Compounds and methods for reducing prion expression

Abstract

Compounds, methods and pharmaceutical compositions are provided for reducing the amount or activity of PRNP RNA and, in some cases, the amount of PrP protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or marker of neurodegenerative disease. Such symptoms and markers are cavernous changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapid progression dementia and death. Such neurodegenerative diseases include prion disease, Kirschner-Yahan Disease (CJD), variant Kirschner-Yahan Disease (vCJD), familial Kirschner-Yahan Disease (fCJD), Jetzmann-Schiller-Sterile Syndrome, fatal familial insomnia, Kuluo Disease, Alzheimer's Disease, or Parkinson's Disease.

Description

[0001] This application is a divisional application of the Chinese invention patent application with application number 201980076256.1, application date November 21, 2019, and invention name “Compounds and methods for reducing prion expression”. The Chinese invention patent application with application number 201980076256.1 is the Chinese national phase application of the PCT international application with international application number PCT / US2019 / 062681, which claims priority to the U.S. provisional patent application with application number 62 / 770,386 filed on November 21, 2018, the full text of which is hereby incorporated by reference into this document.

[0002] Sequence Listing

[0003] This application is submitted with a sequence listing in electronic format. The sequence listing is provided as a document named 036502-8070CN02-sequence listing-seq-Partial_CN, which was created on November 26, 2024 and is 2.41MB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0004] Provided are compounds, methods and pharmaceutical compositions for reducing the amount of prion RNA (PRNP RNA) in cells or animals and in some cases reducing the amount of prion protein (PrP protein) in cells or animals. These compounds, methods and pharmaceutical compositions can be used to improve at least one symptom or mark of neurodegenerative diseases. These symptoms and marks include spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapid progression dementia and death. These neurodegenerative diseases include prion diseases, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease or Parkinson's disease. Background Art

[0005] Prion diseases are a family of rare progressive neurodegenerative diseases that affect both humans and non-human animals. These diseases are caused by the normal prion protein (“PrP C”) and is characterized by long latency and characteristic spongiform changes associated with neuronal loss (Senesi et al., “In vivo prion models and the disconnection between transmissibility and neurotoxicity”, Ageing Research Reviews 2017, 36: 156-164; Erana et al., Biochem. And Biophys. Res. Comm., “Prion-like disorders and Transmissible Spongiform Encephalopathies: An overview of the mechanistic features that are shared by the various disease-related Misfolded proteins”, 2017, 483:1125-1136). Hallmarks of prion diseases include (but are not limited to) spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, and markers of neuronal loss. Symptoms of prion diseases include (but are not limited to) rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic dysfunction, impaired vision, insomnia, blindness, loss of speech, coma, and death.

[0006] The prion protein can exist in several different conformational states: the normal cellular form PrP C and protease-resistant scrapie pathogenic forms, which are hypothesized to represent a group of misfolded conformers collectively referred to as scrapie or pathogenic prion proteins “PrP Sc ” (Sensei, 2017). The scrapie form of prion protein PrP Sc It is the causative agent of transmissible spongiform encephalopathies. The two forms of this protein have the same amino acid sequence and are encoded by the PRNP RNA, but they differ in the way they fold in three-dimensional space. However, certain mutations in the PRNP RNA cause the expressed protein to prefer the pathogenic PrP Sc The folding state of PrP (Mastrianni, "The genetics of prion diseases", Genetic Med., 2010, 12 (4): 187-195). Sc Forms aggregates and resists proteolytic degradation by proteinase K. Infectious PrP Sc Can cause normal cell PrP Cmisfolding, converting it into proteinase K-resistant PrP Sc This leads to PrP Sc The cellular levels of prion proteins increase, leading to increased protein aggregation and spread of misfolded forms throughout the CNS. Patients rapidly develop the characteristic signs and symptoms of prion disease, which is always fatal.

[0007] In addition to prion diseases, PrP C It has also been considered as a molecular target for synucleinopathies such as Parkinson's disease and dementia with Lewy bodies (Ferreira et al., "α-synuclein interacts with PrPC to induce cognitive impairment through mGluR5 and NMDAR2B", Nature Neuroscience, 2017, 20: 1569-157) and Alzheimer's disease (Purro et al., "Alzheimer's", Biological Psychiatry, 2018, 83(4): 358-368).

[0008] PrP C PrP Sc It can be detected in cerebrospinal fluid (CSF). C Can be detected in CSF by standard methods (eg, western blot). Infectious PrP Sc It can be detected in the CSF of patients with prion infection by the RT-QuIC test (real-time shake-induced conversion), as described by Orru et al., mBio, "Rapid and sensitive RT-QuIC detection of human Creutzfeldt-Jakob disease using cerebrospinal fluid", 2015, 6(1): e02451-14. This test measures PrP by its ability to induce misfolding of recombinant PrP substrates in CSF samples. Sc PrP C Distinguish them.

[0009] There is currently a lack of acceptable options for treating neurodegenerative diseases. It is therefore an object herein to provide compounds, methods and pharmaceutical compositions for treating such diseases. Summary of the invention

[0010] Provided herein are compounds, methods and pharmaceutical compositions for reducing the amount or activity of PRNP RNA in cells or animals and reducing the amount of PrP protein in certain embodiments. In certain embodiments, the animal suffers from a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is a prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gertzman-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer's disease or Parkinson's disease. In certain embodiments, the compound that can be used to reduce the expression of PRNP RNA is an oligomeric compound. In certain embodiments, the compound that can be used to reduce the expression of PRNP RNA is a modified oligonucleotide.

[0011] Also provided are methods for improving at least one symptom or marker of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is a prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease. In certain embodiments, symptoms or markers include spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, and death. DETAILED DESCRIPTION

[0012] It should be understood that the foregoing general description and the following detailed description are only illustrative and explanatory and not restrictive. In this article, unless otherwise expressly stated, the use of the singular includes the plural. Unless otherwise stated, the use of "or" as used herein means "and (and) / or". In addition, the use of the term "including" and other forms (such as "includes" and "included") is not restrictive. In addition, unless otherwise expressly stated, terms such as "element" or "component" cover elements and components comprising one unit and elements and components comprising more than one subunit.

[0013] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application (including but not limited to patents, patent applications, articles, books, and papers) are expressly incorporated by reference in their entirety with respect to the portions of the documents discussed herein.

[0014] definition

[0015] Unless specific definitions are provided, the nomenclature used in connection with the analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein, and the procedures and techniques of these chemistries, are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.

[0016] Unless otherwise indicated, the following terms have the following meanings:

[0017] definition

[0018] As used herein, "2'-deoxynucleoside" means a nucleoside comprising a 2'-H (H) deoxyribosyl sugar moiety as found in natural deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). Unless otherwise specified, a 2'-deoxynucleoside has a β-D configuration.

[0019] As used herein, "2'-substituted nucleosides" means nucleosides comprising 2'-substituted sugar moieties. As used herein, "2'-substituted" with respect to sugar moieties means sugar moieties comprising at least one 2'-substituent other than H or OH.

[0020] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0021] As used herein, "administering" means providing an agent to an animal.

[0022] As used herein, "animal" means a human or non-human animal.

[0023] As used herein, "antisense activity" means any detectable and / or measurable change caused by hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by the target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound.

[0024] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0025] As used herein, "improvement" with respect to treatment means the improvement of at least one symptom relative to the same symptom in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset of the severity or frequency of the symptom or a slowing of progression. In certain embodiments, the symptom or sign is spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, and death.

[0026] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

[0027] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed by connecting two atoms in the first ring by a bridge, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0028] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions (eg, inside a cell, animal, or human).

[0029] As used herein, "complementarity" with respect to oligonucleotides means that when the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, the nucleobases of at least 70% of the oligonucleotide or one or more regions thereof and the nucleobases of the other nucleic acid or one or more regions thereof can hydrogen bond with each other. Complementary nucleobases mean nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity on each nucleoside. Instead, some mispairings are tolerated. As used herein, "complete complementarity" or "100% complementarity" with respect to oligonucleotides means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

[0030] As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0031] As used herein, "conjugate linker" means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0032] As used herein, "conjugate moiety" means a group of atoms attached to an oligonucleotide via a conjugate linker.

