiments, the binding region of the BME of the present disclosure contains a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, the BME of the present disclosure contains a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for an endocytic receptor selected from the group consisting of: mannose receptor, MERTK, dectin-1, MEGF10, and CD163.

[0200] In some embodiments, the BMEs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for the mannose receptor, such as mannose or a fragment thereof.

[0201] In some embodiments, the BMEs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for MERTK, such as growth arrest-specific factor 6 (Gas6) or protein S (Pros1), or fragments thereof.

[0202] In some embodiments, the BMEs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for dectin-1, such as β-glucan.

[0203] In some embodiments, the BMEs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for MEGF10, such as C1q or a fragment thereof.

[0204] In some embodiments, the BMEs of the present disclosure contain a) an ACE2 portion sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for CD163, such as sCD163 or a fragment thereof.

[0205] In some embodiments, the BME of the present disclosure comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 107.

[0206] In another aspect, the present disclosure provides an antigen macrophage engager (AME) comprising a) an antibody that binds to an antigen expressed on the surface of a cancer cell, and b) a ligand for an endocytic receptor. In some embodiments, the antibody comprises a single chain variable fragment (scFv) or a single part antibody (sdAb) variable portion, or alternatively consists of a single chain variable fragment (scFv) or a single part antibody (sdAb) variable portion. In some embodiments, the ligand is a ligand for an endocytic receptor selected from a phagocytic receptor or a scavenger receptor.

[0207] The exemplary AMEs disclosed herein target cancer cells for phagocytosis. The exemplary AMEs contain scFvs that specifically bind to an antigen selected from FLT3, CD19, or CD20. Similar to the CPRs described above, scFvs act as baits for cancer cells expressing tumor-associated antigens such as FLT3, CD19, or CD20. After the ligand portion of the AME binds to its corresponding endocytic receptor, phagocytosis of the AME and the attached cancer cells will occur. Therefore, AMEs can also be used as cancer therapeutic agents.

[0208] In some embodiments, the AME of the present disclosure contains an antibody or an antigen-binding portion thereof that specifically binds to a tumor-associated antigen, including, but not limited to, an antigen selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, prostate enzymes, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide and IGLL1. In certain embodiments, the AME of the present disclosure contains an antibody or an antigen-binding portion thereof, which specifically binds to an antigen selected from the group consisting of CD19, CD20 and FLT3. In certain embodiments, the antibody or antigen-binding portion thereof is a scFv.

[0209] In some embodiments, the AME of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20 and FLT3, b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), multiple EGF-like moieties 10 (MEGF10) and CD163, and c) a ligand for an endocytic receptor selected from the group consisting of mannose receptor, MERTK, dectin-1, MEGF10 and CD163.

[0210] In some embodiments, the AME of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for the mannose receptor, such as mannose or a fragment thereof.

[0211] In some embodiments, the AME of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20 and FLT3, and b) a ligand of MERTK, such as growth arrest-specific factor 6 (Gas6) or protein S (Pros1), or a fragment thereof.

[0212] In some embodiments, the AME of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand of MEGF10, such as C1q or a fragment thereof.

[0213] In some embodiments, the AME of the present disclosure contains a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for CD163, such as sCD163 or a fragment thereof.

[0214] In some embodiments, the chimeric polypeptide of the present invention contains a portion of the extracellular domain of an endocytic receptor. For example, the CBR of the present invention may include a binding region that specifically binds to a virus and is fused to a portion of an endocytic receptor, and a portion of the endocytic receptor includes a portion of the extracellular domain of the endocytic receptor, a transmembrane domain, and an intracellular domain. Similarly, the CPR of the present invention may include an antigen binding portion fused to a portion of an endocytic receptor, and a portion of the endocytic receptor includes a portion of the extracellular domain of the endocytic receptor, a transmembrane domain, and an intracellular domain. In some embodiments, the chimeric polypeptide of the present invention includes a full-length endocytic receptor (e.g., the entire extracellular domain, transmembrane domain, and intracellular domain of an endocytic receptor). For example, the CBR of the present invention may include a binding region that specifically binds to a virus and is fused to a full-length endocytic receptor. Similarly, the CPR of the present invention may include an antigen binding portion fused to a full-length endocytic receptor.

[0215] Non-limiting examples of sequences that can be used to generate chimeric polypeptides of the present disclosure are provided in Table 1.

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281] In some embodiments, the chimeric polypeptides of the present disclosure may further include one or more linkers between the various parts of the chimeric polypeptide. For example, the CBR or CPR of the present disclosure may include one or more linkers between the extracellular portion and the transmembrane portion and / or between the transmembrane portion and the intracellular portion. The BME may include one or more linkers between the binding region and the endocytic receptor ligand. The AME may include one or more linkers between the antibody and the endocytic receptor ligand. Those skilled in the art will understand that any linker that maintains the function of the chimeric polypeptide may be used. There is no particular limitation on the linkers that can be used in the chimeric polypeptides described herein. In some embodiments, the linker includes a peptide linker / spacer sequence. In some embodiments, the linker is a synthetic compound linker, such as, for example, a chemical cross-linking agent. Non-limiting examples of suitable cross-linking agents available on the market include N-hydroxysuccinimide (NHS), disuccinimidyl suberate (DSS), di(sulfosuccinimidyl) suberate (BS3), disulfobis(succinimidyl propionate) (DSP), disulfobis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfo-EGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidyloxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidyloxycarbonyloxy)ethyl]sulfone (sulfo-BSOCOES).

[0282] In certain embodiments, the joint includes a peptide joint sequence. In principle, there is no particular restriction on the length and / or amino acid composition of the joint peptide sequence. In certain embodiments, any arbitrary single-stranded peptide including about one to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a peptide joint. In certain embodiments, the joint peptide sequence includes about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the joint peptide sequence comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, about 50 to 70 amino acid residues. In certain embodiments, the joint peptide sequence includes about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90 or about 80 to 100 amino acid residues. In certain embodiments, the joint peptide sequence includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues. In certain embodiments, the joint peptide sequence may include up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids. In some embodiments, a short oligomeric or polypeptide linker, preferably between 2 and 10 amino acids in length, can form the connection between the extracellular domain and the transmembrane domain of the chimeric polypeptides of the present disclosure.

[0283] In some embodiments, the length and amino acid composition of the linker peptide sequence can be optimized to change the direction and / or proximity of the polypeptide domains to each other to achieve the expected activity of the chimeric polypeptide. In some embodiments, the direction and / or proximity of the polypeptide domains to each other can be optimized to produce a partial to complete engulfment form of the chimeric polypeptide. In certain embodiments, the linker contains only glycine and / or serine residues (e.g., glycine-serine linkers). Examples of such peptide linkers include: Gly(x)Ser, wherein x is 0 to 6; or Ser Gly(x), wherein x is 0 to 6; (Gly Gly Gly Gly Ser)n, wherein n is an integer of one or more; and (Ser Gly Gly Gly Gly)n, wherein n is an integer of one or more. In some embodiments, the linker peptide is modified so that the amino acid sequence GSG (appearing at the junction of the traditional Gly / Ser linker peptide repeats) does not exist. For example, in some embodiments, the peptide linker comprises an amino acid sequence selected from the group consisting of: (GGGXX)nGGGGS and GGGGS(XGGGS)n, wherein X is any amino acid that can be inserted into the sequence and does not produce a polypeptide comprising the sequence GSG, and n is 0 to 4. In some embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, and X1 is P, and X2 is S, and n is 0 to 4. In some other embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, and X1 is G, and X2 is Q, and n is 0 to 4. In some other embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, and X1 is G, and X2 is A, and n is 0 to 4. In yet another embodiment, the sequence of the linker peptide is GGGGS(XGGGS)n, and X is P, and n is 0 to 4. In some embodiments, the linker peptide of the present disclosure comprises the amino acid sequence (GGGGA) 2 GGGGS or consisting of this amino acid sequence. In some embodiments, the linker peptide comprises the amino acid sequence (GGGGQ) 2 GGGGS or consisting of this amino acid sequence. In another embodiment, the linker peptide comprises the amino acid sequence (GGGPS) 2 In another embodiment, the linker peptide comprises the amino acid sequence GGGGS (PGGGS) 2 In another embodiment, the linker peptide comprises the amino acid sequence GSGGS or SGGSGS, or consists of the amino acid sequence GSGGS or SGGSGS. In certain embodiments, the linker peptide comprises the amino acid sequence GGGGSGGGSGGGSGGGGS or consists of the amino acid sequence.

[0284] In some embodiments, the linker is the hinge region of a protein, such as the CD8 hinge region.

[0285] In some embodiments, the chimeric polypeptide further includes a signal peptide operably connected upstream (e.g., N-terminally) to the extracellular domain. Any signal peptide that targets the cell membrane of the protein to the phagocytic cell can be used. In some embodiments, the signal peptide is derived from a phagocytic receptor. In some embodiments, the signal peptide is derived from a T cell receptor or a co-receptor. In certain embodiments, the signal peptide is selected from a CD8 signal peptide and a mannose receptor signal peptide. In some embodiments, the chimeric polypeptide does not include its corresponding signal peptide.

[0286] In some embodiments, the chimeric polypeptide further comprises a label. Suitable labels for protein detection and / or purification are known in the art, and any of these labels may be included in the chimeric polypeptide described herein. Exemplary labels include, but are not limited to, polyhistidine tags, maltose binding protein tags, glutathione-S-transferase tags, and calmodulin binding protein tags. In some embodiments, the chimeric polypeptide does not include a label.

[0287] Virus binding peptide

[0288] In some embodiments, a chimeric polypeptide described herein includes an extracellular portion that contains a binding region that specifically binds to a virus (eg, a virus-binding polypeptide).

[0289] In some embodiments, the virus binding polypeptide is a portion of angiotensin converting enzyme 2 (ACE2), a receptor to which the SARS-CoV-2 virus binds to infect cells. Thus, in some embodiments, the virus binding polypeptide is a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, ACE2 is human ACE2 (SEQ ID NO: 2). In some embodiments, the virus binding polypeptide comprises amino acids 19-358, 19-605, or 19-740 of SEQ ID NO: 2, provided herein as SEQ ID NO: 4, 6, and 8, respectively. Thus, in some embodiments, the virus binding polypeptide comprises, or alternatively consists of, an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0290] In some embodiments, the virus-binding polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8. In some embodiments, the virus-binding polypeptide comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0291] In some embodiments, the virus binding polypeptide is part of a receptor to which the HIV virus binds to infect cells, including, for example, CD4, CCR5, and CXCR4. In some embodiments, the virus binding polypeptide is a part of CD4 sufficient to bind to HIV, such as, for example, the CD4 extracellular domain or a fragment thereof. In some embodiments, the virus binding polypeptide is a part of CCR5 sufficient to bind to HIV, such as, for example, the CCR5 extracellular domain or a fragment thereof. In some embodiments, the virus binding polypeptide is a part of CXCR4 sufficient to bind to HIV, such as, for example, the CXCR4 extracellular domain or a fragment thereof.

[0292] In some embodiments, the virus binding polypeptide is part of a receptor to which a filovirus (such as Ebola or Marburg) binds to infect a cell, including, for example, T cell Ig and mucin domain 1 (TIM-1). In some embodiments, the virus binding polypeptide is a portion of TIM-1 sufficient to bind to a filovirus, such as, for example, a TIM-1 extracellular domain or a fragment thereof.

[0293] In some embodiments, the virus binding polypeptide is part of a receptor to which the measles virus binds to infect cells, including, for example, CD46 and SLAMF1 (CD150). In some embodiments, the virus binding protein is a part of CD46 sufficient to bind to the measles virus, such as, for example, the CD46 extracellular domain or a fragment thereof. In some embodiments, the virus binding protein is a part of SLAMF1 sufficient to bind to the measles virus, such as, for example, the SLAMF1 extracellular domain or a fragment thereof.

[0294] Antigen Binding Peptides

[0295] In some embodiments, the chimeric polypeptides described herein include antigen binding moieties that are bound to one or more target antigens of interest. In some embodiments, the antigen binding moiety is bound to one or more target antigens expressed on the surface of the target cell (e.g., cell surface markers). Examples of cell surface markers that can serve as antigens bound to the antigen binding moiety of the chimeric polypeptide include those associated with viruses, bacteria and parasitic infections, autoimmune diseases and cancer cells. In some embodiments, the antigen binding moiety is bound to a cancer-associated antigen, such as a tumor antigen, such as an antigen that is specific to a tumor or cancer of interest. Therefore, in some embodiments, the extracellular domain of the chimeric polypeptide includes an antigen binding moiety that is bound to a cancer-associated antigen that is specific to one or more cancers. Typically, a cancer-associated antigen can be any cancer-associated antigen. Suitable cancer-associated antigens include, but are not limited to, CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, prostate enzymes, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, and IGLLE. In some embodiments, one or more cancer-associated antigens are selected from the group consisting of FLT3, CD19, and CD20.

[0296] The binding domain includes any naturally occurring, synthetic, semisynthetic or recombinantly produced binding partner for a biomolecule or other target of interest. In some embodiments, the binding region is an antigen binding region, such as an antibody or its functional binding domain or antigen binding portion thereof. The antigen binding region may include any domain that binds to an antigen, and may include but is not limited to monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragment thereof. Therefore, in some embodiments, the antigen binding domain portion includes a mammalian antibody or a fragment thereof. Non-limiting examples of antigen binding regions suitable for chimeric polypeptides of the present disclosure include antigen binding fragments (Fab), single-chain variable fragments (scFv), nanobodies, VH domains, VL domains, single domain antibodies (sdAb), VNAR domains and VHH domains, bispecific antibodies, double antibodies, or any functional fragment thereof.

[0297] In some embodiments, "antigen-binding fragment" refers to an antibody fragment, such as, for example, a diabody, Fab, Fab', F(ab')2, an Fv fragment, a disulfide-stabilized Fv fragment (dsFv), (dsFv)2, a bispecific dsFv (dsFv-dsFv'), a disulfide-stabilized diabody (dsdiabody), a single-chain antibody molecule (scFv), a scFv dimer (bivalent diabody), a multispecific antibody formed from a portion of an antibody including one or more CDRs. Both blocking antibodies and non-blocking antibodies are suitable. As used herein, the term "blocking" antibody or "antagonist" antibody refers to an antibody that prevents, inhibits, blocks or reduces the biological or functional activity of the antigen to which it binds. A blocking antibody or antagonist antibody can substantially or completely prevent, inhibit, block or reduce the biological activity or function of an antigen. For example, a blocking anti-CD 19 antibody can prevent, inhibit, block or reduce the binding interaction between CD 19 and its natural ligand (e.g., CD77), thereby preventing, blocking, inhibiting or reducing the immunosuppressive function associated with the CD19 / CD77 interaction. The term "non-blocking" antibody refers to an antibody that does not interfere with, inhibit, block or reduce the biological or functional activity of the antigen to which it binds.

[0298] Therefore, in some embodiments, the antigen binding portion of the chimeric polypeptide described herein includes an amino acid sequence of an antibody selected from the group consisting of an antigen binding fragment (Fab), a single chain variable fragment (scFv), a nanobody, a VH domain, a VL domain, a single domain antibody (dAb), a VNAR domain and a VHH domain, a bispecific antibody, a diabody, or a functional fragment of any of the foregoing. In some embodiments, the antigen binding portion includes a heavy chain variable region and a light chain variable region.

[0299] In some embodiments, the heavy chain variable region and the light chain variable region of the antigen binding region are operably connected to each other by one or more intervening amino acid residues positioned between the heavy chain variable region and the light chain variable region. In some embodiments, the one or more intervening amino acid residues include a linker peptide sequence.

[0300] In some embodiments, the antigen binding region is derived from the same cell type or the same species that the chimeric polypeptide is ultimately used in. For example, for use in humans, the antigen binding region of the chimeric polypeptide includes a human antibody, a humanized antibody, or a fragment thereof.

[0301] Endocytic receptors

[0302] In some embodiments, the chimeric polypeptides described herein include a portion of an endocytic receptor. In some embodiments, the chimeric polypeptides described herein include a portion of an endocytic receptor, the portion of the endocytic receptor including one or more of an extracellular domain or a fragment thereof, a transmembrane domain or a fragment thereof, and an intracellular domain or a fragment thereof. In some embodiments, the chimeric polypeptides described herein include an intracellular signaling region of an endocytic receptor. In some embodiments, the chimeric polypeptides described herein include a transmembrane domain and an intracellular domain of an endocytic receptor.

[0303] The intracellular signaling region of an endocytic receptor refers to an intracellular effector domain that activates one or more signaling pathways in a host cell after binding to a target molecule (e.g., a viral antigen or a tumor-associated antigen) targeted by the extracellular domain of a chimeric polypeptide expressed by a host cell, thereby causing endocytosis, including in certain embodiments, rearrangement of the host cell's cytoskeleton and internalization of target cells, microorganisms, or particles associated with the antigen. In some embodiments, the intracellular signaling domain activates one or more signaling pathways, thereby causing phagocytosis of target cells, microorganisms, or particles.

[0304] In some embodiments, the intracellular signaling domain from the endocytic receptor can mediate the endogenous phagocytic signaling pathway. In some embodiments, the intracellular domain of the chimeric polypeptide includes a domain responsible for signal activation and / or transduction. Non-limiting examples of intracellular domains suitable for chimeric polypeptides disclosed herein include cytoplasmic portions of surface receptors that can initiate signal transduction in phagocytic cells (e.g., monocytes, macrophages, or dendritic cells), as well as any derivatives or variants of these elements and any synthetic sequences with the same functional capabilities. In some embodiments, the chimeric polypeptides of the present disclosure include at least one intracellular domain derived from, for example, mannose receptors, MER proto-oncogene tyrosine kinases (MERTK), dectin-1, and scavenger receptor endocytic receptors.

[0305] In some embodiments, the scavenger receptor is a member of scavenger receptor class A, B, C, D, E, F, G, H, IK, J, K or L. Examples of scavenger receptors suitable for use in the chimeric polypeptides of the present disclosure include, but are not limited to, scavenger receptor type A class I / II (SR AI / II), macrophage receptor with collagen structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor type B class I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX), scavenger receptor-1 containing a linker domain (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor type L class I (SR-L1).

[0306] In some embodiments, the chimeric polypeptide of the present disclosure comprises a portion of an endocytic receptor, the portion of the endocytic receptor comprising an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 (mannose receptor 82 amino acid C-terminal fragment); SEQ ID NO: 12 (mannose receptor 96 amino acid C-terminal fragment); SEQ ID NO: 14 (MERTK C-terminal fragment); SEQ ID NO: 16 (dectin-1 N-terminal fragment); SEQ ID NO: 18 (dectin-1 full-length protein); SEQ ID NO: 20 (FcγR intracellular fragment); SEQ ID NO: 22 (SR-AI / II fragment); SEQ ID NO: 24 (MARCO fragment); SEQ ID NO: 26 (SCARA5 receptor fragment); SEQ ID NO: 28 (SRCL fragment); SEQ ID NO: 30 (CD36 fragment); SEQ ID NO: 32 (SR-BI fragment); SEQ ID NO: 34 (CD68 fragment); SEQ ID NO: 35 (CD48 fragment); SEQ ID NO: 36 (CD50 fragment); SEQ ID NO: 37 (CD61 ​​fragment); SEQ ID NO: 38 (CD62 fragment); SEQ ID NO: 39 (CD63 fragment); SEQ ID NO: 40 (CD64 fragment); SEQ ID NO: 41 (CD65 fragment); SEQ ID NO: 42 (CD66 fragment); SEQ ID NO: 43 (CD67 fragment); SEQ ID NO: 44 (CD68 fragment); SEQ ID NO: 45 (CD69 fragment); SEQ ID NO: 46 (CD68 fragment); SEQ ID NO: 47 (CD69 fragment); SEQ ID NO: 48 (CD69 fragment); SEQ ID NO: 49 (CD69 fragment); SEQ ID NO: 50 (CD69 fragment); SEQ ID NO: 51 (CD6 SEQ ID NO:36 (LOX-1 fragment); SEQ ID NO:38 (SREC fragment); SEQ ID NO:40 (MEGF10 fragment); SEQ ID NO:42 (SR-PSOX fragment); SEQ ID NO:44 (FEEL-1 fragment); SEQ ID NO:46 (CD163 fragment); SEQ ID NO:48 (RAGE fragment); SEQ ID NO:50 (CD44 fragment); and SEQ ID NO:52 (SR-L1 fragment).

[0307] In some embodiments, the chimeric polypeptides of the present disclosure include a portion of an endocytic receptor comprising an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 (mannose receptor 82 amino acid C-terminal fragment); SEQ ID NO: 12 (mannose receptor 96 amino acid C-terminal fragment); SEQ ID NO: 14 (MERTK C-terminal fragment); SEQ ID NO: 16 (dectin-1 N-terminal fragment); SEQ ID NO: 18 (dectin-1 full-length protein); SEQ ID NO: 20 (FcγR intracellular fragment); SEQ ID NO: 22 (SR-AI / II fragment); SEQ ID NO: 24 (MARCO fragment); SEQ ID NO: 26 (SCARA5 receptor fragment); SEQ ID NO: 28 (SRCL fragment); SEQ ID NO: 30 (CD36 fragment); SEQ ID NO: 31 (CD36 fragment); SEQ ID NO: 32 (CD36 fragment); SEQ ID NO: 33 (CD36 fragment); SEQ ID NO: 34 (CD36 fragment); SEQ ID NO: 35 (CD36 fragment); SEQ ID NO: 36 (CD36 fragment); SEQ ID NO: 37 (CD36 fragment); SEQ ID NO: 38 (CD36 fragment); SEQ ID NO: 39 (CD36 fragment); SEQ ID NO: 40 (CD36 fragment); SEQ ID NO: 41 (CD36 fragment); SEQ ID NO: 42 (CD36 fragment); SEQ ID NO: 43 (CD36 fragment); SEQ ID NO: 44 (CD36 fragment); SEQ ID NO: 45 (CD36 fragment); SEQ ID NO: 46 (CD36 fragment); SEQ ID NO: ID NO:32 (SR-BI fragment); SEQ ID NO:34 (CD68 fragment); SEQ ID NO:36 (LOX-1 fragment); SEQ ID NO:38 (SREC fragment); SEQ ID NO:40 (MEGF10 fragment); SEQ ID NO:42 (SR-PSOX fragment); SEQ ID NO:44 (FEEL-1 fragment); SEQ ID NO:46 (CD163 fragment); SEQ ID NO:48 (RAGE fragment); SEQ ID NO:50 (CD44 fragment); and SEQ ID NO:52 (SR-L1 fragment).