[0033] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "consecutive nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0034] As used herein, "constrained ethyl" or "cEt" or "cEt-modified sugar" refers to a β-D-ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed by connecting the 4'-carbon and the 2'-carbon of the β-D-ribosyl sugar moiety via a bridge, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration.

[0035] As used herein, "cEt nucleoside" means a nucleoside comprising a cEt modified sugar.

[0036] As used herein, "chiral enriched population" means a plurality of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom, the number or percentage of molecules containing a particular stereochemical configuration at a particular chiral center within the population is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population. A chiral enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0037] As used herein, "interval body" means a modified oligonucleotide comprising an internal region with multiple nucleosides, which supports RNase H cleavage between an external region with one or more nucleosides, wherein the nucleosides comprising the internal region are chemically different from the one or more nucleosides comprising the external region. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing". Unless otherwise specified, "interval body" refers to a sugar motif. Unless otherwise specified, the sugar moiety of the gap nucleosides of the interval body is an unmodified 2'-β-D-deoxyribose base. Therefore, the term "MOE interval body" indicates a sugar motif of a 2'-MOE nucleoside in both wings and a spacer of a 2'-deoxynucleoside gap. Unless otherwise specified, the MOE interval body may include one or more modified internucleoside bonds and / or modified core bases, and such modifications do not necessarily follow the sugar-modified interval body pattern.

[0038] As used herein, a "hot spot region" is a series of nucleobases on a target nucleic acid that are susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0039] As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which may be Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reversed Hoogsteen hydrogen bonding.

[0040] As used herein, the term "internucleoside linkage" is a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced by a sulfur atom.

[0041] As used herein, "linker-nucleoside" means a nucleoside that directly or indirectly connects an oligonucleotide to a conjugate portion. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are adjacent to an oligonucleotide.

[0042] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications (eg, substituents) that do not form a bridge between two atoms of the sugar to form a second ring.

[0043] As used herein, "mismatch" or "non-complementary" means that a nucleobase of a first oligonucleotide is not complementary to a corresponding nucleobase of a second oligonucleotide or a target nucleic acid when the first and second oligonucleotides are aligned.

[0044] As used herein, "MOE" means methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" means a 2'-OCH2CH2OCH3 group replacing the 2'-OH group of the ribosyl sugar moiety. As used herein, "2'-MOE nucleoside" means a nucleoside comprising a 2'-MOE modified sugar.

[0045] As used herein, "motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases and / or internucleoside linkages in an oligonucleotide.

[0046] Unless otherwise specified, as used herein, "RNA" means RNA transcripts that encode proteins and include pre-mRNA and mature mRNA.

[0047] As used herein, "neurodegenerative disease" means a disorder characterized by progressive loss of function or structure, including loss of motor function and neuronal death. In certain embodiments, the neurodegenerative disease is a prion disease. In certain embodiments, the neurodegenerative disease is any one of Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease.

[0048] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U) or guanine (G). As used herein, a "modified nucleobase" is a group of atoms that can pair with at least one unmodified nucleobase except unmodified A, T, C, U or G. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the 5 unmodified nucleobases. As used herein, a "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide that is independent of any sugar or internucleoside linkage modification.

[0049] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides that are linked in a continuous sequence (i.e., there are no additional nucleosides between those linked nucleosides).

[0050] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more other features, such as a conjugate group or end group. An oligomeric compound may be paired with a second oligomeric compound complementary to a first oligomeric compound or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligoduplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound".

[0051] As used herein, "oligonucleotide" means a chain of linked nucleosides connected by internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide is composed of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.

[0052] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to an animal. Certain such carriers enable the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffered solution, or sterile artificial cerebrospinal fluid.

[0053] As used herein, "pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of the parent compound and does not impart undesired toxicological effects thereto.

[0054] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in a free uptake assay in certain cell lines.

[0055] As used herein, "PrP C ” refers to the normal cellular form of the PrP protein.

[0056] As used herein, "PrP Sc ” refers to the protease-resistant pathogenic form of the PrP protein.

[0057] As used herein, "prodrug" means a therapeutic agent in an in vitro form that is converted into a different form in an animal or its cells. Typically, the action of enzymes (e.g., endogenous enzymes or viral enzymes) or chemical substances present in cells or tissues and / or physiological conditions contribute to the conversion of prodrugs in animals.

[0058] As used herein, "reduced or inhibited amount or activity" refers to a reduction or blockade of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.

[0059] As used herein, "RNAi compound" means an antisense compound that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, RNAi compounds regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound does not include antisense compounds that act through RNase H.

[0060] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0061] As used herein, "siRNA" refers to a ribonucleic acid molecule having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands. The two strands forming the duplex structure may be different parts of a larger RNA molecule, or they may be separate RNA molecules. When the two strands are part of a larger molecule and are therefore connected by continuous nucleobases between the 3' end of one strand and the 5' end of the other strand to form a duplex structure, the connecting RNA strands are referred to as "hairpin loops". The RNA strands may have the same or different numbers of nucleotides.

[0062] As used herein, "standard cellular assay" means the assay described in Example 1 and reasonable variations thereof.

[0063] As used herein, "stereorandom chiral center" means a chiral center with a random stereochemical configuration in the context of a population of molecules of the same molecular formula. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules with the (S) configuration of the stereorandom chiral center may, but is not necessarily, be the same as the number of molecules with the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0064] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH (H) ribosyl moiety as found in RNA ("unmodified RNA sugar moiety") or a 2'-H (H) deoxyribosyl moiety as found in DNA ("unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar surrogate.

[0065] As used herein, "sugar surrogate" means a modified sugar moiety other than a furanosyl moiety that can link a nucleobase to another group in an oligonucleotide, such as an internucleoside linkage, a conjugate group, or a terminal group. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or a target nucleic acid.

[0066] As used herein, "symptom or sign" means any physical characteristic or test result that indicates the presence or extent of a disease or condition. In certain embodiments, a symptom is obvious to the subject or a medical professional examining or testing the subject. In certain embodiments, a sign is obvious during an invasive diagnostic test (including but not limited to post-mortem testing).

[0067] As used herein, "target nucleic acid" and "target RNA" mean the nucleic acid that an antisense compound is designed to affect.

[0068] As used herein, "target region" means the portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0069] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the terminus of an oligonucleotide.

[0070] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves the symptoms of a disease.

[0071] Certain embodiments

[0072] The present disclosure provides the following non-limiting numbered embodiments:

[0073] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PRNP nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

[0074] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases of any one of SEQ ID NOs: 27-2744.

[0075] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18 or 19 nucleobases of any one of SEQ ID NOs: 2745-2766.

[0076] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17 or 18 nucleobases of any one of SEQ ID NOs: 2767-2780.

[0077] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 nucleobases of any one of SEQ ID NOs: 2781-2802.

[0078] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15 or 16 nucleobases of any one of SEQ ID NOs: 2803-2806.

[0079] Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence:

[0080] an equal length portion of nucleobases 5,635-5,677 of SEQ ID NO:2;

[0081] An equal length portion of nucleobases 5,791-5,826 of SEQ ID NO:2; or

[0082] An equal length portion of nucleobases 14,366-14,410 of SEQ ID NO:2.

[0083] Embodiment 8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases selected from the following nucleobase sequences:

[0084] SEQ ID No: 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793, 2803-2806;

[0085] SEQ ID No: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2798-2801; or

[0086] SEQ ID No:555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2 334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, 2794-2797.

[0087] Embodiment 9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence:

[0088] an equal length portion of nucleobases 4,902-4,929 of SEQ ID NO:2;

[0089] an equal length portion of nucleobases 5,000-5,026 of SEQ ID NO:2;

[0090] an equal length portion of nucleobases 5,073-5,100 of SEQ ID NO:2;

[0091] an equal length portion of nucleobases 5,515-5,559 of SEQ ID NO:2;

[0092] an equal length portion of nucleobases 5,595-5,632 of SEQ ID NO:2;

[0093] an equal length portion of nucleobases 5,666-5,690 of SEQ ID NO:2;

[0094] an equal length portion of nucleobases 5,857-5,881 of SEQ ID NO:2;

[0095] an equal length portion of nucleobases 9,352-9,377 of SEQ ID NO:2;

[0096] an equal length portion of nucleobases 11,331-11,358 of SEQ ID NO:2;

[0097] an equal length portion of nucleobases 16,292-16,328 of SEQ ID NO:2;

[0098] An equal length portion of nucleobases 17,120-17,151 of SEQ ID NO:2;

[0099] An equal length portion of nucleobases 17,211-17,241 of SEQ ID NO:2;

[0100] an equal length portion of nucleobases 17,281-17,331 of SEQ ID NO:2;

[0101] an equal length portion of nucleobases 17,410-17,445 of SEQ ID NO:2;

[0102] an equal length portion of nucleobases 17,601-17,641 of SEQ ID NO:2;

[0103] an equal length portion of nucleobases 17,635-17,670 of SEQ ID NO:2;

[0104] an equal length portion of nucleobases 17,663-17,712 of SEQ ID NO:2;

[0105] An equal length portion of nucleobases 17,753-17,781 of SEQ ID NO:2; or

[0106] An equal length portion of nucleobases 17,985-18,016 of SEQ ID NO:2.

[0107] Embodiment 10. The oligomeric compound of any one of embodiments 1-9, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 when measured over the entire nucleobase sequence of the modified oligonucleotide.

[0108] Embodiment 11. The oligomeric compound of any one of embodiments 1-10, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0109] Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0110] Embodiment 13. The oligomeric compound of embodiment 12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0111] Embodiment 14. An oligomeric compound as described in embodiment 13, wherein the modified oligonucleotide comprises at least one modified nucleoside, wherein the at least one modified nucleoside comprises a bicyclic sugar portion, wherein the bicyclic sugar portion has a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2-; and -O-CH(CH3)-.

[0112] Embodiment 15. The oligomeric compound of any one of embodiments 11-14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

[0113] Embodiment 16. The oligomeric compound of embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2'-MOE modified sugar or a 2'-OMe modified sugar.

[0114] Embodiment 17. The oligomeric compound of any one of embodiments 11-16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

[0115] Embodiment 18. The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from the group consisting of morpholino and PNA.

[0116] Embodiment 19. The oligomeric compound of any one of embodiments 1-12 or 15-18, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.

[0117] Embodiment 20. The oligomeric compound of any one of embodiments 1-19, wherein the modified oligonucleotide has a sugar motif comprising:

[0118] A 5' region consisting of 1 to 7 5' region nucleosides;

[0119] A central region consisting of 6-10 linked central region nucleosides; and

[0120] A 3' region consisting of 1 to 7 linked 3' region nucleosides; wherein

[0121] Each 5' region nucleoside and each 3' region nucleoside comprises a modified sugar and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0122] Embodiment 21. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0123] A 5' region consisting of 4 linked 5' region nucleosides;

[0124] A central region consisting of 8 linked central region nucleosides; and

[0125] A 3' region consisting of four linked 3' region nucleosides; wherein

[0126] Each 5' region nucleoside comprises a 2'-MOE modified sugar, each 3' region nucleoside comprises a 2'-MOE modified sugar or a cEt modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0127] Embodiment 22. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0128] A 5' region consisting of 4 linked 5' region nucleosides;

[0129] A central region consisting of 8 linked central region nucleosides; and

[0130] A 3' region consisting of five linked 3' region nucleosides; wherein

[0131] Each 5' region nucleoside comprises a 2'-MOE modified sugar, each 3' region nucleoside comprises a 2'-MOE modified sugar or a cEt modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0132] Embodiment 23. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0133] A 5' region consisting of five linked 5' region nucleosides;

[0134] A central region consisting of 8 linked central region nucleosides; and

[0135] A 3' region consisting of five linked 3' region nucleosides; wherein

[0136] Each 5' region and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0137] Embodiment 24. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0138] A 5' region consisting of five linked 5' region nucleosides;

[0139] A central region consisting of 9 linked central region nucleosides; and

[0140] A 3' region consisting of five linked 3' region nucleosides; wherein

[0141] Each 3' region nucleoside comprises a 2'-MOE modified sugar or a cEt modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0142] Embodiment 25. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0143] A 5' region consisting of five linked 5' region nucleosides;

[0144] A central region consisting of 9 linked central region nucleosides; and

[0145] A 3' region consisting of five linked 3' region nucleosides; wherein

[0146] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0147] Embodiment 26. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0148] A 5' region consisting of 6 5' region nucleosides linked together;

[0149] A central region consisting of 10 linked central region nucleosides; and

[0150] A 3' region consisting of four linked 3' region nucleosides; wherein

[0151] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0152] Embodiment 27. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0153] A 5' region consisting of 6 5' region nucleosides linked together;

[0154] A central region consisting of 10 linked central region nucleosides; and

[0155] A 3' region consisting of four linked 3' region nucleosides; wherein

[0156] Each 3' region nucleoside comprises a 2'-MOE modified sugar or a cEt modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0157] Embodiment 28. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0158] A 5' region consisting of five linked 5' region nucleosides;

[0159] A central region consisting of 10 linked central region nucleosides; and

[0160] A 3' region consisting of five linked 3' region nucleosides; wherein

[0161] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0162] Embodiment 29. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0163] A 5' region consisting of five linked 5' region nucleosides;

[0164] A central region consisting of 10 linked central region nucleosides; and

[0165] A 3' region consisting of five linked 3' region nucleosides; wherein

[0166] Each 3' region nucleoside comprises a 2'-MOE modified sugar or a cEt modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0167] Embodiment 30. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0168] A 5' region consisting of 4 linked 5' region nucleosides;

[0169] A central region consisting of 10 linked central region nucleosides; and

[0170] A 3' region consisting of 6 linked 3' region nucleosides; wherein

[0171] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0172] Embodiment 31. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0173] A 5' region consisting of three linked 5' region nucleosides;

[0174] A central region consisting of 10 linked central region nucleosides; and

[0175] A 3' region consisting of 7 linked 3' region nucleosides; wherein

[0176] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0177] Embodiment 32. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0178] A 5' region consisting of 7 5' region nucleosides linked together;

[0179] A central region consisting of 10 linked central region nucleosides; and

[0180] A 3' region consisting of three linked 3' region nucleosides; wherein

[0181] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar, and each central region nucleoside comprises a 2'-deoxyribosyl sugar.

[0182] Embodiment 33. The oligomeric compound of any one of embodiments 20-32, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.

[0183] Embodiment 34. The oligomeric compound of any one of embodiments 1-19, wherein the modified oligonucleotide has a sugar motif comprising:

[0184] A 5' region consisting of 1 to 6 5' region nucleosides;

[0185] A central region consisting of 6-10 linked central region nucleosides; and

[0186] A 3' region consisting of 1 to 6 linked 3' region nucleosides; wherein

[0187] Each 5' region nucleoside and each 3' region nucleoside comprises a modified sugar,

[0188] And the central region has the following formula:

[0189] (Nd)(Nx)(Nd)n

[0190] wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside;

[0191] And n is 6 to 8.

[0192] Embodiment 35. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0193] A 5' region consisting of five linked 5' region nucleosides;

[0194] A central region consisting of 8 linked central region nucleosides; and

[0195] A 3' region consisting of five linked 3' region nucleosides; wherein

[0196] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar,

[0197] And the central region has the following formula:

[0198] (Nd)(Nx)(Nd)n

[0199] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0200] And n is 6.

[0201] Embodiment 36. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0202] A 5' region consisting of five linked 5' region nucleosides;

[0203] A central region consisting of 8 linked central region nucleosides; and

[0204] A 3' region consisting of five linked 3' region nucleosides; wherein

[0205] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar,

[0206] And the central region has the following formula:

[0207] (Nd)(Nx)(Nd)n

[0208] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0209] And n is 6.

[0210] Embodiment 37. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0211] A 5' region consisting of five linked 5' region nucleosides;

[0212] A central region consisting of 10 linked central region nucleosides; and

[0213] A 3' region consisting of five linked 3' region nucleosides; wherein

[0214] Each 5' region nucleoside and each 3' region nucleoside comprises a 2'-MOE modified sugar,

[0215] And the central region has the following formula:

[0216] (Nd)(Nx)(Nd)n

[0217] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0218] And n is 8.

[0219] Embodiment 38. The oligomeric compound of any one of embodiments 34-37, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.