[0308] In some embodiments, the chimeric polypeptides of the present disclosure do not include a recruitment portion. In the context of the present disclosure, the recruitment portion does not encompass the intracellular region of the endocytic receptor. Instead, the recruitment portion binds to the cytoplasmic protein of the engulfment signaling pathway and is generally used to activate and / or enhance the activity of the endogenous engulfment signaling pathway. Examples of recruitment portions include, but are not limited to: a p85-recruitment portion that binds to the p85 regulatory subunit of phosphatidylinositol 3-kinase (PI3K); an SH3 portion that is derived from Crk, Cdc25, phospholipase, Ras, Vav, GRB2, FAK, Pyk2, TRIP10 or Gads; and a proline-rich peptide sequence that is derived from C3G, p41, PEP, p4'7, HPK1, SLP-1, CD3.ε, PAK, AIP4 or Sos, wherein the proline-rich peptide sequence binds to a protein containing an SH3 portion. In some embodiments, the recruitment moiety is a p85-recruiting moiety derived from CD19, Gab2, IREM-1, PDGF receptor, CSFR-1, c-Kit, ErbB3, or CD7.

[0309] Endocytosis of receptor ligands

[0310] In some embodiments, the chimeric polypeptide described herein includes a ligand of an endocytic receptor. The endocytic receptor can be any endocytic receptor described herein. In some embodiments, the ligand is one or more of the following: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptides, high-density cholesterol (HDL), lectins, selectins, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA, also known as hyaluronic acid), microtubule-associated protein Tau (MAPT), or a fragment of any ligand described herein. Examples of ligands for endocytic receptors include, but are not limited to, ligands for the mannose receptor, such as mannose or a fragment thereof; ligands for MERTK, such as growth arrest-specific factor 6 (Gas6) or protein S (Pros1), or a fragment thereof; ligands for dectin-1, such as β-glucan; ligands for MEGF10, such as C1q or a fragment thereof; and ligands for CD163, such as soluble CD163 of a fragment thereof. In some embodiments, the ligand is soluble CD163 (sCD163). In some embodiments, the ligand comprises an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 105.

[0311] Carrier

[0312] In one aspect, recombinant vectors are provided herein, which include nucleic acid molecules capable of expressing one or more chimeric polypeptides of the present disclosure. Some embodiments disclosed herein relate to isolated, synthetic or recombinant nucleic acid molecules, expression cassettes, and expression vectors containing these nucleic acid molecules encoding chimeric polypeptides of the present disclosure. In some embodiments, the isolated, synthetic or recombinant nucleic acid molecules of the present disclosure are operably linked to regulatory sequences that allow expression of the chimeric polypeptide in a host cell or in vitro cell-free expression system.

[0313] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to both RNA molecules and DNA molecules, including nucleic acid molecules comprising cDNA, genomic DNA, synthetic DNA, and DNA molecules or RNA molecules containing nucleic acid analogs. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense strand or antisense strand). Nucleic acid molecules can contain unconventional nucleotides or modified nucleotides. As used herein, the terms "polynucleotide sequence" and "nucleic acid sequence" refer interchangeably to the sequence of a polynucleotide molecule.

[0314] As used herein, the term "recombinant" nucleic acid molecule refers to a nucleic acid molecule that has been altered by human intervention. As a non-limiting example, cDNA is a recombinant DNA molecule, such as any nucleic acid molecule generated by an in vitro polymerase reaction, or any nucleic acid molecule to which a linker has been attached, or any nucleic acid molecule that has been integrated into a vector (such as a cloning vector or an expression vector). As a non-limiting example, a recombinant nucleic acid molecule: 1) has been synthesized or modified in vitro, for example, using chemical or enzymatic techniques (e.g., by the use of chemical nucleic acid synthesis, or by the use of enzymes for replication, polymerization, exonucleolytic digestion, endonucleolytic digestion, ligation, reverse transcription, transcription, base modification (including, for example, methylation) or recombination (including homologous recombination and site-specific recombination) of nucleic acid molecules; 2) includes essentially unconnected contiguous nucleotide sequences, 3) has been modified using molecular cloning techniques so that it lacks one or more nucleotides relative to the sequence of naturally occurring nucleic acid molecules, and / or 4) has been manipulated using molecular cloning techniques so that it has one or more sequence changes or rearrangements relative to the sequence of naturally occurring nucleic acids.

[0315] In some embodiments, a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide is provided, the polypeptide comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence of a chimeric polypeptide disclosed herein or a functional fragment thereof. In some embodiments, a nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide, the polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of a chimeric polypeptide disclosed herein or a functional fragment thereof.

[0316] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 to 67, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 86 to 103, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 107 or a functional fragment thereof.

[0317] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 54 to 60, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 68 to 85, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 106 or a functional fragment thereof.

[0318] In some embodiments, nucleic acid molecules disclosed herein are operably connected to heterologous nucleic acid sequences. Some embodiments disclosed herein relate to vectors or expression cassettes comprising isolated, synthetic or recombinant nucleic acid molecules disclosed herein. Expression cassettes generally contain coding sequences and sufficient regulatory information to guide the correct transcription and / or translation of coding sequences in vivo and / or in vitro in recipient cells. Expression cassettes can be inserted into vectors for targeting desired host cells and / or targeting subjects. Therefore, the term expression cassette can be used interchangeably with the term "expression construct". Expression cassettes can be inserted into plasmids, cosmids, viruses, autonomously replicating polynucleotide molecules, and bacteriophages in linear or circular, single-stranded or double-stranded DNA or RNA polynucleotide molecules, which are derived from any source, capable of genome integration or autonomous replication, including nucleic acid molecules wherein one or more nucleic acid sequences have been connected (i.e., operably connected) in a functionally operable manner.

[0319] Generally, when combined with appropriate control elements, the vector can replicate. The term "vector" includes cloning vectors and expression vectors, as well as viral vectors and integration vectors." Expression vector" is a vector including a regulatory region, so that DNA sequences and fragments can be expressed in vitro and / or in vivo. The vector may include a sequence that instructs autonomous replication in the cell, or may include a sequence that is sufficient to allow integration into the host cell DNA. Useful vectors include, for example, plasmids (for example, DNA plasmids or RNA plasmids), transposons, clays, bacterial artificial chromosomes, and viral vectors. Useful viral vectors include, for example, replication-defective retroviruses and slow viruses. In certain embodiments, the vector is a gene delivery vector. In certain embodiments, the vector is used as a gene delivery vehicle to transfer genes into cells.

[0320] In some embodiments, the vector is a non-viral vector. Exemplary non-viral vectors include, but are not limited to, plasmid DNA, transposons, episomal plasmids, minicircles, ministrings, and oligonucleotides (e.g., mRNA, naked DNA). In some embodiments, the vector is a DNA plasmid vector.

[0321] In certain embodiments, the vector is a viral vector. The viral vector may be replication-competent or replication-incompetent. The viral vector may be integrated or non-integrated. Many virus-based systems have been developed for gene transfer into mammalian cells, and those of ordinary skill in the art may select suitable viral vectors. Exemplary viral vectors include, but are not limited to, adenoviral vectors (e.g., adenovirus 5), adeno-associated virus (AAV) vectors (e.g., AAV2, 3, 5, 6, 8, 9), retroviral vectors (MMSV, MSCV), lentiviral vectors (e.g., HIV-1, HIV-2), γ-retroviral vectors, herpesvirus vectors (e.g., HSV1, HSV2), alphavirus vectors (e.g., SFV, SIN, VEE, M1), flavivirus (e.g., Kunjin virus, West Nile virus, dengue virus), rhabdovirus vectors (e.g., rabies virus, VSV), measles virus vectors (e.g., MV-Edm), Newcastle disease virus vectors, poxvirus vectors (e.g., VV), measles virus and picornavirus vectors (e.g., coxsackievirus).

[0322] In some embodiments, the vector includes one or more additional elements. Additional elements include, but are not limited to, promoters, enhancers, polyadenylation (polyA) sequences, and selection genes.

[0323] In some embodiments, the vector comprises a polynucleotide sequence encoding a selectable marker that confers a specific trait to cells in which the selectable marker is expressed, thereby enabling artificial selection of those cells. Exemplary selectable markers include, but are not limited to, antibiotic resistance genes, for example, resistance to kanamycin, ampicillin or triclosan.

[0324] In some embodiments, the vector includes a transcriptional regulatory element. Exemplary transcriptional regulatory elements include, but are not limited to, promoters and enhancers.

[0325] DNA vectors can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd Edition, Cold Spring Harbor Laboratory Press, Plainview, NY) and other standard molecular biology laboratory manuals.

[0326] The nucleic acid sequences encoding the chimeric polypeptides of the present disclosure can be optimized for expression in a host cell of interest. For example, the GC content of the sequence can be adjusted to the average level for a given cellular host, as calculated by reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. Codon usage within the coding sequence of the chimeric polypeptides disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a particular host cell.

[0327] Non-limiting examples of suitable vectors for use include T7-based vectors for bacteria, pMSXND expression vectors for mammalian cells, and baculovirus-derived vectors for insect cells. In some embodiments, the nucleic acid insert encoding the subject chimeric polypeptide in such vectors can be operably linked to a promoter, which is selected based on, for example, the cell type in which expression is sought. A non-limiting example of a suitable promoter is an early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that is capable of driving high-level expression of any polynucleotide sequence operably linked thereto. However, other constitutive promoter sequences may also be used, including but not limited to the Simian Virus 40 (SV40) early promoter, the MoMuLV promoter, the avian leukosis virus promoter, the Epstein-Barr virus early promoter, the mouse mammary tumor virus (MMTV), the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the Rous sarcoma virus promoter, the elongation factor-1a promoter, and human gene promoters, such as but not limited to the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. In addition, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the present disclosure. The use of inducible promoters provides a molecular switch that can turn on the expression of a polynucleotide sequence operably linked thereto when such expression is desired, or can turn off the expression when expression is not desired. Examples of inducible promoters include but are not limited to metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0328] In addition, any of a variety of expression control sequences can be used in these vectors. Such useful expression control sequences include expression control sequences associated with the structural genes of the aforementioned expression vectors. Examples of useful expression control sequences include, for example, early and late promoters of SV40 or adenovirus, lac systems, trp systems, TAC or TRC systems, major operator genes and promoter regions of bacteriophage λ, such as PL, control regions of fd coat proteins, promoters of 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of acid phosphatases, such as, PhoA, promoters of yeast a-mating systems, polyhedral promoters of baculoviruses, and other sequences known to control gene expression of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.

[0329] The T7 promoter can be used for bacteria, the polyhedron promoter can be used for insect cells, and the cytomegalovirus or metallothionein promoter can be used for mammalian cells. In addition, for higher eukaryotic organisms, tissue-specific and cell-type-specific promoters are widely available. These promoters are named for their ability to direct the expression of nucleic acid molecules in a given tissue or cell type in the body. The technician will readily understand the many promoters and other regulatory elements that can be used to direct nucleic acid expression.

[0330] In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the subject chimeric polypeptide, particularly with respect to potential secondary structures. The host should be selected taking into account the compatibility of the host with the selected vector, the toxicity of the product encoded by the DNA sequence of the present disclosure, its secretion characteristics, its ability to correctly fold polypeptides, its fermentation or culture requirements, and the ease of purification of the product encoded by the DNA sequence.

[0331] Within these parameters, one skilled in the art can select various vector / expression control sequence / host combinations that will express the desired DNA sequence in fermentation or in large-scale animal culture (eg, using CHO cells or COS 7 cells).

[0332] In certain embodiments, the selection of expression control sequences and expression vectors will depend on the selection of the host. A variety of expression host / vector combinations can be used. Non-limiting examples of useful expression vectors for eukaryotic hosts include, for example, vectors with expression control sequences from SV40, bovine papilloma virus, adenovirus, and cytomegalovirus. Non-limiting examples of useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from Escherichia coli (including colE1, pCRI, pER32z, pMB9 and derivatives thereof), more extensive host range plasmids, such as RP4, phage DNA (e.g., numerous derivatives of phage lambda (e.g., NM989) and other DNA phages (such as M13 and filamentous single-stranded DNA phages)). Non-limiting examples of useful expression vectors for yeast cells include 2m plasmids and derivatives thereof. Non-limiting examples of useful vectors for insect cells include pVL 941 and pFastBac TM 1.

[0333] In addition to sequences that promote transcription of the inserted nucleic acid molecules, vectors may contain replication origins and other genes encoding selectable markers. For example, the neomycin resistance (neoR) gene confers G418 resistance to cells expressing the gene therein, and thereby allows phenotypic selection of transfected cells. One skilled in the art can easily determine whether a given regulatory element or selectable marker is suitable for use in a particular experimental setting.

[0334] Viral vectors useful in the present disclosure include, for example, retroviral vectors, adenoviral vectors and adeno-associated vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY).

[0335] Recombinant prokaryotic or eukaryotic cells containing chimeric polypeptides disclosed herein and / or containing and expressing nucleic acid molecules encoding any of the chimeric polypeptides disclosed herein are also features of the present disclosure. In some embodiments, the recombinant cells of the present disclosure are transfected cells, such as cells into which nucleic acid molecules (e.g., nucleic acid molecules encoding chimeric polypeptides disclosed herein) have been introduced by recombinant methods and techniques. The progeny of such cells are also considered to be within the scope of the present disclosure. Cell cultures containing at least one recombinant cell disclosed herein are also within the scope of the present disclosure.

[0336] The precise composition of the expression system is not critical. For example, the chimeric polypeptides disclosed herein can be produced in a prokaryotic host, such as a bacterium, E. coli, or in a eukaryotic host, such as an insect cell (e.g., Sf21 cell) or a mammalian cell (e.g., COS cell, NIH 3T3 cell or HeLa cell). In some embodiments, the recombinant cell is a phagocytic cell, such as a macrophage. Both professional phagocytic cells and non-professional phagocytic cells are suitable. In some embodiments, the phagocytic cell is a professional phagocytic cell. In some embodiments, the phagocytic cell is a non-professional phagocytic cell. In some embodiments, the phagocytic cell is selected from the group consisting of macrophages, dendritic cells, mast cells, monocytes, neutrophils, microglia, and astrocytes. In some embodiments, the phagocytic cell is a BMDM or BMDC. In some embodiments, the phagocytic cell is a Thp-1 monocyte. In some embodiments, the phagocytic cell is a J774A.1 macrophage. These cells can be obtained from many sources, including the American Type Culture Collection (Manassas, Va.). In selecting an expression system, it is only important that the components are compatible with each other. A person of ordinary skill is able to make such a determination. In addition, if guidance is needed in selecting an expression system, the skilled person can consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).

[0337] The expressed polypeptide can be purified from the expression system using conventional biochemical procedures and can be used, for example, as a therapeutic agent, as described herein.

[0338] In some embodiments, the chimeric polypeptide obtained will be glycosylated or non-glycosylated, depending on the host organism used to produce the chimeric polypeptide. If bacteria are selected as the host, the chimeric polypeptide produced will be non-non-glycosylated. On the other hand, eukaryotic cells will typically glycosylate the chimeric polypeptide, although the manner in which the native polypeptide is glycosylated may be different. The chimeric polypeptide produced by the transformed host cell can be purified according to any suitable method known in the art. The chimeric polypeptide produced can be isolated from inclusion bodies produced in bacteria (such as E. coli), or from conditioned medium from a mammalian or yeast culture that produces a given chimeric polypeptide using cation exchange, gel filtration and / or reversed phase liquid chromatography.

[0339] Therefore, another exemplary method for constructing a DNA sequence encoding a chimeric polypeptide of the present disclosure is by chemical synthesis. This includes direct peptide synthesis by chemical methods of a protein sequence encoding a chimeric polypeptide exhibiting the properties. This method can incorporate both natural and non-natural amino acids at positions that affect the binding affinity of the chimeric polypeptide to the target antigen and / or target protein. Alternatively, a gene encoding a desired chimeric polypeptide can be synthesized by chemical methods using an oligonucleotide synthesizer. Such oligonucleotides are designed based on the amino acid sequence of the desired chimeric polypeptide, and preferably those codons that are favorable in the host cell that will produce the recombinant chimeric polypeptide are selected. In this regard, it is well known in the art that the genetic code is degenerate-amino acids can be encoded by more than one codon. For example, Phe (F) is encoded by two codons TIC or TTT, Tyr (Y) is encoded by TAC or TAT, and his (H) is encoded by CAC or CAT. Trp (W) is encoded by a single codon TGG. Therefore, it should be understood by those skilled in the art that for a given DNA sequence encoding a particular chimeric polypeptide, there will be many DNA degenerate sequences encoding the chimeric polypeptide. For example, it should be understood that, in addition to the DNA sequences of the chimeric polypeptides provided in the sequence listing, there are many degenerate DNA sequences encoding the chimeric polypeptides disclosed herein. These degenerate DNA sequences are considered to be within the scope of the present disclosure. Therefore, in the context of the present disclosure, "degenerate variants thereof" refers to all DNA sequences that encode a specific chimeric polypeptide and are thereby capable of expressing a specific chimeric polypeptide.

[0340] The DNA sequence encoding the subject chimeric polypeptide, whether prepared by site-directed mutagenesis, chemical synthesis or other methods, may also include a DNA sequence encoding a signal sequence. If such a signal sequence is present, such a signal sequence should be a signal sequence recognized by the cell selected for expressing the chimeric polypeptide. It can be a prokaryotic organism, a eukaryotic organism or a combination of the two. Generally speaking, the inclusion of a signal sequence depends on whether the chimeric polypeptide needs to be secreted from the recombinant cell producing the chimeric polypeptide disclosed herein. If the selected cell is a prokaryotic cell, it is generally preferred that the DNA sequence does not encode a signal sequence. If the selected cell is a eukaryotic cell, it is generally preferred to include a signal sequence.

[0341] The nucleic acid molecules provided may contain naturally occurring sequences, or sequences that differ from naturally occurring sequences but encode the same polypeptide due to the degeneracy of the genetic code. These nucleic acid molecules may be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as DNA produced by phosphoramidite-based synthesis) or combinations or modifications of nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules may be double-stranded or single-stranded (e.g., sense strand or antisense strand).

[0342] Nucleic acid molecules are not limited to sequences encoding polypeptides; they may also include some or all of the non-coding sequences located upstream or downstream of the coding sequence (e.g., the coding sequence of the chimeric polypeptide disclosed herein). Those of ordinary skill in the field of molecular biology are familiar with conventional procedures for isolating nucleic acid molecules. For example, they can be generated by treating genomic DNA with restriction endonucleases or by performing a polymerase chain reaction (PCR). If the nucleic acid molecule is a ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.

[0343] Exemplary isolated nucleic acid molecules of the present disclosure may include fragments not found in the natural state. Thus, the present disclosure encompasses recombinant molecules, such as those in which a nucleic acid sequence (e.g., a sequence encoding a chimeric polypeptide disclosed herein) is incorporated into a vector (e.g., a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell, located outside the natural chromosomal location).

[0344] How to use

[0345] In another aspect, the present disclosure provides a method of treating a subject using a chimeric decoy receptor (CBR), a chimeric engulfment receptor (CPR), a decoy macrophage adapter (BME), an antigen macrophage adapter (AME), a recombinant vector, a modified cell (e.g., a cell comprising a heterologous and / or recombinant nucleic acid), or a pharmaceutical composition disclosed herein. The methods disclosed herein can be used to treat any disease or condition in a subject that would benefit from treatment with a recombinant cell of the present disclosure, or a polypeptide or polynucleotide or vector of the present disclosure. The chimeric polypeptides, nucleic acid molecules and / or pharmaceutical compositions disclosed herein can be used to treat individuals who have, are suspected of having, or may be at high risk of developing one or more health conditions or conditions. Exemplary health conditions and conditions of interest may include, but are not limited to, those health conditions and conditions associated with acute and chronic infections, inflammatory diseases, immune diseases, and various cancers. In some embodiments, the methods disclosed herein are useful for treating one or more health conditions or conditions by enhancing the removal of infected, transformed, malignant, apoptotic, damaged, or necrotic cells or particles from the body of an individual.

[0346] In certain embodiments, the method comprises administering to the subject an effective amount of a recombinant cell or population thereof as disclosed herein.

[0347] The cells administered to the subject can be autologous or allogeneic.

[0348] The number of cells used will depend on a variety of circumstances, including the life span of the cells, the regimen to be used (e.g., number of administrations), the ability of the cells to proliferate, the stability of the recombinant construct, etc. In certain embodiments, the cells are applied in the form of a dispersion, typically injected into or near the site of interest. The cells can be administered in any physiologically acceptable medium.

[0349] In certain embodiments, the viral infection is caused by an enveloped RNA virus. Examples of enveloped RNA viruses include, but are not limited to, Togaviridae (e.g., Chikungunya virus (CHIKV)), Coronaviridae (e.g., SARS-CoV-2), Flaviviridae (e.g., dengue, Zika), Orthomyxoviridae (e.g., influenza virus), Filoviridae (e.g., Ebola), Paramyxoviridae (e.g., measles, respiratory syncytial virus), Retroviridae (e.g., HIV), and Bunyaviridae (e.g., Hantavirus).

[0350] In some embodiments, the virus infection is caused by coronavirus. As used herein, the term "coronavirus" refers to a group of related RNA viruses that constitute the subfamily of positive coronaviruses and belong to the family Coronaviridae of the order Nidovirales. Coronaviruses are further divided into four genera: alpha coronavirus, beta coronavirus, gamma coronavirus, and delta coronavirus. Therefore, in some embodiments, the virus infection is caused by alpha coronavirus, for example, human coronavirus 229E (HCoV-229E), porcine epidemic diarrhea virus (PEDV), human coronavirus NL63 (HCoV-NL63), and alpha coronavirus 1. In some embodiments, the virus infection is caused by beta coronavirus, for example, beta coronavirus 1, human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus HKU1 (HCoV-HKU1), Middle East respiratory syndrome-related coronavirus (MERS-CoV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the virus infection is caused by gamma coronavirus. In some embodiments, the virus infection is caused by delta coronavirus.

[0351] In a preferred embodiment, the viral infection is caused by a beta coronavirus. In some embodiments, the viral infection is caused by human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus HKU1, Middle East respiratory syndrome-related coronavirus (MERS-CoV) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the viral infection is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0352] In some embodiments, the viral infection is caused by a virus that uses lysosomes for egress.

[0353] In humans, coronaviruses cause respiratory infections that may be mild, such as some cases of the common cold, and others that may be fatal, such as SARS-CoV, MERS-CoV, and SARS-CoV-2. In general, symptoms associated with coronavirus infection include fever, cough, shortness of breath, chest pain or pressure, confusion, bluish lips or face, pneumonia, bronchitis, runny nose, sneezing, chills, worsening asthma, acute respiratory distress syndrome (ARDS), RNAemia, acute heart injury, shock, myalgia, fatigue, cough with sputum, rust-colored sputum, bloody sputum, swollen lymph nodes, middle ear infection, joint pain, wheezing, headache, hemoptysis, diarrhea, dyspnea, redness, swelling or edema, pain, loss of function, organ dysfunction, multiple organ system failure, acute kidney injury, malnutrition, sepsis, hypotension, hypertension, hypothermia, hypoxemia, leukocytosis, leukopenia, lymphopenia, thrombocytopenia, nasal congestion, sore throat, reluctance to drink water, convulsions, persistent vomiting, abdominal pain, secondary infection and multiple organ failure.