[0220] Embodiment 39. The oligomeric compound of any one of embodiments 1-38, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0221] Embodiment 40. The oligomeric compound of embodiment 39, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0222] Embodiment 41. The oligomeric compound of embodiment 39 or 40, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0223] Embodiment 42. The oligomeric compound of embodiment 39 or 41, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0224] Embodiment 43. The oligomeric compound of any one of embodiments 39, 41 or 42, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0225] Embodiment 44. The oligomeric compound of any one of embodiments 1-43, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0226] Embodiment 45. The oligomeric compound of embodiment 44, wherein the modified nucleobase is 5-methylcytosine.

[0227] Embodiment 46. The oligomeric compound of any one of embodiments 1-45, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

[0228] Embodiment 47. The oligomeric compound of any one of embodiments 1-21, 33, 34 or 38-46, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0229] Embodiment 48. The oligomeric compound of any one of embodiments 1-20, 22, 33, 34 or 38-46, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0230] Embodiment 49. The oligomeric compound of any one of embodiments 1-20, 23, 33, 34-36 or 38-46, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0231] Embodiment 50. The oligomeric compound of any one of embodiments 1-20, 24, 25, 33, 34 or 38-46, wherein the modified oligonucleotide consists of 19 linked nucleosides.

[0232] Embodiment 51. The oligomeric compound of any one of embodiments 1-20, 26-34 or 37-46, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0233] Embodiment 52. The oligomeric compound of embodiment 39, wherein the modified oligonucleotide has an internucleoside linkage motif soosssssssssssooooss, soooossssssssssso ooss, soooosssssssssssooss, soooosssssssssssooss, soooooossssssssssooss, ssooooossssssssssos, sooooossssssssssooss, soossssssssssooss, soooosssssssssooss, or soossssssssssoos, wherein "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.

[0234] Embodiment 53. The oligomeric compound of any one of embodiments 1-52, wherein the oligomeric compound is composed of modified oligonucleotides.

[0235] Embodiment 54. The oligomeric compound of any one of embodiments 1-52, comprising a conjugate group comprising a conjugate portion and a conjugate linker.

[0236] Embodiment 55. The oligomeric compound of embodiment 54, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

[0237] Embodiment 56. The oligomeric compound of embodiment 54 or 55, wherein the conjugate linker consists of a single bond.

[0238] Embodiment 57. The oligomeric compound of embodiment 54, wherein the conjugate linker is cleavable.

[0239] Embodiment 58. The oligomeric compound of embodiment 54, wherein the conjugate linker comprises 1-3 linker-nucleosides.

[0240] Embodiment 59. The oligomeric compound of any one of embodiments 54-58, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0241] Embodiment 60. The oligomeric compound of any one of embodiments 54-58, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0242] Embodiment 61. The oligomeric compound of any one of Embodiments 1-60, comprising terminal groups.

[0243] Embodiment 62. The oligomeric compound of any one of embodiments 1-61, wherein the oligomeric compound is a single-chain oligomeric compound.

[0244] Embodiment 63. The oligomeric compound of any one of embodiments 1-57 or 59-62, wherein the oligomeric compound does not comprise a linker-nucleoside.

[0245] Embodiment 64. An oligomeric duplex comprising the oligomeric compound of any one of embodiments 1-61 or 63.

[0246] Embodiment 65. An antisense compound comprising or consisting of the oligomeric compound of any one of embodiments 1-63 or the oligomeric duplex of embodiment 64.

[0247] Embodiment 66. A pharmaceutical composition comprising the oligomeric compound of any one of embodiments 1-63 or the oligomeric duplex of embodiment 64 and a pharmaceutically acceptable carrier or diluent.

[0248] Embodiment 67. The pharmaceutical composition of embodiment 66, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0249] Embodiment 68. The pharmaceutical composition of embodiment 67, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.

[0250] Embodiment 69. A method comprising administering to an animal the pharmaceutical composition of any one of embodiments 66-68.

[0251] Embodiment 70. A method of treating a disease associated with PRNPs, the method comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of Embodiments 66-68 to an individual suffering from or at risk of suffering from a disease associated with PRNPs; and thereby treating the disease associated with PRNPs.

[0252] Embodiment 71. A method of reducing PrP protein in the CSF of an individual having or at risk of developing a disease associated with PRNP, a therapeutically effective amount of a pharmaceutical composition according to any one of Embodiments 66-68; and thereby reducing PrP protein in the CSF.

[0253] Embodiment 72. A method as described in embodiment 71, wherein the PrP protein is PrP C .

[0254] Embodiment 73. A method as described in embodiment 71, wherein the PrP protein is PrP Sc .

[0255] Embodiment 74. A method as described in embodiment 71, wherein the PrP protein is PrP C PrP Sc both.

[0256] Embodiment 75. The method of embodiment 70 or 71, wherein the administration is by intrathecal administration.

[0257] Embodiment 76. The method of embodiment 70 or embodiment 71, wherein the disease associated with PRNP is a neurodegenerative disease.

[0258] Embodiment 77. The method of embodiment 76, wherein the neurodegenerative disease is selected from prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, or Parkinson's disease.

[0259] Embodiment 78. The method of any one of embodiments 70-77, wherein at least one symptom or marker of a neurodegenerative disease is improved.

[0260] Embodiment 79. The method of embodiment 78, wherein the symptom or sign is any of: spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, or death.

[0261] Embodiment 80. A method of reducing PRNP RNA in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1-63, an oligomeric duplex according to embodiment 64, or an antisense compound according to embodiment 65; and thereby reducing PRNP RNA in the cell.

[0262] Embodiment 81. A method of reducing PrP protein in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1-63, an oligomeric duplex according to embodiment 64, or an antisense compound according to embodiment 65; and thereby reducing PrP in the cell.

[0263] Embodiment 82. The method of embodiment 81, wherein the PrP protein is PrP C .

[0264] Embodiment 83. A method as described in embodiment 81, wherein the PrP protein is PrP Sc .

[0265] Embodiment 84. The method of embodiment 81, wherein the PrP protein is PrP C PrP Sc both.

[0266] Embodiment 85. The method of any one of Embodiments 80-84, wherein the cell is in an animal.

[0267] Embodiment 86. A modified oligonucleotide according to the following chemical structure:

[0268]

[0269] (SEQ ID NO: 1914), or a salt thereof.

[0270] Embodiment 87. A modified oligonucleotide according to the following chemical structure:

[0271]

[0272] (SEQ ID NO: 1914).

[0273] Embodiment 88. A modified oligonucleotide according to the following chemical structure:

[0274]

[0275] (SEQ ID NO: 1914), or a salt thereof.

[0276] Embodiment 89. A modified oligonucleotide according to the following chemical structure:

[0277]

[0278] (SEQ ID NO: 1914).

[0279] Embodiment 90. A modified oligonucleotide according to the following chemical structure:

[0280]

[0281] (SEQ ID NO: 1939), or a salt thereof.

[0282] Embodiment 91. A modified oligonucleotide according to the following chemical structure:

[0283]

[0284] (SEQ ID NO: 1939).

[0285] Embodiment 92. A modified oligonucleotide according to the following chemical structure:

[0286]

[0287] (SEQ ID NO: 2302), or a salt thereof.

[0288] Embodiment 93. A modified oligonucleotide according to the following chemical structure:

[0289]

[0290] (SEQ ID NO:2302).

[0291] Embodiment 94. A modified oligonucleotide according to the following chemical structure:

[0292]

[0293] (SEQ ID NO: 2750), or a salt thereof.

[0294] Embodiment 95. A modified oligonucleotide according to the following chemical structure:

[0295]

[0296] (SEQ ID NO:2750).

[0297] Embodiment 96. A modified oligonucleotide according to the following chemical structure:

[0298]

[0299] (SEQ ID NO: 2739), or a salt thereof.

[0300] Embodiment 97. A modified oligonucleotide according to the following chemical structure:

[0301]

[0302] (SEQ ID NO:2739).

[0303] Embodiment 98. The modified oligonucleotide of embodiment 86, 88, 90, 92, 94 or 96, which is a sodium salt of the chemical structure.

[0304] Embodiment 99. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m CEO TesAes m Ce (SEQ ID NO: 1914), wherein

[0305] A = adenine nucleobase,

[0306] m C=5-methylcytosine nucleobase,

[0307] G = guanine nucleobase,

[0308] T = thymine nucleobase,

[0309] e=2'-MOE modified sugar,

[0310] d = 2'-β-D-deoxyribose sugar,

[0311] s = phosphorothioate internucleoside linkage, and

[0312] o = phosphodiester internucleoside linkage.

[0313] Embodiment 100. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo m Ceo Aeo Teo Aeo Ads Tds Tds Tds Tds m Cds Tds Tds Ads Gds m CEO TesAes m Ce (SEQ ID NO: 1914), wherein

[0314] A = adenine nucleobase,

[0315] m C=5-methylcytosine nucleobase,

[0316] G = guanine nucleobase,

[0317] T = thymine nucleobase,

[0318] e=2'-MOE modified sugar,

[0319] d = 2'-β-D-deoxyribose sugar,

[0320] s = phosphorothioate internucleoside linkage, and

[0321] o = phosphodiester internucleoside linkage.

[0322] Embodiment 101. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges m Ceo Teo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CEO Tes m Ces m Ce (SEQ ID NO: 1939), wherein

[0323] A = adenine nucleobase,

[0324] m C=5-methylcytosine nucleobase,

[0325] G = guanine nucleobase,

[0326] T = thymine nucleobase,

[0327] e=2'-MOE modified sugar,

[0328] d = 2'-β-D-deoxyribose sugar,

[0329] s = phosphorothioate internucleoside linkage, and

[0330] o = phosphodiester internucleoside linkage.

[0331] Embodiment 102. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo Geo Teo m Ceo Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m CesTe (SEQ ID NO: 2302), wherein

[0332] A = adenine nucleobase,

[0333] mC=5-methylcytosine nucleobase,

[0334] G = guanine nucleobase,

[0335] T = thymine nucleobase,

[0336] e=2'-MOE modified sugar,

[0337] d = 2'-β-D-deoxyribose sugar,

[0338] s = phosphorothioate internucleoside linkage, and

[0339] o = phosphodiester internucleoside linkage.

[0340] Embodiment 103. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo mCeo Aeo Teo Ads Ads Tds Tds Tds Tds mCds Tds Tds Aes Geo mCeo TesAe (SEQ ID NO: 2750), wherein,

[0341] A = adenine nucleobase,

[0342] mC=5-methylcytosine nucleobase,

[0343] G = guanine nucleobase,

[0344] T = thymine nucleobase,

[0345] e=2'-MOE modified sugar,

[0346] d = 2'-β-D-deoxyribose sugar,

[0347] s = phosphorothioate internucleoside linkage, and

[0348] o = phosphodiester internucleoside linkage.

[0349] Embodiment 104. A compound comprising a modified oligonucleotide according to the following chemical symbols: Aes mCeo Geo Teo mCes mCds Ads Tds Tds Tds Tds mCds Tds Gds Tds Geo mCeoTes Tes Te (SEQ ID NO: 2739), wherein,

[0350] A = adenine nucleobase,

[0351] mC=5-methylcytosine nucleobase,

[0352] G = guanine nucleobase,

[0353] T = thymine nucleobase,

[0354] e=2'-MOE modified sugar,

[0355] d = 2'-β-D-deoxyribose sugar,

[0356] s = phosphorothioate internucleoside linkage, and

[0357] o = phosphodiester internucleoside linkage.

[0358] Embodiment 105. A compound as described in any of embodiments 99-104, which comprises a modified oligonucleotide covalently linked to a conjugate group.

[0359] Embodiment 106. A chirally enriched population of modified oligonucleotides as described in any of embodiments 86-105, wherein the population is enriched for modified oligonucleotides that contain at least one specific phosphorothioate internucleoside linkage with a specific stereochemical configuration.

[0360] Embodiment 107. The chiral enriched population of Embodiment 106, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a (Sp) or (Rp) configuration.

[0361] Embodiment 108. A chiral enriched population as described in embodiment 106, wherein the population is enriched for modified oligonucleotides having independently selected specific stereochemical configurations at each phosphorothioate internucleoside linkage

[0362] Embodiment 109. The chirally enriched population of Embodiment 106, wherein the population is enriched for modified oligonucleotides having a (Sp) or (Rp) configuration at each phosphorothioate internucleoside linkage.

[0363] Embodiment 110. A chirally enriched population as described in Embodiment 106, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and a (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0364] Embodiment 111. The chiral enriched population of embodiment 106 or embodiment 108, wherein the population is enriched for modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the configurations of Sp, Sp, and Rp in the 5' to 3' direction.

[0365] Embodiment 112. A population of modified oligonucleotides as described in any one of embodiments 86-105, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0366] Embodiment 113. A pharmaceutical composition comprising a population of modified oligonucleotides as described in any one of embodiments 106-112 and a pharmaceutically acceptable carrier or diluent.

[0367] Embodiment 114. A pharmaceutical composition as described in any one of embodiments 86-105 and a pharmaceutically acceptable diluent or carrier.

[0368] Embodiment 115. The pharmaceutical composition of embodiment 114, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0369] Embodiment 116. The pharmaceutical composition of Embodiment 115, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.

[0370] I. Certain oligonucleotides

[0371] In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which are composed of connected nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Relative to unmodified RNA or DNA, the modified oligonucleotides include at least one modification. That is, the modified oligonucleotides include at least one modified nucleoside (including modified sugar moieties and / or modified core bases) and / or at least one modified internucleoside bond.

[0372] A. Certain modified nucleosides

[0373] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0374] 1. Certain sugar moieties

[0375] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogate may contain one or more substitutions corresponding to substitutions of other types of modified sugar moieties.

[0376] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl group, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of 2'-substituents suitable for non-bicyclic modified sugar moieties include, but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m)-alkynyl, O-alkylalkenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), where each R m and R n are independently H, an amino protecting group or a substituted or unsubstituted C1-C 10 alkyl and 2'-substituents described in Cook et al., US6,531,584; Cook et al., US5,859,221; and Cook et al., US6,005,087. Certain embodiments of these 2'-substituents may also be substituted with one or more substituents independently selected from the group consisting of hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to: 5-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as 2'-F-5'-methyl sugar moiety and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US 2013 / 0203836.).

[0377] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamide (OCH2C(=O)-N(R m )(R n )), where each R m and R n are independently H, an amino protecting group or a substituted or unsubstituted C1-C 10 alkyl.

[0378] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0379] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of: F, OCH3, and OCH2CH2OCH3.

[0380] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridged sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE"), and the like (see, e.g., Seth et al., U.S. Pat. No. 7,399,845; Bhat et al., U.S. Pat. No. 7,569,686; Swayze et al., U.S. Pat. No. 7,741,457; and Swayze et al., U.S. Pat. No. 7,614,785). S8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,426), 4'-C(R a R b )-N(R)-O-2'、4'-C(Ra R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b are independently H, a protecting group or a C1-C 12 Alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0381] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups independently selected from: -[C(R a )(R b )] n -、-[C(R a )(R b )] n -O-、-C(R a )=C(R b )-、-C(R a )=N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R a )-;

[0382] in:

[0383] x is 0, 1, or 2;

[0384] n is 1, 2, 3 or 4;

[0385] Each R a and R b are independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl group (C(=O)-H), substituted acyl group, CN, sulfonyl group (S(=O)2-J1) or sulfinyl group (S(=O)-J1); and

[0386] Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl or protecting group.

[0387] Other bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 20017, 129, 836 2-8379; Wengel et al., US7,053,207; Imanishi et al., US6,268,490; Imanishi et al., US6,770,748; Imanishi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; and Ramasamy et al., US6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and U.S. Patent Publication No. US2008 / 0039618 to Allerson et al. and US2015 / 0191727 to Migawa et al.

[0388] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are also defined by isomeric configuration. For example, LNA nucleosides (described herein) may be in the α-L configuration or the β-D configuration.

[0389]

[0390] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides and have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this article, the general description of bicyclic nucleosides includes two isomeric configurations. Unless otherwise specified, when the position of a specific bicyclic nucleoside (e.g., LNA or cEt) is identified in the embodiments exemplified herein, they are in the β-D configuration.

[0391] In certain embodiments, a modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted sugar and a 4'-2' bridging sugar).

[0392] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is substituted by, for example, a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridged and / or non-bridged substituents as described herein. For example, some sugar surrogates include 4'-sulfur atoms and 2' substitutions (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or 5' substitutions.