[0354] In particular, common symptoms associated with SARS-CoV-2 include fever, cough, shortness of breath, difficulty breathing, fatigue, loss of appetite, muscle or body aches, and production of mucus or phlegm. Less common symptoms include sore throat, headache, chills, loss of taste or smell, nasal congestion or runny nose, nausea, vomiting, diarrhea, chest pain or pressure, confusion, inability to wake up or stay awake, and bluish lips or face. While most cases produce mild symptoms, some have progressed to severe pneumonia, acute respiratory distress syndrome (ARDS), heart damage, and multiple organ failure.

[0355] In some embodiments, the viral infection is caused by a virus from the Togaviridae family, such as an alphavirus. In some embodiments, the alphavirus is selected from the group consisting of Aura virus, Barmah Forest virus, Bebaru virus, Caaingua virus, Cabassou virus, Chikungunya virus, Eastern equine encephalitis virus, Eilat virus, Everglades virus, Fort Morgan virus, Getah virus, Highlands J virus, Madariaga virus, Mayaro virus, Middelburg virus, Mosso das Pedras virus, Mucambo virus, Ndumu virus, O'nyong'nyong virus, Pixuna virus, Rio Negro virus, Ross River virus, In some embodiments, the alphavirus is Chikungunya virus (CHIKV).

[0356] In particular, common symptoms associated with CHIKV include fever, joint pain, and rash. Less common symptoms include headache, fatigue, gastrointestinal lesions, and conjunctivitis. Chronic symptoms associated with CHIKV include arthritis, long-term musculoskeletal pain, and weakness.

[0357] In some embodiments, the viral infection is caused by a virus from the Flaviviridae family. In some embodiments, the virus from the Flaviviridae family is selected from the group consisting of Apoi virus, Aroavirus, Bagaza virus, Banzi virus, Boubouivirus, Bukalasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitisvirus, Japanese encephalitis virus, Jugra virus, Jutiapa virus virus), Kadam virus, Kedougou virus, Kokobera virus, Koutango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotisleukoencephalitis virus, Murray Valleyencephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, San Louis encephalitis virus, Sal Vieja virus, San Perlita virus, Saumarez Reef virusvirus), Sepik virus, Tembusu virus, tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, yellow fever virus, Yokosuka virus, and Zika virus.

[0358] In some embodiments, the viral infection is caused by a virus from the family Orthomyxoviridae, such as influenza A, influenza B, influenza D, influenza C, salmon-borne virus, Thogotovirus, or Quaranjavirus. In some embodiments, the virus from the family Orthomyxoviridae is selected from the group consisting of influenza A, influenza B, influenza C, and influenza D. Examples of influenza A viruses include, but are not limited to, H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, and H10N7.

[0359] In some embodiments, the viral infection is caused by a virus of the Filoviridae family, such as Cuevavirus, Dianlovirus, Ebolavirus, Marburgvirus, Striavirus, or Thamnovirus. In some embodiments, the virus from the Filoviridae family is selected from the group consisting of Lloviu cuevavirus, Mengla dianlovirus, Bombaliebolavirus, Bundibugyo ebolavirus, Restonebolavirus, Sudan ebolavirus, Tai Forest Ebolavirus, Forest ebolavirus), Zaire ebolavirus, Marburg virus, Xilangstriavirus, and Huangjiao thamnovirus.

[0360] In some embodiments, the viral infection is caused by a virus from the Paramyxoviridae family, such as Metaavulavirus, Orthoavulavirus, Paraavulavirus, Metaparamyxyovirus, Aquatic Paramyxovirus, Ferlavirus, Henipavirus, Jeilongvirus, Measlesvirus, Narmovirus, Respiratoryvirus, Salemvirus, Orthorubulavirus, Pararubulavirus, Pneumovirus, Cynoglossusvirus, Hoplichthysvirus, or Scoliodonvirus. In some embodiments, the virus of the Paramyxoviridae family is selected from the group consisting of canine distemper virus (CDV), cetacean measles virus (CeMV), feline measles virus (FeMV), measles virus (MeV), peste des petits ruminants virus (PPRV), seal distemper virus (PDV), Newcastle disease virus, rinderpest virus (RPV), mumps virus, Hendra virus (HeV), Nipah virus (NiV), human parainfluenza viruses (HPIV-1, HPIV-2, HPIV-3, HPIV-4), avian metapneumovirus (AMPV), human metapneumovirus (HMPV), bovine respiratory syncytial virus (BRSV), human respiratory syncytial virus (HRSV) and murine pneumonia virus (MPV).

[0361] In some embodiments, the viral infection is caused by a virus from the family Retroviridae. In some embodiments, the virus from the family Retroviridae is selected from the group consisting of human immunodeficiency virus 1 (HIV-1), human immunodeficiency virus 2 (HIV-2), human T-lymphotropic virus (HTLV), murine leukemia virus (MLV), avian leukemia virus, Rous sarcoma virus, mouse mammary tumor virus (MMTV), feline leukemia virus, bovine leukemia virus, simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV).

[0362] In some embodiments, the viral infection is caused by a virus from the Bunyaviridae family, such as Peribunyaviridae, Phenuiviridae, Arenaviridae, Nairoviridae, and Hantaviridae. In some embodiments, the virus from the Bunyaviridae family is selected from the group consisting of California encephalitis virus, La Crosse encephalitis virus, Jamestown Canyon virus, Akabanevirus, Oropouche virus, Group C virus, Guama virus, Tahina virus, Snowshoe rabbit virus, Hanta virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, Phlebotomycin virus, Hazara virus, Dobrava virus, Seoul virus, Puumala virus, Sinub virus, and severe fever with thrombocytopenia syndrome virus (SFTSV).

[0363] In certain embodiments, the cancer is lung cancer, bile duct cancer (e.g., cholangiocarcinoma), pancreatic cancer, colorectal cancer, ovarian cancer, or gynecological cancer. In certain embodiments, the cancer is leukemia (e.g., mixed lineage leukemia, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, or chronic myeloid leukemia), alveolar rhabdomyosarcoma, bone cancer, brain cancer (e.g., glioma, e.g., glioblastoma), breast cancer, anal cancer, anal canal cancer, or anorectal cancer, eye cancer, intrahepatic bile duct cancer (e.g., intrahepatic cholangiocarcinoma), joint cancer, neck cancer, gallbladder cancer, or pleural cancer, nasal cancer, nasal cavity cancer, or middle ear cancer, oral cancer, vulvar cancer, myeloma (e.g., chronic myeloid cancer), colon cancer, esophageal cancer, cervical cancer, gastrointestinal cancer, gastrointestinal carcinoid. Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer (e.g., non-small cell lung cancer), malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal carcinoma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, peritoneal cancer, omental cancer and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer (e.g., renal cell carcinoma (RCC)), gastric cancer, small intestine cancer, soft tissue cancer, gastric cancer, carcinoma, sarcoma (e.g., synovial sarcoma, rhabdomyosarcoma), skin cancer, testicular cancer, thyroid cancer, head and neck cancer, ureteral cancer and bladder cancer. In certain embodiments, cancer is melanoma, breast cancer, lung cancer, prostate cancer, thyroid cancer, ovarian cancer or synovial sarcoma. In one embodiment, cancer is synovial sarcoma or liposarcoma (e.g., myxoid / round cell liposarcoma). In certain embodiments, cancer is lung cancer, bile duct cancer, pancreatic cancer, colorectal cancer, gynecological cancer or ovarian cancer.

[0364] The polypeptides, nucleotides, recombinant vectors, cells or pharmaceutical compositions described herein can be delivered to the subject by a variety of routes. These include, but are not limited to, parenteral, intranasal, intratracheal, oral, intradermal, topical, intramuscular, intraperitoneal, transdermal, intravenous, intratumoral, conjunctival, intrathecal and subcutaneous routes. Pulmonary administration can also be used, for example, by using an inhaler or nebulizer and a formulation with an atomizer to be used as a spray. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, cells or pharmaceutical compositions described herein are delivered intravenously. In certain embodiments, the polypeptides, polynucleotides, vectors, cells or pharmaceutical compositions described herein are delivered subcutaneously. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, cells or pharmaceutical compositions described herein are delivered intranasally. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, cells or pharmaceutical compositions described herein are delivered intramuscularly. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, cells or pharmaceutical compositions described herein are delivered intratumorally. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells or pharmaceutical compositions described herein are delivered to tumor-draining lymph nodes.

[0365] The amount of the polypeptide, polynucleotide, recombinant vector, engineered cell or pharmaceutical composition that will be effective for treating and / or preventing a disorder will depend on the nature of the disease, and can be determined by standard clinical techniques.

[0366] The precise dose to be employed in the pharmaceutical composition will also depend on the route of administration and the severity of the infection or disease caused, and should be determined according to the practitioner's judgment and the circumstances of each subject. For example, the effective dose may also vary depending on the mode of administration, the target site, the patient's physiological state (including age, weight and health), whether the patient is human or animal, and whether the other drugs or treatments administered are preventive or therapeutic. Typically, the patient is a human, but non-human mammals, including transgenic mammals, may also be treated. The therapeutic dose is optimally titrated to optimize safety and efficacy.

[0367] Manufacturing method

[0368] The cells of the transformation described herein can be manufactured by any method known in the art. Some embodiments of the present disclosure relate to methods for modifying cells, which include introducing (a) chimeric polypeptides described herein; and / or (b) isolated, synthetic or recombinant nucleic acid molecules described herein into cells to produce recombinants (e.g., modified or transgenic). For example, the chimeric polypeptides or nucleic acid molecules disclosed herein can be produced in prokaryotic hosts (such as bacteria Escherichia coli) or in eukaryotic hosts (such as insect cells (e.g., Sf21 cells) or mammalian cells (e.g., COS cells, NIH 3T3 cells or HeLa cells). In some embodiments, the recombinant cell is a phagocytic cell, such as a phagocytic cell. Both professional phagocytic cells and non-professional phagocytic cells are suitable. In some embodiments, the phagocytic cell is a professional phagocytic cell. In some embodiments, the phagocytic cell is a non-professional phagocytic cell. In some embodiments, the phagocytic cell is selected from the group consisting of macrophages, dendritic cells, mast cells, monocytes, neutrophils, microglia and astrocytes. In some embodiments, the phagocytic cell is BMDM or BMDC. In some embodiments, phagocytes are Thp1 monocytes. These cells can be obtained from many sources, including the American Type Culture Collection (Manassas, Va.). In some embodiments, phagocytes are macrophages (iPSC-macrophages) derived from pluripotent stem cells. Such iPSC-macrophages can be generated by knocking out B2M to eliminate all MHC I and then knocking in HLA E. Then, modified iPSCs can be differentiated and polarized into mature M1 macrophages in culture using protocols known in the art (e.g., Cao et al., Stem Cell Reports, 2019). The source of iPSC or phagocytes can be allogeneic or autologous donors.

[0369] In some embodiments, the recombinant cell expresses the chimeric polypeptide and has targeting effector activity. In some embodiments, introducing the chimeric polypeptide into the cell comprises introducing a nucleic acid sequence encoding the chimeric polypeptide. In some embodiments, introducing the nucleic acid sequence comprises electroporating an mRNA encoding the chimeric polypeptide.

[0370] Methods for introducing genes (such as nucleic acid molecules and chimeric polypeptides encoded therefrom) into cells and expressing them are known in the art. In the context of expression vectors, the vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast or insect cells, by any method in the art. For example, the expression vector can be transferred to the host cell by physical, chemical or biological methods. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells including vectors and / or exogenous nucleic acids are well known in the art. For example, commercially available methods including electroporation can be used to introduce nucleic acids into target cells. Nucleic acids can also be introduced into cells using cationic liposome-mediated transfection, using liposome transfection, using polymer encapsulation, using peptide-mediated transfection, or using a gene gun particle delivery system such as a "gene gun".

[0371] The biological method of introducing the polynucleotide of interest into the host cell includes the use of DNA and RNA vectors. RNA vectors include vectors with RNA promoters and / or other related domains for producing RNA transcripts. Viral vectors, especially retroviral vectors, have become the most widely used method for inserting genes into mammals (e.g., human cells). Other viral vectors can be derived from slow viruses, poxviruses, herpes simplex viruses, adenoviruses and adeno-associated viruses, etc. Chemical methods for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles and liposomes. The exemplary colloidal system used as an in vitro and in vivo delivery vehicle is a liposome (e.g., artificial membrane vesicle).

[0372] In the case of utilizing a non-viral delivery system, an exemplary delivery vehicle is a liposome. "Liposome" is a general term covering various monolayer and multilayer lipid vehicles formed by the generation of a closed lipid bilayer or aggregate. Liposomes can be characterized as having a vesicle structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, phospholipids form spontaneously. The lipid components rearrange themselves before forming a closed structure, and water and dissolved solutes are trapped between the lipid bilayers. However, compositions having structures different from normal vesicle structures in solution are also covered. For example, lipids may present a micellar structure or exist only as heterogeneous aggregates of lipid molecules. Liposome transfection amine-nucleic acid complexes are also considered.

[0373] It is contemplated that the use of lipid formulations will introduce nucleic acids into host cells (in vitro, ex vivo or in vivo). In some embodiments, nucleic acid molecules or chimeric polypeptides can be associated with lipids. Nucleic acids or chimeric polypeptides associated with lipids can be encapsulated in the aqueous interior of liposomes, dispersed in the lipid bilayer of liposomes, connected to liposomes via linker molecules associated with both liposomes and oligonucleotides, captured in liposomes, complexed with liposomes, dispersed in a solution containing lipids, mixed with lipids, merged with lipids, contained as a suspension in lipids, containing micelles or complexed with micelles, or otherwise associated with lipids. Compositions associated with lipids, lipid / DNA or lipid / expression vectors are not limited to any specific structure in solution. For example, they can exist as follows: bilayer structures, micelles, or "collapsed" structures. They can also be simply dispersed in solution, possibly forming aggregates that are not uniform in size or properties. Lipids are fatty substances that can be naturally occurring lipids or synthetic lipids. For example, lipids include the fat droplets naturally present in the cytoplasm, as well as the class of compounds containing long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0374] Pharmaceutical composition

[0375] Provided herein are pharmaceutical compositions comprising a population of engineered immune effector cells disclosed herein, the engineered immune effector cell population having a desired purity in a physiologically acceptable carrier, excipient, or stabilizer (see, e.g., Remington's Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA). In some embodiments, the cell is a phagocyte. In some embodiments, the pharmaceutical composition is a protein therapeutic administered in a cell-free manner. Acceptable carriers, excipients, or stabilizers are nontoxic to the recipient at the dose and concentration used, and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethylammonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butanol, or benzyl alcohol; alkyl parabens, such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and metacresol); low molecular weight (less than about 1 0 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants such as TWEENTM 、PLURONICS TM or polyethylene glycol (PEG).

[0376] The pharmaceutical compositions described herein can be used to induce an immune response in a subject and treat a condition, such as cancer. In one embodiment, the present disclosure provides a pharmaceutical composition comprising a modified immune effector cell colony as described herein, which is used as a medicament. In another embodiment, the present disclosure provides a pharmaceutical composition for use in a method for treating cancer. In some embodiments, the pharmaceutical composition comprises a modified immune effector cell colony disclosed herein in a pharmaceutically acceptable carrier and optionally one or more additional prophylactic or therapeutic agents.

[0377] The pharmaceutical composition can be formulated for any route of administration to a subject. Specific examples of routes of administration include parenteral administration (e.g., intravenous, subcutaneous, intramuscular). In some embodiments, the pharmaceutical composition is formulated for intravenous administration. Injections can be prepared in conventional forms (as liquid solutions or suspensions). Injections may contain one or more excipients. Exemplary excipients include, for example, water, saline, glucose, glycerol, or ethanol. In addition, if desired, the pharmaceutical composition to be administered may also contain a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, pH buffers, stabilizers, solubility enhancers, and other such agents, such as, for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate, and cyclodextrins.

[0378] In some embodiments, the pharmaceutical composition is formulated for intravenous administration. Suitable carriers for intravenous administration include physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents such as glucose, polyethylene glycol and polypropylene glycol, and mixtures thereof.

[0379] Compositions to be used for in vivo administration may be sterile. This can be easily achieved, for example, by filtration through sterile filtration membranes.

[0380] Pharmaceutically acceptable carriers for parenteral preparations include, for example, aqueous vehicles, non-aqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending agents and dispersants, emulsifiers, sequestrants or chelating agents and other pharmaceutically acceptable substances. Examples of aqueous vehicles include sodium chloride injection, Ringer's injection, isotonic glucose injection, sterile water injection, glucose and lactated Ringer's injection. Non-aqueous parenteral vehicles include fixed oils, cottonseed oil, corn oil, sesame oil and peanut oil of plant origin. Antimicrobial agents in antibacterial or antifungal concentrations can be added to parenteral preparations packaged in multidose containers, and these parenteral preparations include phenol or cresol, mercurials, benzyl alcohol, chlorobutanol, methylparaben and propylparaben, thimerosal, benzalkonium chloride and benzethonium chloride. Isotonic agents include sodium chloride and glucose. Buffers include phosphates and citrates. Antioxidants include sodium bisulfate. Local anesthetics include procaine hydrochloride. Suspending and dispersing agents include sodium carboxymethylcellulose, hydroxypropyl methylcellulose and polyvinyl pyrrolidone. Emulsifiers include polysorbate 80 ( 80). Metal ion sequestrants or chelators include EDTA. Pharmaceutical carriers also include ethanol, polyethylene glycol and propylene glycol as water-miscible vehicles; and sodium hydroxide, hydrochloric acid, citric acid or lactic acid for adjusting pH.

[0381] The precise dose to be employed in the pharmaceutical composition will also depend on the route of administration and the severity of the condition induced, and should be determined according to the practitioner's judgment and the circumstances of each subject. For example, the effective dose may also vary depending on the mode of administration, the target site, the subject's physiological state (including age, weight and health), other drugs administered, or whether the treatment is prophylactic or therapeutic. The therapeutic dose is optimally titrated to optimize safety and efficacy.

[0382] Reagent test kit

[0383] In one aspect, kits are provided herein, comprising one or more pharmaceutical compositions described herein, a population of effector cells (e.g., recombinant phagocytes), proteins, polynucleotides or vectors, and instructions for use. Such kits may include, for example, carriers, packages or containers, which are separated to accommodate one or more containers, such as vials, tubes, etc. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the container is formed of a variety of materials (such as glass or plastic).

[0384] In a specific embodiment, a drug kit is provided herein, comprising one or more containers, the one or more containers are filled with one or more ingredients in the pharmaceutical composition described herein, the immune effector cell colonies, polynucleotides or carriers of the transformation provided herein. In one embodiment, the kit comprises a pharmaceutical composition, which comprises the immune effector cell colonies of the transformation described herein. In one embodiment, the kit comprises a pharmaceutical composition, which comprises the immune effector cell colonies transformed according to the methods described herein. In some embodiments, the kit contains a pharmaceutical composition and a preventive or therapeutic agent as described herein. Optionally, associated with such containers may be a notice in the form of a government agency regulating the manufacture, use or sale of drugs or biological products, which reflects the approval obtained by the manufacturing, use or sales agency for human administration.

[0385] Examples

[0386] The examples of the present disclosure are provided by way of illustration and explanation and are not intended to limit the scope of the present disclosure.Example 1: Initial design of chimeric decoy receptor and chimeric engulfment receptor constructs.

[0387] Initially, chimeric decoy receptor (CBR) and chimeric phagocytic receptor (CPR) constructs were designed based on traditional chimeric antigen receptors (“CARs”). The CAR-based constructs selected for modification contained the following components from N-terminus to C-terminus:

[0388] CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + CD8 transmembrane (TM) domain + CD3ζ intracellular domain +

[0389] T2A+CopGFP (in the same frame as T2A).

[0390] The nucleotide sequence of the CAR-based construct is provided as SEQ ID NO:53:

[0391]

[0392] The various constructs described below were developed starting from this basic construct to test the CBR / CPR concept.

[0393] First, the CD8 TM domain and CD3ζ intracellular domain were replaced with the last 67 amino acids at the C-terminus of the mannose receptor (MR), which includes the TM domain and intracellular domain of the MR. The resulting construct contained the following components from N-terminus to C-terminus:

[0394] CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + MR TM domain + MR intracellular domain + T2A +

[0395] CopGFP (in frame with T2A).

[0396] The nucleotide sequence of this construct containing the last 67 amino acids of the mannose receptor is provided as SEQ ID NO:68:

[0397]

[0398] Second, to test the approach of using baits instead of scFvs, various regions of ACE2 that have been shown to bind to the SARS-CoV-2 spike protein were tested. Three separate constructs were designed containing three different ACE2 fragments. The components of the three constructs (N-terminus to C-terminus) were:

[0399] 1.CD8 signal peptide + ACE2 (19-358) + CD8 hinge + CD8 TM domain + CD3ζ intracellular domain +

[0400] T2A+CopGFP (in the same frame as T2A).

[0401] 2.CD8 signal peptide + ACE2 (19-605) + CD8 hinge + CD8 TM domain + CD3ζ intracellular domain +

[0402] T2A+CopGFP (in the same frame as T2A).

[0403] 3.CD8 signal peptide + ACE2 (19-740) + CD8TM domain + CD3ζ intracellular domain + T2A +

[0404] CopGFP (in frame with T2A).

[0405] The nucleotide sequences of the ACE2 sequences included in constructs 1 to 3 are provided below.

[0406] ACE2 (19-358) (SEQ ID NO: 3):

[0407]

[0408] ACE2(19-605)(SEQ ID NO:5):

[0409]

[0410] ACE2(19-740)(SEQ ID NO:7):

[0411]

[0412] Only construct #3 containing ACE2 19-740 AA showed binding to the protrusions and was selected as bait to be placed on the extracellular domain of the CBR construct.

[0413] To improve the mannose receptor-based CBR, various constructs (F1 to F5) containing different regions of the mannose receptor (MR), hinge and signal peptide were tested. The components of the constructs (N-terminus to C-terminus) are as follows:

[0414] F1: CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + the last 96 amino acids of MR + T2A + GFP (in the same frame as T2A).

[0415] F2: CD8 signal peptide + anti-FLT3 scFv + the last 96 amino acids of MR + T2A + GFP (in the same frame as T2A).

[0416] F3: CD8 signal peptide+anti-FLT3 scFv+CD8 hinge+the last 83 amino acids of MR+T2A+GFP (in the same frame as T2A).

[0417] F4: CD8 signal peptide + anti-FLT3 scFv or ACE2 (19-740) + the last 83 amino acids of MR + T2A + GFP (in the same frame as T2A).