[0393] In certain embodiments, the sugar surrogate comprises a ring having other than 5 atoms. For example, in certain embodiments, the sugar surrogate comprises a 6-membered tetrahydropyran ("THP"). Such tetrahydropyrans may also be modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids ("HNA"), anitol nucleic acids ("ANA"), mannitol nucleic acids ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

[0394]

[0395] ("F-HNA", see, e.g., Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and nucleosides including other modified THP compounds having the formula:

[0396]

[0397] Wherein, independently, for each of these modified THP nucleosides:

[0398] Bx is the nucleobase part;

[0399] T3 and T4 are each independently an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

[0400] q1, q2, q3, q4, q5, q6 and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and

[0401] Each of R1 and R2 is independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and each J1, J2 and J3 is independently H or C1-C6 alkyl.

[0402] In certain embodiments, modified THP nucleosides are provided wherein each of q1, q2, q3, q4, q5, q6 and q7 is H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0403] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholinyl sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholinyl" means a sugar surrogate having the following structure:

[0404]

[0405] In certain embodiments, the morpholinyl group can be modified, for example, by adding or changing a plurality of substituents from the above-described morpholinyl structure. Such sugar surrogates are referred to herein as "modified morpholinyl groups".

[0406] In certain embodiments, the sugar surrogate comprises a non-cyclic moiety. Examples of nucleosides and oligonucleotides comprising such non-cyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), non-cyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865) and Manoharan et al., nucleosides and oligonucleotides described in WO2011 / 133876.

[0407] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.

[0408] 2. Certain modified nucleobases

[0409] In certain embodiments, the modified oligonucleotide comprises one or more nucleosides, which comprise unmodified nucleobases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides, which comprise modified nucleobases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides, which do not comprise nucleobases, referred to as abasic nucleosides.

[0410] In certain embodiments, the modified nucleobase is selected from the group consisting of: a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl or alkynyl substituted pyrimidine, an alkyl substituted purine, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from the group consisting of: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and others 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, ubiquitous bases, size-expanded bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenthiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include nucleobases in which purine or pyrimidine bases are replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., eds., CRC Press, 1993, 273-288; and Chapter 6 and Chapter 15, Antisense Drug Technology, Crooke ST, ed., CRC Press, 2008, 163-166 and 442-443.

[0411] Publications teaching the preparation of some of the above-mentioned modified nucleobases as well as other modified nucleobases include, but are not limited to, Manoharan et al., US 2003 / 0158403; Manoharan et al., US 2003 / 0175906; Dinh et al., US 4,845,205; Spielvogel et al., US 5,130,302; Rogers et al., US 5,134,066; Bischofberger et al., US 5,1 75,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525,7 11; Haralambidis et al., US5,552,540; Cook et al., US5,587,469; Froehler et al., US5,594,121; Switzer et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al. Cook et al., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0412] 3. Certain modified internucleoside linkages

[0413] In certain embodiments, the nucleosides of the modified oligonucleotide can be linked together using any internucleoside linkage. Two major categories of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates containing a phosphodiester bond ("P=O") (also referred to as unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkages include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thiocarbamates (-OC(=O)(NH)-S-); siloxanes (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to natural phosphate linkages, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures, or as individual enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0414] Representative internucleoside bonds with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside bonds with chiral centers can be prepared as modified oligonucleotide populations comprising stereo-random internucleoside bonds, or as populations of modified oligonucleotides comprising phosphorothioate bonds in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides comprises phosphorothioate internucleoside bonds, wherein all phosphorothioate internucleoside bonds are stereo-random. Such modified oligonucleotides can be generated using a randomly selected synthesis method that produces a stereochemical configuration for each phosphorothioate bond. However, as is well understood by those skilled in the art, each single phosphorothioate of each single oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides that comprise one or more specific phosphorothioate internucleoside bonds in a specific independently selected stereochemical configuration. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art (e.g., Oka et al., JACS 125, 8307 (2003); Wan et al., Nuc. Acid. Res. 42, 13456 (2014) and methods described in WO 2017 / 015555). In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in a (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in a (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulae, wherein "B" indicates a nucleobase:

[0415]

[0416] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereorandom or in a specific stereochemical configuration.

[0417] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methylal (3'-O-CH2-O-5'), methoxypropyl, and thiomethylal (3'-S-CH2-O-5'). Other neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Shanghvi and PDCook, eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Other neutral internucleoside linkages include non-ionic linkages containing mixed N, O, S and CH2 components.

[0418] B. Certain motifs

[0419] In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides, and the one or more modified nucleosides comprise a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides, and the one or more modified nucleosides comprise a modified core base. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified and differently modified sugar moieties, core bases and / or internucleoside linkages of the modified oligonucleotide define patterns or motifs. In certain embodiments, the patterns of sugar moieties, core bases and internucleoside linkages are each independent of one another. Therefore, the modified oligonucleotide can be described by its sugar motif, core base motif and / or internucleoside linkage motif (as used herein, the core base motif describes the modification of the core base of the sequence independent of the core base).

[0420] 1. Certain sugar motifs

[0421] In certain embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif. In certain cases, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0422] In certain embodiments, the modified oligonucleotide comprises or consists of a region with a gap body motif, which is defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gap body motif (5'-wing, gap and 3'-wing) form a continuous nucleoside sequence, wherein at least some sugar moieties of the nucleosides of each wing are different from at least some sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleosides closest to the gap of each wing (the most 3'-nucleosides of the 5'-wing and the most 5'-nucleosides of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties in the gap are identical to each other. In certain embodiments, the gap includes one or more nucleosides with a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetrical gap bodies). In certain embodiments, the sugar motifs of the 5'-wing are different from the sugar motifs of the 3'-wing (asymmetric gap bodies).

[0423] In certain embodiments, the wing of the spacer comprises 1-5 nucleosides. In certain embodiments, the wing of the spacer comprises 6 or 7 nucleosides. In certain embodiments, each nucleoside of each wing of the spacer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of the spacer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of the spacer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of the spacer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of the spacer are modified nucleosides.

[0424] In certain embodiments, the gap of the spacer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of the spacer is an unmodified 2'-deoxynucleoside. In certain embodiments, at least one nucleoside of the gap of the spacer is a modified nucleoside. In certain embodiments, at least one nucleoside of the gap of the spacer comprises a 2'-deoxyfuranosyl sugar moiety having an isomeric configuration except for a β-D-ribosyl configuration.

[0425] In certain embodiments, the spacer is a deoxy spacer. In certain embodiments, the nucleoside on the gap side of each wing / gap junction is an unmodified 2'-deoxynucleoside and the nucleoside on the wing side of each wing / gap junction is a modified nucleoside. In certain embodiments, each nucleoside in the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of the spacer is a modified nucleoside.

[0426] In certain embodiments, the modified oligonucleotide comprises or consists of a region with a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region with a fully modified sugar motif, wherein each nucleoside in the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each uniformly modified nucleoside comprises the same 2'-modification.

[0427] In this article, the length (number of nucleosides) of the three regions of the gap body can be provided using the annotation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Therefore, the 5-10-5 gap body is composed of 5 connected nucleosides in each wing and 10 connected nucleosides in the gap. When the nomenclature is followed by a specific modification, the modification is a modification in each sugar of each wing and the gap nucleosides include unmodified deoxynucleosides. Therefore, the 5-10-5MOE gap body is composed of 5 connected 2'-MOE modified nucleosides in the 5'-wing, 10 connected deoxynucleosides in the gap, and 5 connected 2'-MOE nucleosides in the 3'-wing. In certain such embodiments, the deoxynucleosides in the gap include 2'-β-D-deoxyribosyl sugars. Mixed wing gap bodies have at least two different modified sugars in the 5' and / or 3' wings.

[0428] In certain embodiments, the modified oligonucleotide is a 5-10-5MOE spacer. In certain embodiments, the modified oligonucleotide is a 4-10-6MOE spacer. In certain embodiments, the modified oligonucleotide is a 6-10-4MOE spacer. In certain embodiments, the modified oligonucleotide is a 3-10-7MOE spacer. In certain embodiments, the modified oligonucleotide is a 7-10-3MOE spacer. In certain embodiments, the modified oligonucleotide is a 5-8-5MOE spacer. In certain embodiments, the modified oligonucleotide is a 5-9-5MOE spacer. In certain embodiments, the modified oligonucleotide is an XYZ MOE spacer, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6 or 7 connected 2'-MOE nucleosides and Y is selected from 7, 8, 9, 10 or 11 connected deoxynucleosides.

[0429] In certain embodiments, the modified oligonucleotide has a sugar motif (5' to 3') selected from the following: eeeeedddddddddkkeee, eeeeeeddddddddddkkee, eeeeedddd dddddkkeee, eeeeddddddddkkeee, eeeeddddddddkkee, eeeeedydddddd ddeeeee, eeeeedyddddddeeeee, or eeeeeedyddddddddeeee, wherein "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0430] 2. Certain nucleobase motifs

[0431] In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, the nucleobases are unmodified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine and all other nucleobases are unmodified nucleobases.

[0432] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides at the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides at the 5' end of the oligonucleotide.

[0433] In certain embodiments, the oligonucleotide with the spacer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, a nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide with the spacer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribose moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propyne pyrimidine.

[0434] 3. Certain internucleoside linkage motifs

[0435] In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereo-random phosphorothioates (Sp) phosphorothioates and (Rp) phosphorothioates. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wing are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer, and the internucleoside linkage motif includes at least one phosphodiester internucleoside linkage in at least one wing, wherein at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are thiophosphate internucleoside linkages. In certain such embodiments, all thiophosphate linkages are stereo random. In certain embodiments, all thiophosphate linkages in the wing are (Sp) thiophosphates, and the gap includes at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides, and the modified oligonucleotides include such internucleoside linkage motifs.

[0436] C. Certain lengths

[0437] The length of oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al. (Proc.Natl.Acad.Sci.USA 89:7305-7309,1992), a series of oligonucleotides with a length of 13-25 nucleobases were tested in an oocyte injection model to induce the ability of target RNA cracking. Oligonucleotides with a length of 25 nucleobases and 8 or 11 mismatched bases near the end of the oligonucleotide can directly specifically crack the target RNA, but the degree is less than the oligonucleotides without mismatches. Similarly, target-specific cracking is achieved using 13 nucleobase oligonucleotides, including nucleobase oligonucleotides with 1 or 3 mismatches.

[0438] In certain embodiments, oligonucleotides (including modified oligonucleotides) may have any of a plurality of length ranges. In certain embodiments, oligonucleotides are composed of X to Y linked nucleosides, wherein X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, the oligonucleotide is from 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23 , 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23 , 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27 , 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25,20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 2 7, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30 or 29 to 30 linked nucleosides.

[0439] D. Certain modified oligonucleotides

[0440] In certain embodiments, the above modifications (sugar, core base, internucleoside linkage) are included in modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modified motifs and overall length. In certain embodiments, such parameters are each independent of one another. Therefore, unless otherwise specified, each internucleoside linkage of an oligonucleotide with a spacer sugar motif may be modified or unmodified and may or may not follow a sugar-modified spacer modification pattern. For example, the internucleoside linkage in the wing region of a sugar spacer may be identical or different from one another and may be identical or different from the internucleoside linkage in the gap region of a sugar motif. Similarly, such sugar spacer oligonucleotides may include one or more modified core bases independently of the sugar-modified spacer pattern. Unless otherwise specified, all modifications are independent of the core base sequence.

[0441] E. Populations of certain modified oligonucleotides

[0442] A population of modified oligonucleotides (wherein all modified oligonucleotides of the population have the same molecular formula) can be a stereo-random population or a chiral-enriched population. All chiral centers of all modified oligonucleotides in a stereo-random population are stereo-random. In a chiral-enriched population, at least one specific chiral center in the modified oligonucleotides of the population is not stereo-random. In certain embodiments, the modified oligonucleotides of the chiral-enriched population are enriched in β-D ribosyl sugar moieties, and all thiophosphate nucleoside interlinkages are stereo-random. In certain embodiments, the modified oligonucleotides of the chiral-enriched population are enriched in β-D ribosyl sugar moieties and at least one specific thiophosphate nucleoside interlinkage in a specific stereochemical configuration.

[0443] F. Nucleobase sequence

[0444] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are also described by their core base sequences. In certain embodiments, the oligonucleotides have a core base sequence complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain such embodiments, the region of the oligonucleotides has a core base sequence complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain embodiments, the core base sequence of the region or the entire length of the oligonucleotides is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or a nucleic acid (e.g., a target nucleic acid).

[0445] II. Certain oligomeric compounds

[0446] In certain embodiments, oligomeric compounds are provided herein, which are composed of oligonucleotides (modified or unmodified) and optionally one or more conjugate groups and / or end groups. The conjugate group is composed of one or more conjugate moieties and a conjugate joint connecting the conjugate moiety to the oligonucleotide. The conjugate group can be connected to either end or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is connected to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group connected to either end or both ends of the oligonucleotide is an end group. In certain such embodiments, the conjugate group or end group is connected to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or end group) is connected to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is connected near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or end group) is connected to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is connected near the 5' end of the oligonucleotide.

[0447] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides.

[0448] A. Certain conjugate groups

[0449] In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group changes one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group imparts new properties to the linked oligonucleotide, such as a fluorophore or reporter group capable of detecting the oligonucleotide.Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers (e.g., hexyl-S-tritylthiol) (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains (e.g., dodecanediol or undecyl residues) (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids (e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate) (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantaneacetic acid palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or GalNAc cluster (e.g. WO2014 / 179620).

[0450] 1. Conjugate part

[0451] Conjugate moieties include, but are not limited to, intercalators, reporters, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rose bengal, coumarin, fluorophores, and dyes.

[0452] In certain embodiments, the conjugate portion comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepam, indomethicin, barbiturate, cephalosporin, sulfonamides, antidiabetic agents, antibacterial agents, or antibiotics.

[0453] 2. Conjugate Linker

[0454] The conjugate moiety is connected to the oligonucleotide via a conjugate linker. In some oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly connected to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units (e.g., ethylene glycol, nucleoside, or amino acid units).

[0455] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxyamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus part. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0456] In certain embodiments, the conjugate linker (including the conjugate linker described above) is a bifunctional linking portion, such as those known in the art that can be used to connect the conjugate group to the parent compound (such as the oligonucleotide provided herein). In general, the bifunctional linking portion comprises at least two functional groups. One functional group is selected to bind to a specific site on the parent compound and the other is selected to bind to the conjugate group. Examples of functional groups used in the bifunctional linking portion include, but are not limited to, an electrophile for reacting with a nucleophilic group and a nucleophile for reacting with an electrophilic group. In certain embodiments, the bifunctional linking portion comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl and alkynyl.

[0457] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxooctanoic acid (ADO), 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid succinimidyl ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halo, alkyl, aryl, alkenyl, and alkynyl.

[0458] In certain embodiments, the conjugate linker comprises 1-10 linkers-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linkers-nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linkers-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linkers-nucleosides are modified nucleosides. In certain embodiments, such linkers-nucleosides comprise modified sugar moieties. In certain embodiments, linkers-nucleosides are unmodified. In certain embodiments, linkers-nucleosides comprise optionally protected heterocyclic bases selected from purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. Usually the required linker-nucleoside is cracked from the oligomeric compound after it reaches the target tissue. Therefore, the linker-nucleoside is usually connected to each other and is connected to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, this type of cleavable bond is a phosphodiester bond.

[0459] In this article, the linker-nucleoside is not considered as part of an oligonucleotide. Therefore, in an embodiment where the oligomeric compound comprises an oligonucleotide consisting of a specified number or range of connected nucleosides and / or complementary to a specified percentage of a reference nucleic acid and the oligomeric compound also comprises a conjugate group of a conjugate linker comprising a linker-nucleoside, those linkers-nucleosides are not included in the length of the oligonucleotide and are not used to determine the complementary percentage of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linkers-nucleosides, the 1-10 linkers-nucleosides being adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent connected nucleosides in this oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of adjacent connected nucleosides in this oligomeric compound is not greater than 30. Unless otherwise indicated, the conjugate linker comprises no more than 10 linkers-nucleosides. In certain embodiments, the conjugate linker comprises no more than 5 linkers-nucleosides. In certain embodiments, the conjugate linker comprises no more than 3 linkers-nucleosides. In certain embodiments, the conjugate linker comprises no more than 2 linkers-nucleosides. In certain embodiments, the conjugate linker comprises no more than 1 linker-nucleoside.