[0418] F5: MR signal peptide + anti-FLT3 scFv or ACE2 (19-740) + CD8 hinge + last 96 amino acids + T2A + GFP (in the same frame as T2A).

[0419] The nucleotide sequence of each of these constructs (excluding T2A-GFP) is provided below.

[0420] F1 (SEQ ID NO: 69):

[0421]

[0422] F2(SEQ ID NO:70):

[0423]

[0424] F3(SEQ ID NO:71):

[0425]

[0426] F4-FLT3-scFv(SEQ ID NO:72):

[0427]

[0428] F4-ACE2(19-740)(SEQ ID NO:54):

[0429]

[0430] F5-FLT3-scFv(SEQ ID NO:73):

[0431]

[0432] F5-ACE2(19-740)(SEQ ID NO:55):

[0433]

[0434] Mannose-based CBR development continued using the F4 construct, which contained the CD8 signal peptide, scFv or ACE2(19-740) decoy and the last 83 amino acids of the mannose receptor (transmembrane and intracellular domains). Kruskal et al., 1992. J. Exp. Med.; Harris et al., 1993. Biochem. Biophys. Res. Commun.

[0435] Example 2: Analysis of CBR-induced phagocytosis.

[0436] Thp1 cells were transduced with lentivirus carrying the F4-AC construct under the EF1a promoter, stained with biotinylated SARS-CoV-2 spike protein (MyBioSource, San Diego, CA), then stained with PE-streptavidin (BioLegend, San Diego, CA), and sorted using a Melody sorter (BD, Franklin Lakes, NJ). 5.06um beads (Spherotech, Lake Forest, IL) coated with streptavidin were sterilized using 70% isopropanol and labeled with 10uM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated spike protein at a ratio of 0.025nmole biotinylated spike protein (MyBioSource, San Diego, CA) per 0.5mg beads. The beads were incubated overnight with cells at a ratio of 1:5 (cell:bead).

[0437] like Figure 2 and FIG. 3A to FIG. 3B As shown, only the protrusion-coated beads were phagocytosed, and only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 decoy on its surface. Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any beads.

[0438] The results of this test showed that CBR can bind to viral proteins and induce phagocytosis in a binding-specific manner.

[0439] Example 3: Analysis of CBR-induced phagocytosis of SARS-CoV-2 variants.

[0440] The experiment described in Example 2 was repeated to test the ability of CBR-transduced cells to recognize and engulf spike proteins from two different SARS-CoV-2 variants (UKα variant B.1.1.7 & δ variant B.1.617.2). Specifically, Thp1 cells were transduced with lentivirus carrying the F4-AC construct under the EF1a promoter, and the cells were stained with biotinylated SARS-CoV-2 spike proteins from UKα variant B.1.1.7 (ACROBiosystems, Delaware Technology Park, DE) or δ variant B.1.617.2 (SinoBiological, Wayne, PA), followed by PE-streptavidin (BioLegend, San Diego, CA), and positive cells were sorted using a Melody sorter (BD, Franklin Lakes, NJ). 5.06 μm beads (Spherotech, Lake Forest, IL) coated with streptavidin were sterilized using 70% isopropanol and labeled with 10 μM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated protrusion protein at a ratio of 0.025 nmole biotinylated protrusion protein per 0.5 mg beads. The beads were incubated with cells at a ratio of 1:5 (cells: beads) overnight.

[0441] like FIG. 4A to FIG. 4B As shown, both wild-type protrusion-coated beads and B1.1.7 protrusion-coated beads were phagocytosed, and only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 decoy on its surface. Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any beads.

[0442] Similarly, both wild-type and B.1.617.2 protrusion-coated beads were phagocytosed, and only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 decoy on its surface ( FIG. 5A to FIG. 5B ). Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any beads.

[0443] The results of this test showed that CBR can bind to viral proteins from multiple variants and induce phagocytosis in a binding-specific manner.

[0444] Example 4: Analysis of CBR-induced SARS-CoV-2 neutralization.

[0445] Use neutralization assay ( Figure 6The ability of SARS-CoV-2 pseudotyped lentiviruses in Thp1 cells transduced with a mannose receptor-based CBR construct (F4AC) containing ACE2 bait on the surface was tested. Specifically, the lentivirus carrying the GFP transfer plasmid was pseudotyped with the protrusion envelope protein (BEI Resources, Manassas, VA) to generate protrusion-LV. Protrusion-LV particles were pre-incubated with Thp1 effector cells expressing the F4AC CBR construct or with control cells, ACE2-293 or untransfected ("UTD") Thp1, or without cells during pre-incubation. After 2 hr of pre-incubation, the cells were centrifuged at 300g for 5 minutes, and the supernatant was collected and incubated with HEK 293T cells (ACE2-293) expressing hACE2 receptors on the cell surface. After 2 days, GFP was determined by flow cytometry + The frequency was used to test the neutralization effect. MOI was determined based on the target cells at 0.1 or 0.85. The ratio of effector cells: target cells was 100:1.

[0446] like FIG. 7A to FIG. 7B As shown, pre-incubation with F4-AC Thpl or ACE2-293 reduced the viral load in the supernatant as observed by a decrease in the transduction efficiency of target cells after subsequent incubation.

[0447] Example 5: CBR / CPR constructs based on additional phagocytic receptors.

[0448] Additional CBR and CPR constructs were designed containing anti-FLT3 scFv or ACE2 (19-740) decoys located on the following phagocytic receptors: MERTK, MEGF10, Dectin-1, and CD163. Schematic diagrams of each of the constructs are in Figure 8 Shown in.

[0449] The nucleotide sequence of each of these constructs (excluding T2A-GFP) is provided below.

[0450] B1_sc_MER (SEQ ID NO: 74):

[0451] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCGACA

[0452] TCCAGATGACCCAGAGCCCCTCCTCTTTATCCGCCTCTGTGGGCGACAGAGTGACCA

[0453] TCACTTGTCGTGCCAGCCAAGAAATCTCCGGCTATCTGTCTTGGCTGCAGCAGAAG

[0454] CCCGGTAAGGCTATCAAGAGACTCATCTACGCCGCCAGCACTTTACAGAGCGGAGT

[0455] GCCTAGCAGATTTAGCGGCTCTCGTAGCGGCAGCGATTATACTTTAACCATCTCCTCT

[0456] TTACAGCCCGAAGACTTTGCTACCTACTACTGTTTACAGTACGCCAGCTACCCCTTC

[0457] ACCTTCGGTCAAGGTACCAAGCTGGAGATCAAAGGTGGCGGCGGCTCTGGCGGCG

[0458] GTGGCTCTGGCGGTGGCTCCGGCGGTGGTGGTAGCCAAGTTACCCTCAAGGAGAGC

[0459] GGCCCCACTTTAGTGAAGCCTACCCAGACTTTAACTTTAACTTGTACCTTCAGCGGC

[0460] TTCTCTTTAAGCACCTCCACAATGGGCGTGGGCTGGATCAGACAGCCTCCCGGCAA

[0461] GGCTCTGGAGTGGCTGGCCCACATCCTCTGGAACGACAGCAAGAGGTACAACCCCT

[0462] CTTTAAAGTCTCGTCTGACCATCACCAAGGACACCTCCAAGAAGCAAGTTGTGCTG

[0463] ACCATGACCAATATGGACCCCGTGGACACCGCCACCTATTACTGCGCTCGTATCGTG

[0464] TACTACTCCACCTACGTGGGCTACTTCGACGTCTGGGGACAAGGTACCACCGTGAC

[0465] CGTGAGCTCTGGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGC

[0466] CAGGCCCGCGACCACCAACACCGGCGCCACCATCGCGTCGCAGCCCCTGTCCCTG

[0467] CGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGCGCAGTGCACACGAGGGGGCTG

[0468] GACTTCGCCTGTGATTTTGGATGTTTTTGTGGTTTCATCCTCATCGGTTTGATATTGTA

[0469] CATAAGTCTGGCGATAAGGAAGAGAGTTCAAGAGACAAAGTTCGGAAATGCCTTTA

[0470] CAGAGGAAGACAGTGAGCTCGTTGTAAACTACATCGCAAAAAAAAAGCTTCTGTAGA

[0471] AGAGCAATAGAGCTCACGTTGCACTCACTCGGTGTGTCCGAAGAACTCCAGAATAA

[0472] ACTGGAAGACGTCGTTATCGATCGGAACCTCCTCATACTTGGAAAAATACTGGGAG

[0473] AAGGAGAGTTCGGCAGTGTCATGGAAGGTAACTTGAAACAAGAGGATGGTACCTC

[0474] ACTCAAGGTAGCTGTCAAGACGATGAAACTTGATAACAGTTCACAAAGGGAGATCG

[0475] AAGAATTTCTGTCTGAGGCCGCCTGTATGAAAGACTTCTCACATCCTAATGTCATCA

[0476] GACTTCTTGGCGTTTGTATCGAGATGTCTAGCCAAGGAATCCAAAACCTATGGTCA

[0477] TATTGCCTTTCATGAAATATGGCGATCTGCATACATATTTGCTCTACTCTAGACTTGAG

[0478] ACAGGGCCCAAACATATTCCTCTCCAGACATTGCTCAAGTTTATGGTCGATATTGCCC

[0479] TGGGTATGGAGTACTTGAGCAACCGAAATTTTCTGCATCGGGATCTTGCCGCACGCA

[0480] ACTGCATGCTGCGCGATGACATGACCGTCTGCGTGGCTGATTTTGGGCTGTCAAAAA

[0481] AAATATATTCTGGAGACTACTACCGACAAGGGCGGATTGCAAAGATGCCCGTCAAAT

[0482] GGATTGCGATTGAAAGTTTGGCGGACAGGGTATATACTTCCAAATCAGATGTTTGGG

[0483] CTTTTGGAGTCACTATGTGGGAAATAGCTACACGCGGTATGACCCCGTACCCCGGAG

[0484] TACAAAATCATGAAATGTATGACTATCTCCTTCATGGACACAGGCTGAAGCAGCCCG

[0485] AGGACTGCCTGGACGAACTGTATGAAATAATGTATTCTTGTTGGCGAACCGATCCCT

[0486] TGGACCGGCCTACTTTCAGTGTCCTTAGATTGCAACTTGAGAAATTGCTCGAGTCTT

[0487] TGCCGGATGTGCGAAACCAGGCAGACGTGATCTATGTCAATACCCAACTTTTGGAA

[0488] AGTTCTGAGGGCCTCGCACAGGGTTCTACCCTTGCCCCGTTGGATCTTAACATAGAC

[0489] CCAGACAGCATAATTGCTTCTTGTACACCTCGCGCTGCCATATCAGTTGTAACAGCG

[0490] GAGGTCCATGATAGTAAACCTCACGAGGGTCGCTATATCCTGAACGGCGGGTCAGA

[0491] AGAATGGGAAGACCTGACATCAGCGCCGAGCGCCGCCGTTACTGCTGAGAAAAAC

[0492] TCTGTCCTGCCCGGAGAGCGCTTGGTTCGGAACGGGGTAAGTTGGAGCCATAGCTC

[0493] AATGCTCCCCCTGGGTTCAAGTCTCCCGGAGCGAGCTTCTTTTTGCGGACGACTCATC

[0494] TGAGGGGTCCGAAGTTCTGATG

[0495] B2_AC_MER(SEQ ID NO:56):

[0496] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCTCCA

[0497] CCATTGAGGAACAGGCCAAGACATTTGGACAAGTTTAACCACGAAGCCGAAGAC

[0498] CTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAATATTACTGAAGAGA

[0499] ATGCCAAACATGAATAATGCTGGGGACAATGGTCTGCCTTTTTAAAGGAACAGT

[0500] CCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTC

[0501] AGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAA

[0502] ACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTG

[0503] TAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAAT

[0504] GGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTG

[0505] AGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAATTGAG

[0506] ATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGGAGACTATGAA

[0507] GTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGA

[0508] ACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCA

[0509] AAGTTGATGAATGCCTATCCTTCCTATATCAGTCCAATTGGATGCCTCCCTGCTCATTT

[0510] GCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACTCTTTGACAGTTCCCTTT

[0511] GGACAGAAACCAAACATAGATGTTACTGATGCAATGGTGGACCAGGCCTGGGATGC

[0512] ACAGAGAATATTCAAGGAGGCCGAGAAGTTCTTTGTATCTGTGGTCTTCCTAATAT

[0513] GACTCAAGGATTCTGGGAAAATTCCATGCTAACGGACCCAGGAAATGTTCAGAAAG

[0514] CAGTCTGCCATCCCACAGCTTGGGACCTGGGGAAGGGCGACTTCAGGATCCTTATG

[0515] TGCACAAAGGTGACAATGGACGACTTCCTGACAGCTCATCATGAGATGGGGCATAT

[0516] CCAGTATGATATGGCATATGCTGCACAACCTTTTCTGCTAAGAAATGGAGCTAATGAA

[0517] GGATTCCATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACACCTAAGCAT

[0518] TTAAAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAAGACAATGAAACAGAAATA

[0519] AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCCATTTACTTACATG

[0520] TTAGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAAAGACCAGTGGAT

[0521] GAAAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTGGAACCTGTGCCC

[0522] CATGATGAAACATACTGTGACCCCGCATCTCTGTTCCATGTTTCTAATGATTACTCAT

[0523] TCATTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGAAGCACTTTGTC

[0524] AAGCAGCTAAACATGAAGGCCCTCTGCACAAATGTGACATCTCAAACTCTACAGAA

[0525] GCTGGACAGAAACTGTTCAATATGCTGAGGCTTGGAAAATCAGAACCCTGGACCCT

[0526] AGCATTGGAAAATGTTGTAGGAGCAAAGAACATGAATGTAAGGCCACTGCTCAACT

[0527] ACTTTGAGCCCTTATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTTTGTGGGAT

[0528] GGAGTACCGACTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAGGATAAGCCTA

[0529] AAATCAGCTCTTGGAGATAAAGCATATGAATGGAACGACAATGAAATGTACCTGTTC

[0530] CGATCATCTGTTGCATATGCTATGAGGCAGTACTTTTTAAAAGTAAAAAATCAGATGA

[0531] TTCTTTTTGGGGAGGAGGATGTGCGAGTGGCTAATTTGAAACCAAGAATCTCCTTTA

[0532] ATTTCTTTGTCACTGCACCTAAAAATGTGTCTGATATCATTCCTAGAACTGAAGTTGA

[0533] AAAGGCCATCAGGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTCTGAATGACAA

[0534] CAGCCTAGAGTTTCTGGGGATACAGCCAACACTTGGACCTCCTAACCAGCCCCCTG

[0535] TTTCCGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCG

[0536] CCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCC

[0537] AGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTC

[0538] GCCTGTGATTTTGGATGTTTTTGTGGTTTTCATCCTCATCGGTTTGATATTGTACATAAG

[0539] TCTGGCGATAAGGAAGAGAGTTCAAGAGACAAAGTTCGGAAATGCCTTTACAGAG

[0540] GAAGACGTGAGCTCGTTGTAAACTACATCGCAAAAAAAAGCTTCTGTAGAAGAGC

[0541] AATAGAGCTCACGTTGCACTCACTCGGTGTTGTCCGAAGAACTCCAGAATAAACTGG

[0542] AAGACGTCGTTATCGATCGGAACCTCCTCATACTTGGAAAAATACTGGGAGAAGGA

[0543] GAGTTCGGCAGTGTCATGGAAGGTAACTTGAAACAAGAGGATGGTACCTCACTCAA

[0544] GGTAGCTGTCAAGACGATGAAACTTGATAACAGTTCACAAAGGGAGATCGAAGAAT

[0545] TTCTGTCTGAGGCCGCCTGTATGAAAGACTTCTCACATCCTAATGTCATCAGACTTCT

[0546] TGGCGTTTGTATCGAGATGTCTAGCCAAGGAATCCCAAAACCTATGGTCATATTGCCT

[0547] TTCATGAAATATGGCGATCTGCATACATATTTGCTCTACTCTAGACTTGAGACAGGGC

[0548] CCAAACATATTCCTCTCCAGACATTGCTCAAGTTTATGGTCGATATTGCCCTGGGTAT

[0549] GGAGTACTTGAGCAACCGAAATTTTCTGCATCGGGATCTTGCCGCACGCAACTGCAT

[0550] GCTGCGCGATGACATGACCGTCTGCGTGGCTGATTTTGGGCTGTCAAAAAAAATATA

[0551] TTCTGGAGACTACTACCGACAAGGGCGGATTGCAAAGATGCCCGTCAAATGGATTG

[0552] CGATTGAAAGTTTGGCGGACAGGGTATATACTTCCAAATCAGATGTTTGGGCTTTTG

[0553] GAGTCACTATGTGGGAAATAGCTACACGCGGTATGACCCCGTACCCCGGAGTACAA

[0554] AATCATGAAATGTATGACTATCTCCTTCATGGACACAGGCTGAAGCAGCCCGAGGAC

[0555] TGCCTGGACGAACTGTATGAAATAATGTATTCTTGTTGGCGAACCGATCCCTTGGAC

[0556] CGGCCTACTTTCAGTGTCCTTAGATTGCAACTTGAGAAATTGCTCGAGTCTTTGCCG

[0557] GATGTGCGAAACCAGGCAGACGTGATCTATGTCAATACCCAACTTTTGGAAAGTTCT

[0558] GAGGGCCTCGCACAGGGTTCTACCCTTGCCCCGTTGGATCTTAACATAGACCCAGAC

[0559] AGCATAATTGCTTCTTGTACACCTCGCGCTGCCATATCAGTTGTAACAGCGGAGGTC

[0560] CATGATAGTAAACCTCACGAGGGTCGCTATATCCTGAACGGCGGGTCAGAAGAATG

[0561] GGAAGACCTGACATCAGCGCCGAGCGCCGCCGTTACTGCTGAGAAAAACTCTGTCC

[0562] TGCCCGGAGAGCGCTTGGTTCGGAACGGGGTAAGTTGGAGCCATAGCTCAATGCTC

[0563] CCCCTGGGTTCAAGTCTCCCGGACGAGCTTCTTTTTGCGGACGACTCATCTGAGGG

[0564] GTCCGAAGTTCTGATG

[0565] B3_sc_MEG(SEQ ID NO:75):

[0566] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCGACA

[0567] TCCAGATGACCCAGAGCCCCTCCTCTTTATCCGCCTCTGTGGGCGACAGAGTGACCA

[0568] TCACTTGTCGTGCCAGCCAAGAAATCTCCGGCTATCTGTCTTGGCTGCAGCAGAAG

[0569] CCCGGTAAGGCTATCAAGAGACTCATCTACGCCGCCAGCACTTTACAGAGCGGAGT

[0570] GCCTAGCAGATTTAGCGGCTCTCGTAGCGGCAGCGATTATACTTTAACCATCTCCTCT

[0571] TTACAGCCCGAAGACTTTGCTACCTACTACTGTTTACAGTACGCCAGCTACCCCTTC

[0572] ACCTTCGGTCAAGGTACCAAGCTGGAGATCAAAGGTGGCGGCGGCTCTGGCGGCG

[0573] GTGGCTCTGGCGGTGGCTCCGGCGGTGGTGGTAGCCAAGTTACCCTCAAGGAGAGC

[0574] GGCCCCACTTTAGTGAAGCCTACCCAGACTTTAACTTTAACTTGTACCTTCAGCGGC

[0575] TTCTCTTTAAGCACCTCCACAATGGGCGTGGGCTGGATCAGACAGCCTCCCGGCAA

[0576] GGCTCTGGAGTGGCTGGCCCACATCCTCTGGAACGACAGCAAGAGGTACAACCCCT

[0577] CTTTAAAGTCTCGTCTGACCATCACCAAGGACACCTCCAAGAAGCAAGTTGTGCTG

[0578] ACCATGACCAATATGGACCCCGTGGACACCGCCACCTATTACTGCGCTCGTATCGTG

[0579] TACTACTCCACCTACGTGGGCTACTTCGACGTCTGGGGACAAGGTACCACCGTGAC

[0580] CGTGAGCTCTGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGC

[0581] CAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTG

[0582] CGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTG

[0583] GACTTCGCCTGTGATGCTATCGCGGGGATCATTATATTGGTCTTGGTGGTGCTGTTTC

[0584] TGCTCGCGCTTTTCATTATATACCGCCATAAGCAGAAGGGCAAAGAGTCCTCCATGC

[0585] CAGCCGTGACCTATACGCCTGCGATGCGCGTTGTCAACGCCGATTACACCATCAGTG

[0586] GTACCCTCCCGCACAGTAACGGCGGAAATGCAAACTCTCATTACTTTACAAATCCTA

[0587] GTTACCATACACTCACTCAGTGTGCTACCTCTCCCCATGTGAACAATCGGGACAGGA

[0588] TGACCGTTACGAAAAGCAAAAATAACCAGTTGTTTGTGAACCTTAAGAATGTGAAT

[0589] CCCGGCAAGAGGGGTCCGGTGGGTGACTGCACCGGAACTCTCCCCGCTGACTGGA

[0590] AGCATGGCGGGTACCTGAACGAACTCGGCGCGTTTGGGCTCGACCGAAGCTACATG

[0591] GGTAAAAGTCTTAAGGACCTCGGTAAGAATAGCGAGTATAATAGCTCTAACTGTTCC

[0592] CTTTCCAGCTCCGAGAATCCGTACGCTACTATAAAAGACCCCCCGGTGCTCATTCCC

[0593] AAATCCAGTGAGTGCGGGTACGTGGAGATGAAAAGTCCCGCTCGAAGAGACAGTC

[0594] CATACGCGGAAATCAATAACTCCACCAGTGCGAACCGCAATGTGTACGAAGTGGAG

[0595] CCCACCGTTTCCGTTGTACAAGGTGTATTTTCAAACAATGGGAGGCTTAGCCAGGAC

[0596] CCCTATGATCTTCCAAAGAACAGCCACATCCCGTGTCATTATGATCTGTTGCCGGTG

[0597] AGGGATTCTAGCTCTTCTCCTAAACAAGAGGACTCAGGTGGCTCTAGTTCCAACTCC

[0598] TCCAGTTCTTCAGAG

[0599] B4_AC_MEG(SEQ ID NO:57):

[0600] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCTCCA

[0601] CCATTGAGGAACAGGCCAAGACATTTTTGGACAAGTTTAACCACGAAGCCGAAGAC

[0602] CTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAATATTACTGAAGAGA

[0603] ATGTCCAAAACATGAATAATGCTGGGGACAAATGGTCTGCCTTTTTAAAGGAACAGT

[0604] CCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTC

[0605] AGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAA

[0606] ACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTG

[0607] TAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAAT

[0608] GGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTG

[0609] AGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAG

[0610] ATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAA

[0611] GTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGA

[0612] ACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCA

[0613] AAGTTGATGAATGCCTATCCTTCCTATATCAGTCCAATTGGATGCCTCCCTGCTCATTT

[0614] GCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACTCTTTGACAGTTCCCTTT

[0615] GGACAGAAACCAAACATAGATGTTACTGATGCAATGGTGGACCAGGCCTGGGATGC

[0616] ACAGAGAATATTCAAGGAGGCCGAGAAGTTCTTTGTATCTGTTGGTCTTCCTAATAT

[0617] GACTCAAGGATTCTGGGAAAATTCCATGCTAACGGACCCAGGAAATGTTCAGAAAG

[0618] CAGTCTGCCATCCCACAGCTTGGGACCTGGGGAAGGGCGACTTCAGGATCCTTATG

[0619] TGCACAAAGGTGACAATGGACGACTTCCTGACAGCTCATCATGAGATGGGGCATAT

[0620] CCAGTATGATATGGCATATGCTGCACAACCTTTTCTGCTAAGAAATGGAGCTAATGAA

[0621] GGATTCCATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACACCTAAGCAT

[0622] TTAAAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAAGACAATGAAACAGAAATA

[0623] AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCCATTTACTTACATG

[0624] TTAGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAAAGACCAGTGGAT

[0625] GAAAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTGGAACCTGTGCCC

[0626] CATGATGAAACATACTGTGACCCCGCATCTCTGGTTCCATGTTTCTAATGATTACTCAT

[0627] TCATTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGAAGCACTTTGTC

[0628] AAACAGCTAAACATGAAGGCCCTCTGCACAAATGTGACATCTCAAACTCTACAGAA

[0629] GCTGGACAGAAACTGTTCAATATGCTGAGGCTTGGAAAATCAGAACCCTGGACCCT

[0630] AGCATTGGAAAATGTTGTAGGAGCAAAGAACATGAATGTAAGGCCACTGCTCAACT

[0631] ACTTTGAGCCCTTATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTTTGTGGGAT

[0632] GGAGTACCGACTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAGGATAAGCCTA

[0633] AAATCAGCTCTTGGAGATAAAGCATATGAATGGAACGACAATGAAATGTACCTGTTC

[0634] CGATCATCTGGTTGCATATGCTATGAGGCAGTACTTTTTAAAAGTAAAAAATCAGATGA

[0635] TTCTTTTTGGGGAGGAGGATGTGCGAGTGGCTAATTTGAAACCAAGAATCTCCTTTA

[0636] ATTTCTTTGTCACTGCACCTAAAAATGTGTCTGATATCATTCCTAGAACTGAAGTTGA

[0637] AAAGGCCATCAGGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTCTGAATGACAA

[0638] CAGCCTAGAGTTTCTGGGGATACAGCCAACACTTGGACCTCCTAACCAGCCCCCTG

[0639] TTTCCGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCG

[0640] CCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCC

[0641] AGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTC

[0642] GCCTGTGATGCTATCGCGGGGATCATTATATTGGTCTTGGTGGTGCTGTTTCTGCTCG

[0643] CGCTTTTCATTATATACCGCCATAAGCAGAAGGGCAAAGAGTCCTCCATGCCAGCCG

[0644] TGACCTATACGCCTGCGATGCGCGTTGTCAACGCCGATTACACCATCAGTGGTACCC

[0645] TCCCGCACAGTAACGGCGGAAATGCAAACTCTCATTACTTTACAAATCCTAGTTACC

[0646] ATACACTCACTCAGTGTGCTACCTCTCCCCATGTGAACAATCGGGACAGGATGACCG

[0647] TTACGAAAAGCAAAAATAACCAGTTGTTTGTGAACCTTAAGAATGTGAATCCCGGC

[0648] AAGAGGGGTCCGGTGGTGACTGCACCGGAACTCTCCCCGCTGACTGGAAGCATG

[0649] GCGGGTACCTGAACGAACTCGGCGCGTTTGGGCTCGACCGAAGCTACATGGGTAAA

[0650] AGTCTTAAGGACCTCGGTAAGAATAGCGAGTATAATAGCTCTAACTGTTCCCTTTC

[0651] AGCTCCGAGAATCCGTACGTACTATAAAAGACCCCCGGTGCTCATTCCCAAATCC

[0652] AGTGAGTGCGGGTACGTGGAGAATGAAAAGTCCCGCTCGAAGAGACAGTCCATACG

[0653] CGGAAATCAATAACTCCACCAGTGCGAACCGCAATGTGTACGAAGTGGAGCCCACC

[0654] GTTTCCGTTGTACAAGGTGTATTTTCAAACAATGGGAGGCTTTAGCCAGGACCCCTAT

[0655] GATCTTCCAAAGAACAGCCACATCCCGTGTCATTATGATCTGTTGCCGGTGAGGAT

[0656] TCTAGCTCTTCTCCTAAAACAAGAGGACTCAGGTGGCTCTAGTTCCAACTCCTCCAGT

[0657] TCTTCAGAG

[0658] B5_sc_Dec(SEQ ID NO:76):

[0659] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTCACACTCAACTGCAT

[0660] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAGGGCAGTTGTGCT

[0661] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[0662] TCGTTATAGCGGTGGTGCTTGGGTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCA

[0663] CGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCT

[0664] GTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGG

[0665] GGGCTGGACTTCGCCTGTGATGGATCCGACATCCAGATGACCCAGAGCCCCTCCTCT

[0666] TTATCCGCCTCTGTGGGCGACAGAGTGACCATCACTTGTCGTGCCAGCCAAGAAAT

[0667] CTCCGGCTATCTGTCTTGGCTGCAGCAGAAGCCCGGTAAGGCTATCAAGAGACTCAT

[0668] CTACGCCGCCAGCACTTTACAGAGCGGAGTGCCTAGCAGATTTAGCGGCTCTCGTA

[0669] GCGGCAGCGATTATACTTTAACCATCTCCTCTTTACAGCCCGAAGACTTTGCTACCTA

[0670] CTACTGTTTACAGTACGCCAGCTACCCCTTCACCTTCGGTCAAGGTACCAAGCTGGA

[0671] GATCAAAGGTGGCGGCGGCTCTGGCGGCGGTGGCTCTGGCGGTGGCTCCGGCGGT

[0672] GGTGGTAGCCAAGTTACCCTCAAGGAGAGCGGCCCCACTTTAGTGAAGCCTACCCA

[0673] GACTTTAACTTTAACTTGTACCTTCAGCGGCTTCTCTTTAAGCACCTCCACAATGGG

[0674] CGTGGGCTGGATCAGACAGCCTCCCGGCAAGGCTCTGGAGTGGCTGGCCCACATCC

[0675] TCTGGAACGACAGCAAGAGGTACAACCCCTCTTTAAAGTCTCGTCTGACCATCACC

[0676] AAGGACACCTCCAAGAAGCAAGTTGTGCTGACCATGACCAATATGGACCCCGTGGA

[0677] CACCGCCACCTATTACTGCGCTCGTATCGTGTACTACTCCACCTACGTGGGCTACTTC

[0678] GACGTCTGGGGACAAGGTACCACCGTGACCGTGAGCTCT

[0679] B6_AC_Dec(SEQ ID NO:58):

[0680] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTACACTCAACTGCAT

[0681] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAAGGGCAGTTGTGCT

[0682] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[0683] TCGTTATAGCGGTGGTGCTTGGGTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCA

[0684] CGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCT

[0685] GTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGG

[0686] GGGCTGGACTTCGCCTGTGATGGATCCTCCACCATTGAGGAACAGGCCAAGACATT

[0687] TTTGGACAAGTTTAACCACGAAGCCGAAGACCTGTTCTATCAAAGTTCACTTGCTTC

[0688] TTGGAATTATAACACCAATATTACTGAAGAGAATGTCCAAAACATGAATAATGCTGG

[0689] GGACAAATGGTCTGCCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACT

[0690] ACAAGAAATTCAGAATCTCACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATG

[0691] GGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACGGTTGAACACAATTCTAAATACA

[0692] ATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGC

[0693] TTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAG

[0694] AGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATT

[0695] ATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGA

[0696] CTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTA

[0697] CAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATT

[0698] ATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCCTATCCTTCCTAT

[0699] ATCAGTCCAATTGGATGCCTCCCTGCTCATTTGCTTGGTGATATGTGGGGTAGATTTT

[0700] GGACAAATCTGTACTCTTTGACAGTTCCCTTTGGACAGAAACCAAACATAGATGTTA

[0701] CTGATGCAATGGTGGACCAGGCCTGGGATGCACAGAGAATATTCAAGGAGGCCGAG

[0702] AAGTTCTTTGTATCTGTTGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAATTCCA

[0703] TGCTAACGGACCCAGGAAATGTTCAGAAAGCAGTCTGCCATCCCACAGCTTGGGAC

[0704] CTGGGGAAGGGCGACTTCAGGATCCTTATGTGCACAAAGGTGACAATGGACGACTT

[0705] CCTGACAGCTCATCATGAGATGGGGCATATCCAGTATGATATGGCATATGCTGCACAA

[0706] CCTTTTCTGCTAAGAAATGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGAAATC

[0707] ATGTCACTTTCTGCAGCCACACCTAAGCATTTAAAATCCATTGGTCTTCTGTCACCCG

[0708] ATTTTCAAGAAGACAATGAAACAGAAATAAACTTCCTGCTCAAACAAGCACTCACG

[0709] ATTGTTGGGACTCTGCCATTTACTTACATGTTAGAGAAGTGGAGGTGGATGGTCTTT

[0710] AAAGGGGAAATTCCCAAAGACCAGTGGATGAAAAAGTGGTGGGAGATGAAGCGAG

[0711] AGATAGTTGGGGTGGTGGAACCTGTGCCCCATGATGAAACATACTGTGACCCCGCAT

[0712] CTCTGTTCCATGTTTCTAATGATTACTCATTCATTCGATATTACACAAGGACCCTTTAC

[0713] CAATTCCAGTTTCAAGAAGCACTTTGTCAAGCAGCTAAACATGAAGGCCCTCTGCA

[0714] CAAATGTGACATCTCAAACTCTACAGAAGCTGGACAGAAACTGTTCAATATGCTGA

[0715] GGCTTGGAAAATCAGAACCCTGGACCCTAGCATTGGAAAATGTTGTAGGAGCAAAG

[0716] AACATGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCTTATTTACCTGGCTGAAA

[0717] GACCAGAACAAGAATTCTTTTGTGGGATGGAGTACCGACTGGAGTCCATATGCAGA

[0718] CCAAAGCATCAAAGTGAGGATAAGCCTAAAATCAGCTCTTGGAGATAAAGCATATG

[0719] AATGGAACGACAATGAAATGTACCTGTTCCGATCATCTGTTGCATATGCTATGAGGC

[0720] AGTACTTTTTAAAAGTAAAAAATCAGATGATTCTTTTTGGGGAGGAGGATGTGCGAG

[0721] TGGCTAATTTGAAACCAAGAATCTCCTTTAATTTCTTTGTCACTGCACCTAAAAATGT

[0722] GTCTGATATCATTCCTAGAACTGAAGTTGAAAAGGCCATCAGGATGTCCCGGAGCCG

[0723] TATCAATGATGCTTTCCGTCTGAATGACAACAGCCTAGAGTTTCTGGGGATACAGCC

[0724] AACACTTGGACCTCCTAACCAGCCCCCTGTTTCC

[0725] B7_sc_DecFull(SEQ ID NO:77):

[0726] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTACACTCAACTGCAT

[0727] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAAGGGCAGTTGTGCT

[0728] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[0729] TCGTTATAGCGGTGGTGCTTGGGACCATGGCGATCTGGCGCTCCAACTCTGGAAGTA

[0730] ACACCCTTGAAAATGGTTACTTCCTCAGTAGGAACAAAGAGAACCATTCCCAGCCG

[0731] ACACAGTCAAGCCTTGAAGATTCAGTCACCCCTACAAAGGCCGTAAAAACGACAG

[0732] GTGTCCTGTCCTCTCCGTGTCCGCCTAACTGGATCATCTACGAGAAAAGTTGTTATCT

[0733] GTTTAGCATGAGCCTTAACAGTTGGGATGGCTCAAAAAGGCAGTGCTGGCAACTGG

[0734] GGAGCAACCTTTTGAAGATAGACAGTTCCAACGAACTGGGCTTCATAGTCAAACAG

[0735] GTGTCCTCTCAACCTGATAACTCATTCTGGATCGGGCTCAGTCGACCCCAAACTGAG

[0736] GTTCCATGGCTTTGGGAAGACGGCAGCACTTTCTCTTCAAATTTGTTTCAAATAAGA

[0737] ACCACCGCTACGCAGGAGAATCCGAGTCCGAACTGTGTTTGGATTCACGTCTCAGT

[0738] CATTTACGACCAACTTTGTAGTGTCCCTAGCTATTCCATCTGCGAGAAAAAGTTCAG

[0739] TATGGGATCCGACATCCAGATGACCCAGAGCCCCTCCTCTTTATCCGCCTCTGTGGG

[0740] CGACAGAGTGACCATCACTTGTCGTGCCAGCCAAGAAATCTCCGGCTATCTGTCTTG

[0741] GCTGCAGCAGAAGCCCGGTAAGGCTATCAAGAGACTCATCTACGCCGCCAGCACTT

[0742] TACAGAGCGGAGTGCCTAGCAGATTTAGCGGCTCTCGTAGCGGCAGCGATTATACTT

[0743] TAACCATCTCCTCTTTACAGCCCGAAGACTTTGCTACCTACTACTGTTTACAGTACGC

[0744] CAGCTACCCCTTCACCTTCGGTCAAGGTACCAAGCTGGAGATCAAAGGTGGCGGCG

[0745] GCTCTGGCGGCGGTGGCTCTGGCGGTGGCTCCGGCGGTGGTGGTAGCCAAGTTACC

[0746] CTCAAGGAGAGCGGCCCCACTTTAGTGAAGCCTACCCAGACTTTAACTTTAACTTGT

[0747] ACCTTCAGCGGCTTCTCTTTAAGCACCTCCACAATGGGCGTGGGCTGGATCAGACA

[0748] GCCTCCCGGCAAGGCTCTGGAGTGGCTGGCCCACATCCTCTGGAACGACAGCAAG

[0749] AGGTACAACCCCTCTTTAAAGTCTCGTCTGACCATCACCAAGGACACCTCCAAGAA

[0750] GCAAGTTGTGCTGACCATGACCAATATGGACCCCGTGGACACCGCCACCTATTACTG

[0751] CGCTCGTATCGTGTACTACTCCACCTACGTGGGCTACTTCGACGTCTGGGGACAAGG

[0752] TACCACCGTGACCGTGAGCTCT

[0753] B8_AC_DecFull(SEQ ID NO:59):

[0754] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTACACTCAACTGCAT

[0755] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAAGGGCAGTTGTGCT

[0756] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[0757] TCGTTATAGCGGTGGTGCTTGGGACCATGGCGATCTGGCGCTCCAACTCTGGAAGTA

[0758] ACACCCTTGAAAATGGTTACTTCCTCAGTAGGAACAAAGAGAACCATTCCCAGCCG

[0759] ACACAGTCAAGCCTTGAAGATTCAGTCACCCCTACAAAGGCCGTAAAAACGACAG

[0760] GTGTCCTGTCCTCTCCGTGTCCGCCTAACTGGATCATCTACGAGAAAAGTTGTTATCT

[0761] GTTTAGCATGAGCCTTAACAGTTGGGATGGCTCAAAAAGGCAGTGCTGGCAACTGG

[0762] GGAGCAACCTTTTGAAGATAGACAGTTCCAACGAACTGGGCTTCATAGTCAAACAG

[0763] GTGTCCTCTCAACCTGATAACTCATTCTGGATCGGGCTCAGTCGACCCCAAACTGAG

[0764] GTTCCATGGCTTTGGGAAGACGGCAGCACTTTCTCTTCAAATTTGTTTCAAATAAGA

[0765] ACCACCGCTACGCAGGAGAATCCGAGTCCGAACTGTGTTTGGATTCACGTCTCAGT

[0766] CATTTACGACCAACTTTGTAGTGTCCCTAGCTATTCCATCTGCGAGAAAAAGTTCAG

[0767] TATGGGATCCTCCACCATTGAGGAACAGGCCAAGACATTTTTGGACAAGTTTAACCA

[0768] CGAAGCCGAAGACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAA

[0769] TATTACTGAAGAGAATGTCCAAAACATGAATAATGCTGGGGACAAATGGTCTGCCTT

[0770] TTTAAAGGAACAGTCCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCT

[0771] CACAGTCAAGCTTCAGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAG

[0772] AAGACAAGAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGT

[0773] ACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGT

[0774] TTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGA

[0775] AAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGG

[0776] TCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGA

[0777] GAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTG

[0778] ATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATG

[0779] CCTATGTGAGGGCAAAGTTGATGAATGCCTATCCTTCCTATATCAGTCCAATTGGATG

[0780] CCTCCCTGCTCATTTGCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACTCT

[0781] TTGACAGTTCCCTTTGGACAGAAACCAAACATAGATGTTACTGATGCAATGGTGGAC

[0782] CAGGCCTGGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGTTCTTTGTATCTGTT

[0783] GGTCTTCCTAATATGACTCAAGGATTCTGGGAAAATTCCATGCTAACGGACCCAGGA

[0784] AATGTTCAGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGGGGAAGGGCGACTT

[0785] CAGGATCCTTATGTGCACAAAGGTGACAATGGACGACTTCCTGACAGCTCATCATGA

[0786] GATGGGGCATATCCAGTATGATATGGCATATGCTGCACAACCTTTTCTGCTAAGAAAT

[0787] GGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAGCC

[0788] ACACCTAAGCATTTAAAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAAGACAAT

[0789] GAAACAGAAATAAACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCC

[0790] ATTTACTTACATGTTAGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAA

[0791] AGACCAGTGGATGAAAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTG

[0792] GAACCTGTGCCCCATGATGAAACATACTGTGACCCCGCATCTCTGTTCCATGTTTCTA

[0793] ATGATTACTCATTCATTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGA

[0794] AGCACTTTGTCAAGCAGCTAAACATGAAGGCCCTCTGCACAAATGTGACATCTCAA

[0795] ACTCTACAGAAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTGGAAAATCAGAA

[0796] CCCTGGACCCTAGCATTGGAAAATGTTGTAGGAGCAAAGAACATGAATGTAAGGCC

[0797] ACTGCTCAACTACTTTGAGCCCTTATTTACCTGGCTGAAAGACCAGAACAAGAATTC

[0798] TTTTGTGGGATGGAGTACCGACTGGAGTCCATATGCAGACCAAAGCATCAAAGTGA

[0799] GGATAAGCCTAAAATCAGCTCTTGGAGATAAAGCATATGAATGGAACGACAATGAAA

[0800] TGTACCTGTTCCGATCATCTGTTGCATATGCTATGAGGCAGTACTTTTTAAAAGTAAA

[0801] AAATCAGATGATTCTTTTTGGGGAGGAGGATGTGCGAGTGGCTAATTTGAAACCAA

[0802] GAATCTCCTTTAATTTCTTTGTCACTGCACCTAAAAATGTGTCTGATATCATTCCTAG

[0803] AACTGAAGTTGAAAAGGCCATCAGGATGTCCCGGAGCCGTATCAATGATGCTTTCC

[0804] GTCTGAATGACAACAGCCTAGAGTTCTGGGGATACAGCCAACACTTGGACCTCCT

[0805] AACCAGCCCCCTGTTTCC

[0806] B9_sc_163(SEQ ID NO:78):

[0807] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCGACA

[0808] TCCAGATGACCCAGAGCCCCTCCTCTTTATCCGCCTCTGTGGGCGACAGAGTGACCA

[0809] TCACTTGTCGTGCCAGCCAAGAAATCTCCGGCTATCTGTCTTGGCTGCAGCAGAAG

[0810] CCCGGTAAGGCTATCAAGAGACTCATCTACGCCGCCAGCACTTTACAGAGCGGAGT

[0811] GCCTAGCAGATTTAGCGGCTCTCGTAGCGGCAGCGATTATACTTTAACCATCTCCTCT

[0812] TTACAGCCCGAAGACTTTGCTACCTACTACTGTTTACAGTACGCCAGCTACCCCTTC

[0813] ACCTTCGGTCAAGGTACCAAGCTGGAGATCAAAGGTGGCGGCGGCTCTGGCGGCG

[0814] GTGGCTCTGGCGGTGGCTCCGGCGGTGGTGGTAGCCAAGTTACCCTCAAGGAGAGC

[0815] GGCCCCACTTTAGTGAAGCCTACCCAGACTTTAACTTTAACTTGTACCTTCAGCGGC

[0816] TTCTCTTTAAGCACCTCCACAATGGGCGTGGGCTGGATCAGACAGCCTCCCGGCAA

[0817] GGCTCTGGAGTGGCTGGCCCACATCCTCTGGAACGACAGCAAGAGGTACAACCCCT

[0818] CTTTAAAGTCTCGTCTGACCATCACCAAGGACACCTCCAAGAAGCAAGTTGTGCTG

[0819] ACCATGACCAATATGGACCCCGTGGACACCGCCACCTATTACTGCGCTCGTATCGTG

[0820] TACTACTCCACCTACGTGGGCTACTTCGACGTCTGGGGACAAGGTACCACCGTGAC

[0821] CGTGAGCTCTGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGC

[0822] CAGGCCCGCGACCACCAACACCGGCGCCACCATCGCGTCGCAGCCCCTGTCCCTG

[0823] CGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGCGCAGTGCACACGAGGGGGCTG

[0824] GACTTCGCCTGTGATTCATCCCTGGGTGGAACAGATAAGGAGTTGAGGTTGGTGGA

[0825] TGGAGAGAATAAGTGCAGTGGACGGTTGAGGTCAAGGTGCAGGAAGAGTGGGT

[0826] ACTGTTTGTAACAACGGCTGGAGTATGGAAGCAGTCTCCGTGATATGCAATCAACTT

[0827] GGTTGCCCTACAGCCATAAAAGCTCCTGGATGGGCTAACTCATCTGCCGGAAGCGG

[0828] TCGAATATGGATGGACCATGTATCCTGTAGGGGCAATGAGTCAGCACTGTGGGACTG

[0829] CAAGCATGACGGGTGGGGAAAACACTCTTAATTGTACCCACCAGCAAGATGCCGGTG

[0830] TGACGTGTAGCGACGGCAGCAACTTGGAGATGCGGTTGACGGCCGGCGGAACAT

[0831] GTGCAGCGGTCGCATTGAGATAAAGTTCCAAGGGCGTGGGACCGTTTGTGACG

[0832] ACAACTTCAATATAGATCATGCTAGTGTGATATGCAGGCAGTTGGAGTGCGGTAGCG

[0833] CCGTCTCATTTAGTGGTTCTAGCAATTTCGGTGAGGGATCCGGGCCTATATGGTTCGA

[0834] CGACCTTATCTGCAATGGAAATGAGAGCGCCCTCTGGAACTGCAAGCACCAAGGTT

[0835] GGGGTAAGCATAACTGCGATCATGCTGAGGATGCGGGTGTGATTTGTAGCAAGGGA

[0836] GCCGACTTGTCACTTCGACTCGTAGATGGCGTGACGGAATGTAGCGGTCGCCTTGA

[0837] GGTACGCTTCCAAGGTGAATGGGGCACAATCTGTGATGACGGTTGGGACTCATATGA

[0838] CGCTGCGGTTGCTTGCAAACAGCTGGGCTGTCCGACAGCGGTAACGGCAATTGGGC

[0839] GGGTAAATGCCAGTAAGGGGTTTGGACATATATGGTTGGACAGTGTTTCTTGTCAGG

[0840] GACACGAACCTGCAATATGGCAATGTAAACATCACGAGTGGGGGAAGCATTACTGC

[0841] AATCATAATGAAGACGCAGGCGTCACATGCTCTGACGGATCCGACCTGGAATTGCG

[0842] GCTGAGAGGGGGGGGTTCACGGTGCGCAGGAACCGTGGAAGTTGAGATTCAACGC

[0843] CTGCTCGGGAAAGTTTGTGACAGGGGGTGGGGCCTTAAGGAAGCAGACGTAGTCT

[0844] GCCGACAACTGGGTTGCGGGAGCGCCCTCAAGACGTCCTATCAAGTTTACAGCAAA

[0845] ATTCAAGCAACTAATACCTGGCTGTTTCTTTCCTCCTGCAATGGTAACGAAACGAGC

[0846] CTCTGGGATTGTAAAAATTGGCAATGGGGAGGCCTTACATGTGATCACTATGAAGAG

[0847] GCCAAAATCACCTGCAGCGCGCACCGAGAGCCTAGGCTGGTTGGAGGGGATATTCC

[0848] CTGTTCAGGTAGAGTTGAAGTCAAGCATGGTGATACCTGGGGGTCCATATGCGACTC

[0849] CGATTTCAGTTTGGAAGCAGCGAGCGTGCTGTGCCGAGAGCTTCAATGTGGGACAG

[0850] TAGTTTCCATTCTTGGTGGCGCCCACTTCGGGGAAGGTAACGGACAGATTTGGGCG

[0851] GAGGAATTCCAATGTGAGGGCCATGAAAGTCACCTGAGTCTTTGTCCTGTAGCGCC

[0852] TCGGCCGGAAGGTACTTGTTCTCACTCCAGAGACGTTGGCGTGGTTTGTTCTAGGTA

[0853] CACTGAGATAAGGCTGGTGAATGGCAAAACGCCTTGTGAAGGAAGGGTGGAGCTC

[0854] AAAACGCTTGGCGCCTGGGGGTCTCTGTGCAACTCCCACTGGGACATAGAGGACGC

[0855] ACATGTCTTGTGCCAGCAACTCAAATGCGGTGTCGCGCTTTCAACCCCTGGGGGCG

[0856] CTAGATTCGGGAAAGGTAACGGCCAGATATGGCGCCATATGTTCCATTGCACCGGAA

[0857] CTGAACAGCATATGGGAGATTGTCCTGTGACTGCCTTGGGGGCAAGTCTGTGTCCCT

[0858] CAGAACAAGTGGCTTCAGTTATTTGCAGCGGTAACCAGAGTCAGACGCTCAGCTCC

[0859] TGCAACAGCAGCAGTCTGGGTCCAACAAGACCCACAATACCCGAGGAGTCAGCGG

[0860] TCGCGTGCATCGAATCCGGGCAATTGAGACTCGTTAATGGCGGGGGTCGGTGCGCA

[0861] GGGCGCGTGGAGATCTACCACGAGGGTAGTTGGGGCACAATTTGTGACGACAGCTG

[0862] GGACCTTTCCGACGCTCATGTCGTATGCCGACAACTGGGGTGCGGTGAGGCCATCA

[0863] ATGCCACCGGAAGCGCGCATTTCGGTGAAGGCACGGGCCCAATTTGGCTTGATGAG

[0864] ATGAAATGTAATGGAAAGGAGTCCCGCATTTGGCAATGCCATAGCCATGGCTGGGGT

[0865] CAACAAAATTGTCGACACAAAGAAGATGCCGGGGTGATCTGCTCAGAATTCATGTC

[0866] CTTGCGGCTTACTAGCGAAGCGTCCCGCGAGGCCTGTGCTGGGAGACTGGAAGTTT

[0867] TTTATAACGGGGCTTGGGGAACGGTTGGTAAGTCATCAATGAGTGAAACCACAGTT

[0868] GGTGTTGTGTGTAGACAACTCGGTTGCGCCGACAAGGGAAAGATCAACCCGGCGA

[0869] GCCTTGATAAGGCCATGAGCATCCCCATGTGGGTGGATAACGTTCAGTGTCCGAAAG

[0870] GTCCCGATACCTTGTGGCAATGCCCAAGTTCTCCTTGGGAGAAGAGACTCGCCTCA

[0871] CCAAGTGAAGAGACGTGGATTACGTGTGATAACAAAATTAGGCTCCAAGAAGGACC

[0872] GACCAGTTGCAGCGGAAGAGTTGAGATATGGCATGGAGGAAGCTGGGGAACCGTG

[0873] TGCGATGACAGCTGGGACCTGGACGACGCCCAGGTGGTGTGCCAACAGCTGGGTT

[0874] GCGGGCCTGCCCTCAAAGCATTTAAGGAAGCCGAATTCGGTCAGGGTACTGGGCCA

[0875] ATCTGGCTGAACGAGGTAAAGTGCAAAGGTAACGAAAGTAGCCTGTGGGACTGTCC

[0876] GGCACGAAGGTGGGGCCACAGCGAGTGTGGCCATAAGGAAGACGCGGCCGTGAAC

[0877] TGTACAGACATATCCGTACAAAAAACGCCCCAAAAGGCGACGACCGGGCGATCATC

[0878] AAGACAATCTAGCTTTATTGCCGTGGGAATTCTCGGTGTAGTGCTTCTTGCTATATTT

[0879] GTCGCTTTGTTCTTTCTGACTAAAAAGCGCAGGCAAAGGCAGCGGCTTGCTGTGAG

[0880] CTCTCGGGGGAGAAAACCTCGTTCACCAAATCCAATACCGAGAAATGAACTCCTGTC

[0881] TCAACGCCGACGATCTTGACCTGATGAACTCATCTGAGAACTCACACGAGTCCGCC

[0882] GATTTCAGCGCGGCGGAATTGATTCTCTGTCAGCAAATTTCTGCCTATAAGTGGCATG

[0883] GAAAAAAAGAGCCATACTCTCTCACACGGAAAAGGAAAATGGCAACCTT

[0884] B10_AC_163(SEQ ID NO:60):

[0885] ATGAGGCTACCCCTGCTCCTGGTTTTTGCCTCTGTCATTCCGGGTGCTGTTCTCTCCA

[0886] CCATTGAGGAACAGGCCAAGACATTTTTGGACAAGTTTAACCACGAAGCCGAAGAC

[0887] CTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAATATTACTGAAGAGA

[0888] ATGTCCAAAACATGAATAATGCTGGGGACAAATGGTCTGCCTTTTTAAGGAACAGT

[0889] CCACACTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCTCACAGTCAAGCTTC

[0890] AGCTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAA

[0891] ACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTG

[0892] TAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAAT

[0893] GGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTG

[0894] AGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAG

[0895] ATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAA

[0896] GTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGA

[0897] ACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCA

[0898] AAGTTGATGAATGCCTATCCTTCCTATATCAGTCCAATTGGATGCCTCCCTGCTCATTT

[0899] GCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACTCTTTGACAGTTCCCTTT

[0900] GGACAGAAACCAAACATAGATGTTACTGATGCAATGGTGGACCAGGCCTGGGATGC

[0901] ACAGAGAATATTCAAGGAGGCCGAGAAGTTCTTTGTATCTGTTGGTCTTCCTAATAT

[0902] GACTCAAGGATTCTGGGAAAATTCCATGCTAACGGACCCAGGAAATGTTCAGAAAG

[0903] CAGTCTGCCATCCCACAGCTTGGGACCTGGGGAAGGGCGACTTCAGGATCCTTATG

[0904] TGCACAAAGGTGACAATGGACGACTTCCTGACAGCTCATCATGAGATGGGGCATAT

[0905] CCAGTATGATATGGCATATGCTGCACAACCTTTTCTGCTAAGAAATGGAGCTAATGAA

[0906] GGATTCCATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACACCTAAGCAT

[0907] TTAAAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAAGACAATGAAACAGAAATA

[0908] AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCCATTTACTTACATG

[0909] TTAGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAAAGACCAGTGGAT

[0910] GAAAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTGGAACCTGTGCCC

[0911] CATGATGAAACATACTGTGACCCCGCATCTCTGTTCCATGTTTCTAATGATTACTCAT

[0912] TCATTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGAAGCACTTTGTC

[0913] AAGCAGCTAAACATGAAGGCCCTCTGCACAAATGTGACATCTCAAACTCTACAGAA

[0914] GCTGGACAGAAACTGTTCAATATGCTGAGGCTTGGAAAATCAGAACCCTGGACCCT

[0915] AGCATTGGAAAATGTTGTAGGAGCAAAGAACATGAATGTAAGGCCACTGCTCAACT

[0916] ACTTTGAGCCCTTATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTTTGTGGGAT

[0917] GGAGTACCGACTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAGGATAAGCCTA

[0918] AAATCAGCTCTTGGAGATAAAGCATATGAATGGAACGACAATGAAATGTACCTGTTC

[0919] CGATCATCTGTTGCATATGCTATGAGGCAGTACTTTTTAAAAGTAAAAAATCAGATGA

[0920] TTCTTTTTGGGGAGGAGGATGTGCGAGTGGCTAATTTGAAACCAAGAATCTCCTTTA

[0921] ATTTCTTTGTCACTGCACCTAAAAATGTGTCTGATATCATTCCTAGAACTGAAGTTGA

[0922] AAAGGCCATCAGGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTCTGAATGACAA

[0923] CAGCCTAGAGTTTCTGGGGATACAGCCAACACTTGGACCTCCTAACCAGCCCCCTG

[0924] TTTCCGGATCCTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCG

[0925] CCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCC

[0926] AGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTC

[0927] GCCTGTGATTCATCCCTGGGTGGAACAGATAAGGAGTTGAGGTTGGTGGATGGAGA

[0928] GAATAAGTGCAGTGGACGGGTTGAGGTCAAGGTGCAGGAAGAGTGGGGTACTGTT

[0929] TGTAACAACGGCTGGAGTATGGAAGCAGTCTCCGTGATATGCAATCAACTTGGTTGC

[0930] CCTACAGCCATAAAAGCTCCTGGATGGGCTAACTCATCTGCCGGAAGCGGTCGAATA

[0931] TGGATGGACCATGTATCCTGTAGGGGCAATGAGTCAGCACTGTGGGACTGCAAGCA

[0932] TGACGGGTGGGGAAAACACTCTAATTGTACCCACCAGCAAGATGCCGGTGTGACGT

[0933] GTAGCGACGGCAGCAACTTGGAGATGCGGTTGACGCGCGGCGGGAACATGTGCAG

[0934] CGGTCGCATTGAGATAAAGTTCCAAGGGCGCTGGGGGACCGTTTGTGACGACAACT

[0935] TCAATATAGATCATGCTAGTGTGATATGCAGGCAGTTGGAGTGCGGTAGCGCCGTCT

[0936] CATTTAGTGGTTCTAGCAATTTCGGTGAGGGATCCGGGCCTATATGGTTCGACGACC

[0937] TTATCTGCAATGGAAATGAGAGCGCCCTCTGGAACTGCAAGCACCAAGGTTGGGGT

[0938] AAGCATAACTGCGATCATGCTGAGGATGCGGGTGTGATTTGTAGCAAGGGAGCCGA

[0939] CTTGTCACTTCGACTCGTAGATGGCGTGACGGAATGTAGCGGTCGCCTTGAGGTACG

[0940] CTTCCAAGGTGAATGGGGCACAATCTGTGATGACGGTTGGGACTCATATGACGCTGC

[0941] GGTTGCTTGCAAACAGCTGGGCTGTCCGACAGCGGTAACGGCAATTGGGCGGGTAA

[0942] ATGCCAGTAAGGGGTTTGGACATATATGGTTGGACAGTGTTTCTTGTCAGGGACACG

[0943] AACCTGCAATATGGCAATGTAAACATCACGAGTGGGGGAAGCATTACTGCAATCATA

[0944] ATGAAGACGCAGGCGTCACATGCTCTGACGGATCCGACCTGGAATTGCGGCTGAGA

[0945] GGGGGGGGTTCACGGTGCGCAGGAACCGTGGAAGTTGAGATTCAACGCCTGCTCG

[0946] GGAAAGTTTGTGACAGGGGGTGGGGCCTTAAGGAAGCAGACGTAGTCTGCCGACA

[0947] ACTGGGTTGCGGGAGCGCCCTCAAGACGTCCTATCAAGTTTACAGCAAAATTCAAG

[0948] CAACTAATACCTGGCTGTTTCTTTCCTCCTGCAATGGTAACGAAACGAGCCTCTGGG

[0949] ATTGTAAAAATTGGCAATGGGGAGGCCTTACATGTGATCACTATGAAGAGGCCAAAA

[0950] TCACCTGCAGCGCGCACCGAGAGCCTAGGCTGGTTGGAGGGGATATTCCCTGTTCA

[0951] GGTAGAGTTGAAGTCAAGCATGGTGATACCTGGGGGTCCATATGCGACTCCGATTTC

[0952] AGTTTGGAAGCAGCGAGCGTGCTGTGCCGAGAGCTTCAATGTGGGACAGTAGTTTC

[0953] CATTCTTGGTGGCGCCCACTTCGGGGAAGGTAACGGACAGATTTGGGCGGAGGAAT

[0954] TCCAATGTGAGGGCCATGAAAGTCACCTGAGTCTTTGTCCTGTAGCGCCTCGGCCG

[0955] GAAGGTACTTGTTCTCACTCCAGAGACGTTGGCGTGGTTTGTTCTAGGTACACTGAG

[0956] ATAAGGCTGGTGAATGGCAAAACGCCTTGTGAAGGAAGGGTGGAGCTCAAAACGC

[0957] TTGGCGCCTGGGGGTCTCTGTGCAACTCCCACTGGGACATAGAGGACGCACATGTC

[0958] TTGTGCCAGCAACTCAAATGCGGTGTCGCGCTTTCAACCCCTGGGGGCGCTAGATT

[0959] CGGGAAAGGTAACGGCCAGATATGGCGCCATATGTTCCATTGCACCGGAACTGAAC

[0960] AGCATATGGGAGATTGTCCTGTGACTGCCTTGGGGGCAAGTCTGTGTCCCTCAGAA

[0961] CAAGTGGCTTCAGTTATTTGCAGCGGTAACCAGAGTCAGACGCTCAGCTCCTGCAA

[0962] CAGCAGCAGTCTGGGTCCAACAAGACCCACAATACCCGAGGAGTCAGCGGTCGCG

[0963] TGCATCGAATCCGGGCAATTGAGACTCGTTAATGGCGGGGGTCGGTGCGCAGGGCG

[0964] CGTGGAGATCTACCACGAGGGTAGTTGGGGCACAATTTGTGACGACAGCTGGGACC

[0965] TTTCCGACGCTCATGTCGTATGCCGACAACTGGGGTGCGGTGAGGCCATCAATGCCA

[0966] CCGGAAGCGCGCATTTCGGTGAAGGCACGGGCCCAATTTGGCTTGATGAGATGAAA

[0967] TGTAATGGAAAGGAGTCCCGCATTTGGCAATGCCATAGCCATGGCTGGGGTCAACA

[0968] AAATTGTCGACACAAAGAAGATGCCGGGGTGATCTGCTCAGAATTCATGTCCTTGC

[0969] GGCTTACTAGCGAAGCGTCCCGCGAGGCCTGTGCTGGGAGACTGGAAGTTTTTTAT

[0970] AACGGGGCTTGGGGAACGGTTGGTAAGTCATCAATGAGTGAAACCACAGTTGGTGT

[0971] TGTGTGTAGACAACTCGGTTGCGCCGACAAGGGAAAGATCAACCCGGCGAGCCTTG

[0972] ATAAGGCCATGAGCATCCCCATGTGGGTGGATAACGTTCAGTGTCCGAAAGGTCCCG

[0973] ATACCTTGTGGCAATGCCCAAGTTCTCCTTGGGAGAAGAGACTCGCCTCACCAAGT

[0974] GAAGAGACGTGGATTACGTGTGATAACAAAATTAGGCTCCAAGAAGGACCGACCAG

[0975] TTGCAGCGGAAGAGTTGAGATATGGCATGGAGGAAGCTGGGGAACCGTGTGCGATG

[0976] ACAGCTGGGACCTGGACGACGCCCAGGTGGTGTGCCAACAGCTGGGTTGCGGGCC

[0977] TGCCCTCAAAGCATTTAAGGAAGCCGAATTCGGTCAGGGTACTGGGCCAATCTGGC

[0978] TGAACGAGGTAAAGTGCAAAGGTAACGAAAGTAGCCTGTGGGACTGTCCGGCACG

[0979] AAGGTGGGGCCACAGCGAGTGTGGCCATAAGGAAGACGCGGCCGTGAACTGTACA

[0980] GACATATCCGTACAAAAAACGCCCCAAAAGGCGACGACCGGGCGATCATCAAGACA

[0981] ATCTAGCTTTATTGCCGTGGGAATTCTCGGTGTAGTGCTTCTTGCTATATTTGTCGCTT

[0982] TGTTCTTTCTGACTAAAAAGCGCAGGCAAAGGCAGCGGCTTGCTGTGAGCTCTCGG

[0983] GGAGAAAACCTCGTTCACCAAATCCAATACCGAGAAATGAACTCCTGTCTCAACGC

[0984] CGACGATCTTGACCTGATGAACTCATCTGAGAACTCACACGAGTCCGCCGATTTCAG

[0985] CGCGGCGGAATTGATCTCTGTCAGCAAATTTCTGCCTATAAGTGGCATGGAAAAAGA

[0986] AGCCATACTCTCTCACACGGAAAAGGAAAATGGCAACCTT

[0987] Example 6: Analysis of the CBR construct based on MEGF10.

[0988] Thp1 cells were transduced with a lentivirus carrying a construct (B4-AC) of ACE2 (19-740aa) located above MEGF10 under the EF1a promoter, and the cells were stained with biotinylated SARS-CoV-2 spike protein (MyBioSource, San Diego, CA), followed by staining with PE-streptavidin (BioLegend, San Diego, CA), and positive cells were sorted using a Melody sorter (BD, Franklin Lakes, NJ). 5.06um beads coated with streptavidin (Spherotech, Lake Forest, IL) were sterilized using 70% isopropanol and labeled with 10uM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated WT SARS-CoV-2 spike protein (MyBioSource, San Diego, CA) or with delta variant B.1.617.2 SARS-CoV-2 spike protein (SinoBiological, Wayne, PA) at a ratio of 0.025 nmole biotinylated spike protein per 0.5 mg beads. The beads were incubated with cells overnight at a ratio of 1:5 (cell:bead). Because MEGF10 is involved in cell adhesion and because all cells clump together and are not split by pipetting ( Fig. 9C ), so cells were treated with Accutase (Sigma-Aldrich, St. Louis, MO) for 15 min before flow cytometric analysis.

[0989] like FIG. 9A to FIG. 9B As shown, only the beads coated with protrusions (WT and B.1.167.2) were engulfed, and only by Thp1 transduced with the MEGF10-based B4-AC CBR construct containing ACE2 (19-740AA) bait on the surface. Uncoated beads were not engulfed, and untransduced (UTD) cells did not engulf any beads.

[0990] Neutralization assay was used to test the ability of SARS-CoV-2 pseudotyped lentivirus in Thp1 cells transduced with CBR constructs (B4-AC) based on MEGF10 containing ACE2 bait on the surface.Similar to Example 4, protrusion-LV-GFP was pre-incubated with B4-ACThp1 or with UTD Thp1 or with ACE2-293 effector cells for 2 hr, and then incubated with ACE2-293 target cells.E:T ratio was 100:1, and during the pre-incubation period, cells were mixed every 15 minutes.Based on the number of target cells, the MOI of the test was 2.3.UTD and B4-AC Thp1 were treated with Accutase (Sigma-Aldrich, St.Louis, MO) for 15 minutes, and then pre-incubated and counted.

[0991] like FIG. 10A to FIG. 10B As shown, pre-incubation with B4-AC Thp1 cells or ACE2-293 cells reduced the viral load in the supernatant, as observed by a decrease in the transduction efficiency of the target cells after subsequent incubation. Pre-incubation with B4-AC Thp1 reduced the viral load by nearly 10-fold.

[0992] Example 7: CPR constructs based on additional scFvs.

[0993] Additional CPR constructs were designed containing either anti-CD19 scFv or anti-CD20 scFv located on the following phagocytic receptors: mannose receptor (F4), MERTK, MEGF10, Dectin-1, and CD163. Schematic diagrams of each of the constructs are in Fig.11 Shown in.

[0994] The nucleotide sequences for each of these constructs are provided below.

[0995] F4_sc19 (SEQ ID NO: 79):

[0996] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC

[0997] AGGCCGGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCT

[0998] CACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTG

[0999] TAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGG

[1000] GGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAG

[1001] GACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACAC

[1002] AGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTAC

[1003] TGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGTGGCTCTGGCGGTGG

[1004] CGGTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGACTACATCCTCCCTGTC

[1005] TGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTA

[1006] AATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA

[1007] TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAA

[1008] CAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTG

[1009] CCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAA

[1010] CACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTAATGACACAA

[1011] GGAAGATGGACCCTTCTAAACCGTCTTCCAACGTGGCCGGAGTAGTCATCATTGTGA

[1012] TCCTCCTGATTTTAACGGGTGCTGGCCTTGCCGCCTATTTCTTTTATAAGAAAAGACG

[1013] TGTGCACCTACCTCAAGAGGGCGCCTTTGAAAACACTCTGTATTTTAACAGTCAGTC

[1014] AAGCCCAGGAACTAGTGATATGAAAGATCTCGTGGGCAATATTGAACAGAATGAAC

[1015] ACTCGGTCATC

[1016] F4_sc20(SEQ ID NO:80):

[1017] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC

[1018] AGGCCGGGATCCCAAATTGTTCTCTCCCAGTCTCCAGCAATCCTTTCTGCATCTCCA

[1019] GGGGAGAAGGTCACAATGACTTGCAGGGCCAGCTCAAGTTTAAGTTTCATGCACTG

[1020] GTACCAGCAGAAGCCAGGATCCTCCCCCAAACCCTGGATTTATGCCACATCCAACCT

[1021] GGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCT

[1022] CACAATCAGCAGAGTGGAGGCTGAAGATGCTGCCACTTATTTCTGCCATCAGTGGA

[1023] GTAGTAACCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTCAAACGGGGTGGC

[1024] GGCGGCTCTGGCGGCGGTGGCTCTGGCGGTGGCGGTTCCGGCGGTGGTGGTAGCCA

[1025] GGTGCAACTGCGGCAGCCTGGGGCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAG

[1026] ATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAG

[1027] CAGACACCTGGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGAAATGGTGAT

[1028] ACTTCCTACAATCAGAAGTTCAAAGGCAAGGCCACATTGACTGCAGACAAATCCTC

[1029] CAGCACAGCCTACATGCAGCTCAGCAGTCTGACATCTGAGGACTCTGCGGTCTATTA

[1030] CTGTGCAAGATCGCACTACGGTAGTAACTACGTAGACTACTTTGACTACTGGGGCCA

[1031] AGGCACCACTCTCACAGTCTCCTCTGACACAAGGAAGATGGACCCTTCTAAACCGT

[1032] CTTCCAACGTGGCCGGAGTAGTCATCATTGTGATCCTCCTGATTTTAACGGGTGCTG

[1033] GCCTTGCCGCCTATTTCTTTTATAAGAAAAGACGTGTGCACCTACCTCAAGAGGGCG

[1034] CCTTTGAAAACACTCTGTATTTTAACAGTCAGTCAAGCCCAGGAACTAGTGATATGA

[1035] AAGATCTCGTGGGCAATATTGAACAGAATGAACACTCGGTCATC

[1036] C1_sc19_MER(SEQ ID NO:81):

[1037] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC

[1038] AGGCCGGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCT

[1039] CACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTG

[1040] TAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGG

[1041] GGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAG

[1042] GACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACAC

[1043] AGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTAC

[1044] TGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGTGGCTCTGGCGGTGG

[1045] CGGTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGACTACATCCTCCCTGTC

[1046] TGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTA

[1047] AATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA

[1048] TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAA

[1049] CAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTG

[1050] CCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAA

[1051] CACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTAATGGATCCTT

[1052] CGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCGCCGCGACCACCA

[1053] ACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCG

[1054] GCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTT

[1055] GGATGTTTTTGTGGTTTCATCCTCATCGGTTTGATATTGTACATAAGTCTGGCGATAA

[1056] GGAAGAGAGTTCAAGAGACAAAGTTCGGAAATGCCTTTACAGAGGAAGACAGTGA

[1057] GCTCGTTGTAAACTACATCGCAAAAAAAAGCTTCTGTAGAAGAGCAATAGAGCTCA

[1058] CGTTGCACTCACTCGGTGTGTCCGAAGAACTCCAGAATAAACTGGAAGACGTCGTT

[1059] ATCGATCGGAACCTCCTCATACTTGGAAAAATACTGGGAGAAGGAGAGTTCGGCAG

[1060] TGTCATGGAAGGTAACTTGAAACAAGAGGATGGTACCTCACTCAAGGTAGCTGTCA

[1061] AGACGATGAAACTTGATAACAGTTCACAAAGGGAGATCGAAGAATTTCTGTCTGAG

[1062] GCCGCCTGTATGAAAGACTTCTCACATCCTAATGTCATCAGACTTCTTGGCGTTTGTA

[1063] TCGAGATGTCTAGCCAAGGAATCCCAAAACCTATGGTCATATTGCCTTTCATGAAATA

[1064] TGGCGATCTGCATACATATTTGCTCTACTCTAGACTTGAGACAGGGCCCAAACATATT

[1065] CCTCTCCAGACATTGCTCAAGTTTATGGTCGATATTGCCCTGGGTATGGAGTACTTGA

[1066] GCAACCGAAATTTTCTGCATCGGGATCTTGCCGCACGCAACTGCATGCTGCGCGATG

[1067] ACATGACCGTCTGCGTGGCTGATTTTGGGCTGTCAAAAAAAATATATTCTGGAGACT

[1068] ACTACCGACAAGGGCGGATTGCAAAGATGCCCGTCAAATGGATTGCGATTGAAAGT

[1069] TTGGCGGACAGGGTATATACTTCCAAATCAGATGTTTGGGCTTTTGGAGTCACTATGT

[1070] GGGAAATAGCTACACGCGGTATGACCCCGTACCCCGGAGTACAAAATCATGAAATGT

[1071] ATGACTATCTCCTTCATGGACACAGGCTGAAGCAGCCCGAGGACTGCCTGGACGAA

[1072] CTGTATGAAATAATGTATTCTTGTTGGCGAACCGATCCCTTGGACCGGCCTACTTTCA

[1073] GTGTCCTTAGATTGCAACTTGAGAAATTGCTCGAGTCTTTGCCGGATGTGCGAAACC

[1074] AGGCAGACGTGATCTATGTCAATACCCAACTTTTGGAAAGTTCTGAGGGCCTCGCAC

[1075] AGGGTTCTACCCTTGCCCCGTTGGATCTTAACATAGACCCAGACAGCATAATTGCTT

[1076] CTTGTACACCTCGCGCTGCCATATCAGTTGTAACAGCGGAGGTCCATGATAGTAAAC

[1077] CTCACGAGGGTCGCTATATCCTGAACGGCGGGTCAGAAGAATGGGAAGACCTGACA

[1078] TCAGCGCCGAGCGCCGCCGTTACTGCTGAGAAAAACTCTGTCCTGCCCGGAGAGCG

[1079] CTTGGTTCGGAACGGGGTAAGTTGGAGCCATAGCTCAATGCTCCCCCTGGGTTCAA

[1080] GTCTCCCGGACGAGCTTCTTTTTGCGGACGACTCATCTGAGGGGTCCGAAGTTCTGA

[1081] TG

[1082] C3_sc19_MEG(SEQ ID NO:82):

[1083] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC

[1084] AGGCCGGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCT

[1085] CACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTG

[1086] TAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGG

[1087] GGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAG

[1088] GACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACAC

[1089] AGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTAC

[1090] TGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGTGGCTCTGGCGGTGG

[1091] CGGTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGACTACATCCTCCCTGTC

[1092] TGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTA

[1093] AATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA

[1094] TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAA

[1095] CAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTG

[1096] CCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAA

[1097] CACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTAATGGATCCTT

[1098] CGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCGCCGCGACCACCA

[1099] ACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCG

[1100] GCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATGCT

[1101] ATCGCGGGGATCATTATATTGGTCTTGGTGGTGCTGTTTCTGCTCGCGCTTTTCATTAT

[1102] ATACCGCCATAAGCAGAAGGGCAAAGAGTCCTCCATGCCAGCCGTGACCTATACGC

[1103] CTGCGATGCGCGTTGTCAACGCCGATTACACCATCAGTGGTACCCTCCCGCACAGTA

[1104] ACGGCGGAAATGCAAACTCTCATTACTTTACAAATCCTAGTTACCATACACTCACTC

[1105] AGTGTGCTACCTCTCCCCATGTGAACAATCGGGACAGGATGACCGTTACGAAAAGC

[1106] AAAAATAACCAGTTGTTTGTGAACCTTAAGAATGTGAATCCCGGCAAGAGGGGTCC

[1107] GGTGGGTGACTGCACCGGAACTCTCCCCGCTGACTGGAAGCATGGCGGGTACCTGA

[1108] ACGAACTCGGCGCGTTTGGGCTCGACCGAAGCTACATGGGTAAAAGTCTTAAGGAC

[1109] CTCGGTAAGAATAGCGAGTATAATAGCTCTAACTGTTCCCTTTCCAGCTCCGAGAAT

[1110] CCGTACGCTACTATAAAAGACCCCCCGGTGCTCATTCCCAAATCCAGTGAGTGCGGG

[1111] TACGTGGAGATGAAAAGTCCCGCTCGAAGAGACAGTCCATACGCGGAAATCAATAA

[1112] CTCCACCAGTGCGAACCGCAATGTGTACGAAGTGGAGCCCACCGTTTCCGTTGTAC

[1113] AAGGTGTATTTTCAAACAATGGGAGGCTTAGCCAGGACCCCTATGATCTTCCAAAGA

[1114] ACAGCCACATCCCGTGTCATTATGATCTGTTGCCGGTGAGGGATTCTAGCTCTTCTCC

[1115] TAAACAAGAGGACTCAGGTGGCTCTAGTTCCAACTCCTCCAGTTCTTCAGAG

[1116] C5_sc19_Dec(SEQ ID NO:83):

[1117] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTACACTCAACTGCAT

[1118] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAAGGGCAGTTGTGCT

[1119] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[1120] TCGTTATAGCGGTGGTGCTTGGGTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCA

[1121] CGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCT

[1122] GTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGG

[1123] GGGCTGGACTTCGCCTGTGATGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGG

[1124] CCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATT

[1125] ACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGC

[1126] TGGGAGTAATATGGGGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGAC

[1127] TGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTG

[1128] CAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCT

[1129] ATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGT

[1130] GGCTCTGGCGGTGGCGGTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGAC

[1131] TACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAA

[1132] GTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTA

[1133] AACTCCTGATCTACCATACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTG

[1134] GCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATA

[1135] TTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGA

[1136] CTAAGTTGGAAATAACACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCAT

[1137] CCAGTAAT

[1138] C7_sc19_DecFull(SEQ ID NO:84):

[1139] ATGGAGTATCACCCCGACCTGGAGAATTTGGACGAGGATGGCTACACTCAACTGCAT

[1140] TTCGATAGTCAGTCCAATACAAGGATCGCTGTTGTGTCTGAAAAGGGCAGTTGTGCT

[1141] GCCAGTCCACCGTGGCGGTTGATTGCCGTCATCCTCGGCATTCTGTGCTTGGTTATTC

[1142] TCGTTATAGCGGTGGTGCTTGGGACCATGGCGATCTGGCGCTCCAACTCTGGAAGTA

[1143] ACACCCTTGAAAATGGTTACTTCCTCAGTAGGAACAAAGAGAACCATTCCCAGCCG

[1144] ACACAGTCAAGCCTTGAAGATTCAGTCACCCCTACAAAGGCCGTAAAAACGACAG

[1145] GTGTCCTGTCCTCTCCGTGTCCGCCTAACTGGATCATCTACGAGAAAAGTTGTTATCT

[1146] GTTTAGCATGAGCCTTAACAGTTGGGATGGCTCAAAAAGGCAGTGCTGGCAACTGG

[1147] GGAGCAACCTTTTGAAGATAGACAGTTCCAACGAACTGGGCTTCATAGTCAAACAG

[1148] GTGTCCTCTCAACCTGATAACTCATTCTGGATCGGGCTCAGTCGACCCCAAACTGAG

[1149] GTTCCATGGCTTTGGGAAGACGGCAGCACTTTCTCTTCAAATTTGTTTCAAATAAGA

[1150] ACCACCGCTACGCAGGAGAATCCGAGTCCGAACTGTGTTTGGATTCACGTCTCAGT

[1151] CATTTACGACCAACTTTGTAGTGTCCCTAGCTATTCCATCTGCGAGAAAAAGTTCAG

[1152] TATGGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCAC

[1153] AGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAA

[1154] GCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGT

[1155] AGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAGGAC

[1156] AACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGC

[1157] CATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTACTGG

[1158] GGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGTGGCTCTGGCGGTGGCG

[1159] GTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGACTACATCCTCCCTGTCTG

[1160] CCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAA

[1161] TATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATA

[1162] CATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACA

[1163] GATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCC

[1164] AACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACA

[1165] CGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTAAT

[1166] C9_sc19_163(SEQ ID NO:85):

[1167] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC

[1168] AGGCCGGGATCCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCT

[1169] CACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTG

[1170] TAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGG

[1171] GGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAG

[1172] GACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACAC

[1173] AGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTAC

[1174] TGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGCGGCGGTGGCTCTGGCGGTGG

[1175] CGGTTCCGGCGGTGGTGGTAGCGACATCCAGATGACACAGACTACATCCTCCCTGTC

[1176] TGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTA

[1177] AATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA

[1178] TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAA

[1179] CAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTG

[1180] CCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAA

[1181] CACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTAATGGATCCTT

[1182] CGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCGCCGCGACCACCA

[1183] ACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCG

[1184] GCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTCA

[1185] TCCCTGGGTGGAACAGATAAGGAGTTGAGGTTGGTGGATGGAGAGAATAAGTGCAG

[1186] TGGACGGGTTGAGGTCAAGGTGCAGGAAGAGTGGGGTACTGTTTGTAACAACGGC

[1187] TGGAGTATGGAAGCAGTCTCCGTGATATGCAATCAACTTGGTTGCCCTACAGCCATA

[1188] AAAGCTCCTGGATGGGCTAACTCATCTGCCGGAAGCGGTCGAATATGGATGGACCAT

[1189] GTATCCTGTAGGGGCAATGAGTCAGCACTGTGGGACTGCAAGCATGACGGGTGGGG

[1190] AAAACACTCTAATTGTACCCACCAGCAAGATGCCGGTGTGACGTGTAGCGACGGCA

[1191] GCAACTTGGAGATGCGGTTGACGCGCGGCGGGAACATGTGCAGCGGTCGCATTGAG

[1192] ATAAAGTTCCAAGGGCGCTGGGGGACCGTTTGTGACGACAACTTCAATATAGATCAT

[1193] GCTAGTGTGATATGCAGGCAGTTGGAGTGCGGTAGCGCCGTCTCATTTAGTGGTTCT

[1194] AGCAATTTCGGTGAGGGATCCGGGCCTATATGGTTCGACGACCTTATCTGCAATGGA

[1195] AATGAGAGCGCCCTCTGGAACTGCAAGCACCAAGGTTGGGGTAAGCATAACTGCGA

[1196] TCATGCTGAGGATGCGGGTGTGATTTGTAGCAAGGGAGCCGACTTGTCACTTCGAC

[1197] TCGTAGATGGCGTGACGGAATGTAGCGGTCGCCTTGAGGTACGCTTCCAAGGTGAA

[1198] TGGGGCACAATCTGTGATGACGGTTGGGACTCATATGACGCTGCGGTTGCTTGCAA

[1199] ACAGCTGGGCTGTCCGACAGCGGTAACGGCAATTGGGCGGGTAAATGCCAGTAAGG

[1200] GGTTTGGACATATATGGTTGGACAGTGTTTCTTGTCAGGGACACGAACCTGCAATAT

[1201] GGCAATGTAAACATCACGAGTGGGGGAAGCATTACTGCAATCATAATGAAGACGCA

[1202] GGCGTCACATGCTCTGACGGATCCGACCTGGAATTGCGGCTGAGAGGGGGGGGTTC

[1203] ACGGTGCGCAGGAACCGTGGAAGTTGAGATTCAACGCCTGCTCGGGAAAGTTTGT

[1204] GACAGGGGGTGGGGCCTTAAGGAAGCAGACGTAGTCTGCCGACAACTGGGTTGCG

[1205] GGAGCGCCCTCAAGACGTCCTATCAAGTTTACAGCAAAATTCAAGCAACTAATACCT

[1206] GGCTGTTTCTTTCCTCCTGCAATGGTAACGAAACGAGCCTCTGGGATTGTAAAAATT

[1207] GGCAATGGGGAGGCCTTACATGTGATCACTATGAAGAGGCCAAAATCACCTGCAGC

[1208] GCGCACCGAGAGCCTAGGCTGGTTGGAGGGGATATTCCCTGTTCAGGTAGAGTTGA

[1209] AGTCAAGCATGGTGATACCTGGGGGTCCATATGCGACTCCGATTTCAGTTTGGAAGC

[1210] AGCGAGCGTGCTGTGCCGAGAGCTTCAATGTGGGACAGTAGTTTCCATTCTTGGTG

[1211] GCGCCCACTTCGGGGAAGGTAACGGACAGATTTGGGCGGAGGAATTCCAATGTGAG

[1212] GGCCATGAAAGTCACCTGAGTCTTTGTCCTGTAGCGCCTCGGCCGGAAGGTACTTG

[1213] TTCTCACTCCAGAGACGTTGGCGTGGTTTGTTCTAGGTACACTGAGATAAGGCTGGT

[1214] GAATGGCAAAACGCCTTGTGAAGGAAGGGTGGAGCTCAAAACGCTTGGCGCCTGG

[1215] GGGTCTCTGTGCAACTCCCACTGGGACATAGAGGACGCACATGTCTTGTGCCAGCA

[1216] ACTCAAATGCGGTGTCGCGCTTTCAACCCCTGGGGGCGCTAGATTCGGGAAAGGTA

[1217] ACGGCCAGATATGGCGCCATATGTTCCATTGCACCGGAACTGAACAGCATATGGGAG

[1218] ATTGTCCTGTGACTGCCTTGGGGGCAAGTCTGTGTCCCTCAGAACAAGTGGCTTCA

[1219] GTTATTTGCAGCGGTAACCAGAGTCAGACGCTCAGCTCCTGCAACAGCAGCAGTCT

[1220] GGGTCCAACAAGACCCACAATACCCGAGGAGTCAGCGGTCGCGTGCATCGAATCCG

[1221] GGCAATTGAGACTCGTTAATGGCGGGGGTCGGTGCGCAGGGCGCGTGGAGATCTAC

[1222] CACGAGGGTAGTTGGGGCACAATTTGTGACGACAGCTGGGACCTTTCCGACGCTCA

[1223] TGTCGTATGCCGACAACTGGGGTGCGGTGAGGCCATCAATGCCACCGGAAGCGCGC

[1224] ATTTCGGTGAAGGCACGGGCCCAATTTGGCTTGATGAGATGAAATGTAATGGAAAG

[1225] GAGTCCCGCATTTGGCAATGCCATAGCCATGGCTGGGGTCAACAAAATTGTCGACA

[1226] CAAAGAAGATGCCGGGGTGATCTGCTCAGAATTCATGTCCTTGCGGCTTACTAGCGA

[1227] AGCGTCCCGCGAGGCCTGTGCTGGGAGACTGGAAGTTTTTTATAACGGGGCTTGGG

[1228] GAACGGTTGGTAAGTCATCAATGAGTGAAACCACAGTTGGTGTTGTGTGTAGACAA

[1229] CTCGGTTGCGCCGACAAGGGAAAGATCAACCCGGCGAGCCTTGATAAGGCCATGAG

[1230] CATCCCCATGTGGGTGGATAACGTTCAGTGTCCGAAAGGTCCCGATACCTTGTGGCA

[1231] ATGCCCAAGTTCTCCTTGGGAGAAGAGACTCGCCTCACCAAGTGAAGAGACGTGGA

[1232] TTACGTGTGATAACAAAATTAGGCTCCAAGAAGGACCGACCAGTTGCAGCGGAAGA

[1233] GTTGAGATATGGCATGGAGGAAGCTGGGGAACCGTGTGCGATGACAGCTGGGACCT

[1234] GGACGACGCCCAGGTGGTGTGCCAACAGCTGGGTTGCGGGCCTGCCCTCAAAGCA

[1235] TTTAAGGAAGCCGAATTCGGTCAGGGTACTGGGCCAATCTGGCTGAACGAGGTAAA

[1236] GTGCAAAGGTAACGAAAGTAGCCTGTGGGACTGTCCGGCACGAAGGTGGGGCCAC

[1237] AGCGAGTGTGGCCATAAGGAAGACGCGGCCGTGAACTGTACAGACATATCCGTACA

[1238] AAAAACGCCCCAAAAGGCGACGACCGGGCGATCATCAAGACAATCTAGCTTTATTG

[1239] CCGTGGGAATTCTCGGTGTAGTGCTTCTTGCTATATTTGTCGCTTTGTTCTTTCTGACT

[1240] AAAAAGCGCAGGCAAAGGCAGCGGCTTGCTGTGAGCTCTCGGGGAGAAAACCTCG

[1241] TTCACCAAATCCAATACCGAGAAATGAACTCCTGTCTCAACGCCGACGATCTTGACC

[1242] TGATGAACTCATCTGAGAACTCACACGAGTCCCGCCGATTTCAGCGCGGCGGAATTG

[1243] ATCTCTGTCAGCAAATTTCTGCCTATAAGTGGCATGGAAAAAGAAGCCATACTCTCT

[1244] CACACGGAAAAGGAAAATGGCAACCTT

[1245] Example 8: Design of BME constructs

[1246] A decoy macrophage engager (BME) construct was designed, containing soluble CD163 (sCD163) fused to ACE2 (19-740). This sCD163-ACE2 (19-740) BME construct can be used as a surrogate for neutralizing antibodies against SARS-CoV-2, which recruits macrophages via CD163 instead of recruiting immune cells via Fc. A schematic diagram of the BME construct is shown in Fig.12 Shown in.

[1247]

[1248] Example 9: CBR-macrophage cell production.

[1249] In order to avoid cell manufacturing for each individual, ready-made CBR programmed macrophages (CBRMs) will be used. CBRMs will be manufactured in advance using universal induced pluripotent stem cell-derived macrophages (iPSC-macrophages), which will be generated by knocking out B2M to eliminate all MHC I and then knocking in HLA E (Hoerster et al., Frontiers in Immunology, 2021).

[1250] iPSCs were generated from healthy donors using the Sendai viral kit (Thermo Fisher, Waltham, MA). iPSCs were differentiated and polarized into mature M1 macrophages in culture using the protocol from Cao et al., Stem Cell Reports, 2019.

[1251] ***

[1252] The present invention is not limited to the scope of the specific embodiments described herein. In fact, various modifications of the present invention, in addition to those described, will become apparent to those skilled in the art based on the foregoing description and the accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

[1253] All references (e.g., publications or patents or patent applications) cited herein are incorporated by reference in their entirety and for all purposes to the same extent as if each individual reference (e.g., publication or patent or patent application) was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[1254] Other embodiments are within the scope of the following claims.

Claims

1. A chimeric decoy receptor (CBR), comprising: a) an extracellular portion comprising a binding region that specifically binds to a virus, wherein the binding region is not an antibody; b) transmembrane part; as well as c) The intracellular portion, which includes the intracellular signaling domain of the endocytosed receptor.

2. The CBR of claim 1, wherein the binding region is part of a host protein that enables the virus to attach to the host cell when the binding region is exposed to the virus and the binding region is expressed in the host cell.

3. The CBR according to claim 1 or 2, wherein the binding region comprises a portion of a protein selected from the group consisting of angiotensin converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T cell Ig and mucin domain 1 (TIM-1), CD46 and SLAMF1.

4. A CBR according to any one of claims 1 to 3, wherein the binding region comprises ACE2 or a fragment thereof.

5. The CBR according to claim 3 or 4, wherein the binding region comprises amino acids 19-358, 19-605 or 19-740 of SEQ ID NO:

2.

6. A CBR according to any one of claims 3 to 5, wherein the binding region comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:

8.

7. The CBR according to any one of claims 1 to 6, wherein the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, and scavenger receptor.

8. The CBR of claim 7, wherein the transmembrane portion comprises a transmembrane portion of a scavenger receptor.

9. The CBR of claim 8, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of A, B, C, D, E, F, G, H, IK, J, K and L class scavenger receptors.

10. The CBR of claim 9, wherein the scavenger receptor is selected from the group consisting of: scavenger receptor type A I / II (SR AI / II), macrophage receptor with collagen structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor type B (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), scavenger receptor-1 containing a linker domain (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor type L (SR-L1).

11. The CBR according to any one of claims 1 to 10, wherein the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

12. The CBR of claim 11, wherein the transmembrane portion comprises the transmembrane portion of the mannose receptor.

13. The CBR of claim 12, wherein the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

10.

14. The CBR of claim 12, wherein the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

12.

15. The CBR of any one of claims 1 to 10, wherein the intracellular signaling region of the endocytic receptor comprises the intracellular signaling region of a phagocytic receptor.

16. The CBR of claim 15, wherein the transmembrane portion comprises a transmembrane portion of a phagocytic receptor.

17. The CBR of claim 15 or 16, wherein the intracellular signaling region of the engulfment receptor comprises an intracellular portion of a protein from the group consisting of: MERTK, dectin-1, and Fcγ receptor (FcγR).

18. The CBR of claim 17, wherein the transmembrane portion and the intracellular signaling region of the engulfment receptor comprise the transmembrane portion and the intracellular portion of MERTK.

19. The CBR of claim 18, wherein the transmembrane portion and the intracellular portion of MERTK comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

14.

20. The CBR of claim 17, wherein the transmembrane portion and the intracellular signaling region of the engulfment receptor comprise the transmembrane portion and the intracellular portion of dectin-1.

21. The CBR of claim 20, wherein the transmembrane portion and the intracellular portion of dectin-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

16.

22. The CBR of claim 21, wherein the CBR comprises SEQ ID NO:

18.

23. The CBR of claim 17, wherein the intracellular signaling region of the engulfment receptor comprises the intracellular portion of an FcγR.

24. The CBR of claim 23, wherein the intracellular portion of FcγR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

20.

25. The CBR of any one of claims 1 to 10, wherein the transmembrane portion and the intracellular signaling region of the endocytic receptor comprise the transmembrane portion and intracellular signaling region of a scavenger receptor.

26. The CBR of claim 25, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of A, B, C, D, E, F, G, H, IK, J, K and L class scavenger receptors.

27. The CBR according to claim 26, wherein the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44 and SR-L1.

28. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR AI / II.

29. The CBR of claim 28, wherein the transmembrane portion and the intracellular portion of SR AI / II comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

22.

30. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of MARCO.

31. The CBR of claim 30, wherein the transmembrane portion and the intracellular portion of MARCO comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

24.

32. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of the SCARA5 receptor.

33. The CBR of claim 32, wherein the transmembrane portion and the intracellular portion of the SCARA5 receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

26.

34. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SRCL.

35. The CBR of claim 34, wherein the transmembrane portion and the intracellular portion of SRCL comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

28.

36. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD36.

37. The CBR of claim 36, wherein the transmembrane portion and the intracellular portion of CD36 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

30.

38. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-BI.

39. The CBR of claim 39, wherein the transmembrane portion and the intracellular portion of SR-BI comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

32.

40. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD68.

41. The CBR of claim 41, wherein the transmembrane portion and the intracellular portion of CD68 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

34.

42. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of LOX-1.

43. The CBR of claim 43, wherein the transmembrane portion and the intracellular portion of LOX-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

36.

44. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of a SREC.

45. The CBR of claim 45, wherein the transmembrane portion and the intracellular portion of SREC comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

38.

46. ​​The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of MEGF10.

47. The CBR of claim 47, wherein the transmembrane portion and the intracellular portion of MEGF10 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

40.

48. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-PSOX.

49. The CBR of claim 49, wherein the transmembrane portion and the intracellular portion of SR-PSOX comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

42.

50. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of FEEL-1.

51. The CBR of claim 51, wherein the transmembrane portion and the intracellular portion of FEEL-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

44.

52. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD163.

53. The CBR of claim 53, wherein the transmembrane portion and the intracellular portion of CD163 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

46.

54. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of RAGE.

55. The CBR of claim 55, wherein the transmembrane portion and the intracellular portion of RAGE comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

48.

56. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD44.

57. The CBR of claim 57, wherein the transmembrane portion and the intracellular portion of CD44 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

50.

58. The CBR of claim 27, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-L1.

59. The CBR of claim 59, wherein the transmembrane portion and the intracellular portion of SR-L1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

52.

60. The CBR according to any one of claims 1 to 60, further comprising an N-terminal signal peptide.

61. The CBR of claim 61, wherein the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

62. The CBR of claim 1 or 2, wherein the CBR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 to 67.

63. The CBR of claim 1 or 2, wherein the CBR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of: a) amino acid residues 22-827 of SEQ ID NO:61; b) amino acid residues 19-893 of SEQ ID NO:62; c) amino acid residues 19-1291 of SEQ ID NO:63; d) amino acid residues 19-1080 of SEQ ID NO:64; and e) amino acid residues 19-1912 of SEQ ID NO:

67.

64. A nucleic acid encoding one or more of the CBRs according to any one of claims 1 to 64.

65. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 54 to 60.

66. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence selected from the group consisting of: a) nucleotides 64-2481 of SEQ ID NO:54; b) nucleotides 55-2679 of SEQ ID NO:55; c) nucleotides 55-3873 of SEQ ID NO:56; d) nucleotides 55-3240 of SEQ ID NO:57; and e) nucleotides 55-5736 of SEQ ID NO:

67.

67. A recombinant vector comprising the nucleic acid according to any one of claims 65 to 67.

68. A cell comprising one or more of the CBR of any one of claims 1 to 64, the nucleic acid of any one of claims 65 to 67, or the vector of claim 68.

69. The cell of claim 69, wherein the host cell is a phagocytic cell.

70. The cell of claim 70, wherein the phagocytic cell is selected from the group consisting of macrophages, dendritic cells, mast cells, monocytes, neutrophils, microglia, and astrocytes.

71. A cell population comprising two or more cells according to any one of claims 69 to 71.

72. A pharmaceutical composition comprising a therapeutically effective amount of a CBR according to any one of claims 1 to 64, a nucleic acid according to any one of claims 65 to 67, a vector according to claim 68, a host cell according to any one of claims 69 to 71 or a cell population according to claim 72, and a pharmaceutically acceptable carrier.

73. A method for treating or preventing a viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a CBR according to any one of claims 1 to 64, a nucleic acid according to any one of claims 65 to 67, a vector according to claim 68, a host cell according to any one of claims 69 to 71, a cell population according to claim 72, or a pharmaceutical composition according to claim 73.

74. The method of claim 74, wherein the subject is a human.

75. The method according to claim 74 or 75, wherein the viral infection is caused by a virus selected from the group consisting of: Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae and Bunyaviridae.

76. The method of claim 76, wherein the virus is a coronavirus.

77. The method of claim 77, wherein the coronavirus is SARS-CoV-2.

78. A chimeric phagocytic receptor (CPR) comprising a) an extracellular part, which comprises an antigen binding part, b) a transmembrane portion; and c) an intracellular portion, which includes the intracellular signaling domain of the endocytosed receptor, wherein the CPR does not include a recruitment moiety, wherein the recruitment moiety is not an endocytic receptor intracellular domain, and wherein the recruitment moiety binds to a cytoplasmic protein of a phagocytic signaling pathway.

79. The CPR of claim 79, wherein the antigen binding moiety comprises an antibody.

80. The CPR of claim 80, wherein the antibody comprises a single chain variable fragment (scFv) or a monopartite antibody (sdAb) variable portion.

81. The CPR of any one of claims 79 to 81, wherein the antigen binding portion specifically binds to an antigen selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, prostacyclin, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

82. The CPR of any one of claims 79 to 82, wherein the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, and a scavenger receptor.

83. The CPR of claim 83, wherein the transmembrane portion comprises a transmembrane portion of a scavenger receptor.

84. The CPR of claim 84, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors.

85. The CPR of claim 85, wherein the scavenger receptor is selected from the group consisting of: scavenger receptor type A I / II (SR AI / II), macrophage receptor with collagen structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor type B (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), scavenger receptor-1 containing a linking domain (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor type L (SR-L1).

86. The CPR of any one of claims 79 to 86, wherein the intracellular signaling region of the endocytosed receptor comprises the intracellular portion of the mannose receptor.

87. The CPR of claim 87, wherein the transmembrane portion comprises the transmembrane portion of the mannose receptor.

88. The CPR of claim 88, wherein the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

10.

89. The CPR of claim 88, wherein the transmembrane portion and the intracellular portion of the mannose receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

12.

90. The CPR of any one of claims 79 to 86, wherein the intracellular signaling region of the endocytic receptor comprises the intracellular signaling region of a phagocytic receptor.

91. The CPR of claim 91, wherein the transmembrane portion comprises a transmembrane portion of a phagocytic receptor.

92. The CPR of claim 91 or 92, wherein the intracellular signaling region of the engulfment receptor comprises an intracellular portion of a protein from the group consisting of: MERTK, dectin-1, and an Fc gamma receptor (Fc gamma R).

93. The CPR of claim 93, wherein the transmembrane portion and the intracellular signaling region of the engulfment receptor comprise the transmembrane portion and the intracellular portion of MERTK.

94. The CPR of claim 94, wherein the transmembrane portion and the intracellular portion of MERTK comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

14.

95. The CPR of claim 93, wherein the transmembrane portion and the intracellular signaling region of the engulfment receptor comprise the transmembrane portion and the intracellular portion of dectin-1.

96. The CPR of claim 96, wherein the transmembrane portion and the intracellular portion of dectin-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

16.

97. The CPR of claim 97, wherein the CBR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

18.

98. The CPR of claim 93, wherein said intracellular signaling region of said engulfment receptor comprises said intracellular portion of an FcγR.

99. The CPR of claim 99, wherein the intracellular portion of the FcγR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

20.

100. The CPR of any one of claims 79 to 86, wherein the transmembrane portion and the intracellular signaling region of the endocytic receptor comprise a transmembrane portion and an intracellular signaling region of a scavenger receptor.

101. The CPR of claim 101, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors.

102. The CPR of claim 102, wherein the scavenger receptor is selected from the group consisting of SRAI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

103. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR AI / II.

104. The CPR of claim 104, wherein the transmembrane portion and the intracellular portion of SR AI / II comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

22.

105. The CPR of claim 103, wherein said transmembrane portion and said intracellular signaling region of said scavenger receptor comprise said transmembrane portion and said intracellular portion of MARCO.

106. The CPR of claim 106, wherein the transmembrane portion and the intracellular portion of MARCO comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

24.

107. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of a SCARA5 receptor.

108. The CPR of claim 108, wherein the transmembrane portion and the intracellular portion of the SCARA5 receptor comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

26.

109. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SRCL.

110. The CPR of claim 110, wherein the transmembrane portion and the intracellular portion of SRCL comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

28.

111. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD36.

112. The CPR of claim 112, wherein the transmembrane portion and the intracellular portion of CD36 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

30.

113. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-BI.

114. The CPR of claim 114, wherein the transmembrane portion and the intracellular portion of SR-BI comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

32.

115. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD68.

116. The CPR of claim 116, wherein the transmembrane portion and the intracellular portion of CD68 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

34.

117. The CPR of claim 103, wherein said transmembrane portion and said intracellular signaling region of said scavenger receptor comprise said transmembrane portion and said intracellular portion of LOX-1.

118. The CPR of claim 118, wherein the transmembrane portion and the intracellular portion of LOX-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

36.

119. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of a SREC.

120. The CPR of claim 120, wherein the transmembrane portion and the intracellular portion of the SREC comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

38.

121. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of MEGF10.

122. The CPR of claim 122, wherein the transmembrane portion and the intracellular portion of MEGF10 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

40.

123. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-PSOX.

124. The CPR of claim 124, wherein the intracellular portion of SR-PSOX comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

42.

125. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of FEEL-1.

126. The CPR of claim 126, wherein the transmembrane portion and the intracellular portion of FEEL-1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

44.

127. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD163.

128. The CPR of claim 128, wherein the transmembrane portion and the intracellular portion of CD163 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

46.

129. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of RAGE.

130. The CPR of claim 130, wherein the transmembrane portion and the intracellular portion of RAGE comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

48.

131. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of CD44.

132. The CPR of claim 132, wherein the transmembrane portion and the intracellular portion of CD44 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

50.

133. The CPR of claim 103, wherein the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-L1.

134. The CPR of claim 134, wherein the transmembrane portion and the intracellular portion of SR-L1 comprise an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

52.

135. The CPR of any one of claims 79 to 135, wherein the recruitment portion is selected from the group consisting of: a) a p85-recruiting moiety that binds the p85 regulatory subunit of phosphatidylinositol 3-kinase (PI3K); b) SH3 moieties derived from Crk, Cdc25, phospholipase, Ras, Vav, GRB2, FAK, Pyk2, TRIP10 or Gads; and c) a proline-rich peptide sequence derived from C3G, p41, PEP, p4'7, HPK1, SLP-1, CD3.ε, PAK, AIP4 or Sos, wherein the proline-rich peptide sequence binds to a protein containing an SH3 moiety.

136. The CPR of claim 136, wherein the recruitment moiety is a p85-recruiting moiety, and wherein the p85-recruiting moiety is derived from CD19, Gab2, IREM-1, PDGF receptor, CSFR-1, c-Kit, ErbB3 or CD7.

137. The CPR of any one of claims 79 to 137, further comprising an N-terminal signal peptide.

138. The CPR of claim 138, wherein the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

139. The CPR of claim 79, wherein the CPR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of: SEQ ID NOs: 86 to 103.

140. The CPR of claim 79, wherein the CPR comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence selected from the group consisting of: a) amino acid residues 22-396 of SEQ ID NO:86; b) amino acid residues 22-425 of SEQ ID NO:87; c) amino acid residues 22-368 of SEQ ID NO:88; d) amino acid residues 22-411 of SEQ ID NO:89; e) amino acid residues 22-354 of SEQ ID NO:90; f) amino acid residues 19-420 of SEQ ID NO:91; g) amino acid residues 19-818 of SEQ ID NO:92; h) amino acid residues 19-607 of SEQ ID NO:93; i) amino acid residues 19-1439 of SEQ ID NO:96; j) amino acid residues 22-363 of SEQ ID NO:97; k) amino acid residues 22-354 of SEQ ID NO:98; 1) amino acid residues 22-832 of SEQ ID NO:99; m) amino acid residues 22-621 of SEQ ID NO: 100; and n) amino acid residues 22-1453 of SEQ ID NO:

103.

141. A nucleic acid encoding one or more of the CPRs of any one of claims 79 to 141.

142. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 68 to 85.

143. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a nucleotide sequence selected from the group consisting of: a) nucleotides 64-1189 of SEQ ID NO:68; b) nucleotides 64-1275 of SEQ ID NO:69; c) nucleotides 64-1104 of SEQ ID NO:70; d) nucleotides 64-1233 of SEQ ID NO:71; e) nucleotides 64-1062 of SEQ ID NO:72; f) nucleotides 55-1260 of SEQ ID NO:73; g) nucleotides 55-2454 of SEQ ID NO:74; h) nucleotides 55-1821 of SEQ ID NO:75; i) nucleotides 55-4317 of SEQ ID NO:78; j) nucleotides 64-1089 of SEQ ID NO:79; k) nucleotides 64-1062 of SEQ ID NO:80; 1) nucleotides 64-2496 of SEQ ID NO:81; m) nucleotides 64-1863 of SEQ ID NO:82; and n) nucleotides 64-4359 of SEQ ID NO:

85.

144. A recombinant vector comprising the nucleic acid according to any one of claims 142 to 144.

145. A cell comprising one or more of the CPR of any one of claims 79 to 141, the nucleic acid of any one of claims 142 to 144, or the vector of claim 145.

146. The cell of claim 146, wherein the host cell is a phagocytic cell.

147. The cell of claim 147, wherein the phagocytic cell is selected from the group consisting of a macrophage, a dendritic cell, a mast cell, a monocyte, a neutrophil, a microglia, and astrocyte.

148. A cell population comprising two or more cells according to any one of claims 146 to 148.

149. A pharmaceutical composition comprising a therapeutically effective amount of a CPR according to any one of claims 79 to 141, a nucleic acid according to any one of claims 142 to 144, a vector according to claim 145 or a host cell according to any one of claims 146 to 148 or a cell population according to claim 149, and a pharmaceutically acceptable carrier.

150. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a CPR according to any one of claims 79 to 141, a nucleic acid according to any one of claims 142 to 144, a vector according to claim 145, or a host cell according to any one of claims 146 to 148, or a cell population according to claim 149, or a pharmaceutical composition according to claim 150.

151. The method of claim 151, wherein the subject is a human.

152. A bait macrophage engager (BME), comprising: a) a binding region that specifically binds to a virus, wherein the binding region is not an antibody; as well as b) Ligands of endocytic receptors.

153. A bait macrophage engager (BME), comprising: a) a binding region that specifically binds to a virus, wherein the binding region is part of a host protein that enables the virus to attach to the host cell when the binding region is exposed to the virus and the binding region is expressed in the host cell; as well as b) Ligands of endocytic receptors.

154. The BME of claim 153 or 154, wherein the binding region comprises a portion of a protein selected from the group consisting of angiotensin converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1.

155. A BME according to any one of claims 153 to 155, wherein the binding region comprises ACE2 or a fragment thereof.

156. The BME of claim 156, wherein the binding region comprises amino acids 19-358, 19-605 or 19-740 of SEQ ID NO:

2.

157. A BME according to any one of claims 155 to 157, wherein the binding region comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:

8.

158. The BME of any one of claims 153 to 158, wherein the endocytic receptor is a mannose receptor.

159. The BME of any one of claims 153 to 158, wherein the endocytic receptor is a phagocytic receptor.

160. The BME of claim 160, wherein the engulfment receptor is selected from the group consisting of MERTK, dectin-1, and Fc gamma receptor (FcγR).

161. The BME of any one of claims 153 to 158, wherein the endocytic receptor is a scavenger receptor.

162. The BME of claim 162, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K, and L class scavenger receptors.

163. The BME of claim 163, wherein the scavenger receptor is selected from the group consisting of SRAI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

164. The BME of any one of claims 153 to 164, wherein the ligand is selected from the group consisting of: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptides, high-density cholesterol (HDL), lectins, selectins, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA, also known as hyaluronic acid), and microtubule-associated protein Tau (MAPT).

165. The BME of claim 165, wherein the ligand is soluble CD163.

166. The BME of claim 166, wherein the ligand comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

105.

167. The BME of claim 153 or 154, wherein the BME comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

107.

168. The BME of claim 153 or 154, wherein the BME comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acid residues 26-1756 of SEQ ID NO:

107.

169. The BME of any one of claims 153 to 169, further comprising an IgG Fc.

170. A nucleic acid encoding one or more of the BMEs of any one of claims 153 to 170.

171. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO:

106.

172. A nucleic acid comprising a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleotides 76-5268 of SEQ ID NO:

106.

173. A recombinant vector comprising a nucleic acid according to any one of claims 171 to 173.

174. A cell comprising one or more of the BME of any one of claims 153 to 170, the nucleic acid of any one of claims 171 to 173, or the vector of claim 174.

175. A cell population comprising two or more cells according to claim 175.

176. A pharmaceutical composition comprising a therapeutically effective amount of the BME according to any one of claims 153 to 170 and a pharmaceutically acceptable carrier.

177. A method of treating or preventing a viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a BME according to any one of claims 153 to 170 or a pharmaceutical composition according to claim 177.

178. The method of claim 178, wherein the subject is a human.

179. The method according to claim 178 or 179, wherein the viral infection is caused by a virus selected from the group consisting of: Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae and Bunyaviridae.

180. The method of any one of claims 178 to 180, wherein the virus is a coronavirus.

181. The method of claim 181, wherein the coronavirus is SARS-CoV-2.

182. An antigen macrophage adapter (AME), comprising a) an antibody that binds to an antigen expressed on the surface of a cancer cell; and b) Ligands of endocytic receptors.

183. The AME of claim 183, wherein the antibody comprises a single chain variable fragment (scFv) or a monopartite antibody (sdAb) variable portion.

184. The AME of any one of claims 183 or 184, wherein the antigen binding portion specifically binds to an antigen selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD 117), CD213A2, IL-1IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-β, SSEA-4, CD20, MUC1, EGFR, NCAM, prostacyclin, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

185. The AME according to any one of claims 183 to 185, wherein the endocytic receptor is a mannose receptor.

186. The AME according to any one of claims 183 to 185, wherein the endocytic receptor is a phagocytic receptor.

187. The AME of claim 187, wherein the intracellular signaling region of the engulfment receptor comprises an intracellular portion of a protein from the group consisting of: MERTK and an Fcγ receptor (FcγR).

188. The AME according to any one of claims 183 to 185, wherein the endocytic receptor is a scavenger receptor.

189. The AME according to claim 189, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of: A, B, C, D, E, F, G, H, IK, J, K and L class scavenger receptors.

190. The AME according to claim 190, wherein the scavenger receptor is selected from the group consisting of SRAI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44 and SR-L1.

191. The AME according to any one of claims 183 to 191, wherein the ligand is selected from the group consisting of: soluble CD163 (sCD163), mannose, growth arrest-specific factor 6 (Gas6), protein S (Pros1), low-density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanions, ferritin, ferritin light chain, β-glucan, N-acetylgalactosamine, GAL-type ligand (β-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptides, high-density cholesterol (HDL), lectins, selectins, C1q, hemoglobin, haptoglobin, β-amyloid peptide, hyaluronic acid (HA also known as hyaluronic acid) and microtubule-associated protein Tau (MAPT).

192. The AME according to claim 192, wherein the ligand is soluble CD163.

193. The AME of claim 193, wherein the ligand comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

105.

194. A nucleic acid encoding one or more of the AMEs according to any one of claims 183 to 194.

195. A recombinant vector comprising the nucleic acid according to claim 195.

196. A cell comprising one or more of the AME according to any one of claims 183 to 194, the nucleic acid according to claim 193, or the vector according to claim 196.

197. A cell population comprising two or more cells according to claim 197.

198. A pharmaceutical composition comprising a therapeutically effective amount of the AME according to any one of claims 183 to 194 and a pharmaceutically acceptable carrier.

199. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an AME according to any one of claims 183 to 194 or a pharmaceutical composition according to claim 199.

200. The method of claim 200, wherein the subject is a human.

Images