[0460] In certain embodiments, it is necessary for the conjugate group to be cleaved from the oligonucleotide. For example, in some cases, the oligomeric compound comprising a specific conjugate portion is preferably absorbed by a specific cell type, but once the oligomeric compound is absorbed, it is necessary for the conjugate group to be cleaved to release unbound or parent oligonucleotides. Therefore, some conjugate joints may include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms having one, two, three, four or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved in a cell or subcellular compartment (e.g., lysosome). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (e.g., nuclease).

[0461] In certain embodiments, the cleavable bond is selected from: amide, ester, ether, one or two esters of phosphodiester, phosphate, carbamate or disulfide. In certain embodiments, the cleavable bond is one or two esters of phosphodiester. In certain embodiments, the cleavable portion comprises phosphate or phosphodiester. In certain embodiments, the cleavable portion is a phosphate bond between an oligonucleotide and a conjugate portion or conjugate group.

[0462] In certain embodiments, the cleavable portion comprises or consists of one or more joints-nucleosides. In certain such embodiments, the one or more joints-nucleosides are connected to each other and / or are connected to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxynucleoside that is connected to the 3' or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and is covalently connected to the conjugate joint or the remainder of the conjugate portion by a phosphate or thiophosphate bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0463] B. Certain end groups

[0464] In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-connected nucleosides. In certain such embodiments, the 2'-connected nucleosides are abasic nucleosides.

[0465] III. Oligoduplex

[0466] In certain embodiments, oligomeric compounds as described herein include oligonucleotides having a core base sequence complementary to a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes include a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex includes or is composed of: (1) a modified or unmodified oligonucleotide and an optional conjugate group and (2) a second modified or unmodified oligonucleotide and an optional conjugate group. Any one or two oligomeric compounds of an oligomeric duplex may include a conjugate group. The oligomeric nucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

[0467] IV. Antisense activity

[0468] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing with target nucleic acids to produce at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when the amount or activity of target nucleic acids is reduced or inhibited by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds include a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and do not hybridize with one or more non-target nucleic acids or do not hybridize with one or more non-target nucleic acids in a manner that produces significant unwanted antisense activity.

[0469] In certain antisense activities, hybridization of antisense compounds to target nucleic acids can recruit proteins that cleave target nucleic acids. For example, certain antisense compounds produce RNase H-mediated cleavage of target nucleic acids. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to trigger RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a spacer are not tolerated.

[0470] In some antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), which ultimately cleaves the target nucleic acid. For example, some antisense compounds can cleave the target nucleic acid by Argonaute. The antisense compound loaded into RISC is an RNAi compound. The RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0471] In certain embodiments, antisense compounds and target nucleic acid hybridization will not recruit proteins that crack the target nucleic acid. In certain embodiments, antisense compounds and target nucleic acid hybridization can change the splicing of the target nucleic acid. In certain embodiments, antisense compounds and target nucleic acid hybridization can inhibit the binding interaction between the target nucleic acid and the protein or other nucleic acids. In certain embodiments, antisense compounds and target nucleic acid hybridization can change the translation of the target nucleic acid.

[0472] Antisense activity can be observed directly or indirectly. In certain embodiments, the observation or detection of antisense activity involves the observation or detection of a change in the amount of a target nucleic acid or a protein encoded by the target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0473] V. Certain target nucleic acids

[0474] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: mature mRNA and pre-mRNA, including intronic regions, exonic regions, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is completely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron. In certain embodiments, the target nucleic acid is an RNA transcription product of a reverse transcription gene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: long non-coding RNA, short non-coding RNA, intron RNA molecules.

[0475] A. Complementarity / mismatch with target nucleic acid

[0476] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93: 463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and 3 mismatches to bcl-xL mRNA reduced the ability of bcl-2 and bcl-xL to be expressed in vitro and in vivo. In addition, this oligonucleotide exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16: 3341-3358, 1988) tested a series of 14-nucleobase oligonucleotides in series and 28 and 42-nucleobase oligonucleotides containing two or three sequences in the series oligonucleotides in a rabbit reticulocyte assay to prevent the translation of human DHFR. Each of the three individual 14-nucleobase oligonucleotides was able to inhibit translation, but the level was more moderate than that of 28 or 42-nucleobase oligonucleotides.

[0477] In certain embodiments, oligonucleotide is complementary to target nucleic acid on the whole length of oligonucleotide.In certain embodiments, oligonucleotide is complementary to target nucleic acid 99%, 95%, 90%, 85% or 80%.In certain embodiments, oligonucleotide is complementary to target nucleic acid at least 80% on the whole length of oligonucleotide and comprises and target nucleic acid 100% or the region of complete complementarity.In certain embodiments, the length in the region of complete complementarity is 6 to 20, 10 to 18 or 18 to 20 core bases.

[0478] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, the antisense activity for the target is reduced due to the mismatch, but the activity reduction amount for non-target is larger. Therefore, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located in the oligonucleotide with the spacer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7 or 8 from the 5' end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3' end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3 or 4 from the 5' end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2 or 1 from the 3' end of the wing region.

[0479] B. PRNP

[0480] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is a PRNP. In certain embodiments, the PRNP nucleic acid has a sequence described in SEQ ID NO: 1 (GENBANK Accession No.: NM_000311.4) or SEQ ID NO: 2 (GENBANK Accession No.: NC_000020.11, truncated from nucleotides 4683001 to 4705000). In certain embodiments, the PRNP nucleic acid has a sequence described in SEQ ID NO: 3 (GENBANK Accession No.: NM_001080123.2), which is a splice variant of SEQ ID NO: 1. In certain embodiments, the PRNP nucleic acid has the sequence described in SEQ ID NO:4 (ENSEMBL accession number ENST00000359125.6, from ENSEMBL version 98: September 2019, human reference assembly form GRCh38.p13, located at positions 63,406,137 to 63,472,590 of the antisense strand of chromosome 20 (CM000682.2); Yates et al., "Ensembl 2020", Nucleic Acids Research, gkz966, 2019), which is a splice variant of SEQ ID NO:1.

[0481] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 reduces the amount of PRNP RNA, and in certain embodiments reduces the amount of PrP protein. In certain embodiments, the oligomeric compound is composed of modified oligonucleotides. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 improves one or more symptoms or markers of a neurodegenerative disease. In certain embodiments, the oligomeric compound is composed of modified oligonucleotides. In certain embodiments, the symptom or marker is spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia and death. In certain embodiments, the oligomeric compound is composed of modified oligonucleotides.

[0482] In certain embodiments, administration of an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 reduces the detectable amount of PrP protein in CSF. In certain embodiments, the PrP protein is PrP C In certain embodiments, the PrP protein is PrP Sc In certain embodiments, the PrP protein is PrP C and PrP Sc .

[0483] C. Certain target nucleic acids in certain tissues

[0484] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell and tissue comprising a central nervous system (CNS). Such tissues include brain tissue, such as cortex, substantia nigra, striatum, midbrain, brain stem, and spinal cord.

[0485] VI. Certain pharmaceutical compositions

[0486] In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, one or more oligomeric compounds are each composed of modified oligonucleotides. In certain embodiments, pharmaceutical compositions comprise a pharmaceutically acceptable diluent or carrier. In certain embodiments, pharmaceutical compositions comprise sterile saline solution and one or more oligomeric compounds or consist of it. In certain embodiments, sterile saline is pharmaceutical grade saline. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and sterile water or consist of it. In certain embodiments, sterile water is pharmaceutical grade water. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and phosphate buffered saline (PBS) or consist of it. In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and artificial cerebrospinal fluid or consist of it. In certain embodiments, artificial cerebrospinal fluid is pharmaceutical grade.

[0487] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition is composed of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition is essentially composed of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0488] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipient is selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinyl pyrrolidone.

[0489] In certain embodiments, the oligomeric compound can be mixed with pharmaceutically acceptable active and / or inert substances to prepare a pharmaceutical composition or formulation. The composition and method for preparing a pharmaceutical composition depends on a number of criteria (including but not limited to the route of administration, the extent of the disease or the intended dose).

[0490] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides are capable of providing (directly or indirectly) biologically active metabolites or residues thereof when administered to animals (including humans). Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of oligomeric compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts. In certain embodiments, prodrugs include one or more conjugate groups connected to oligonucleotides, wherein the conjugate groups are cleaved in vivo by endogenous nucleases.

[0491] Lipid moieties have been used in nucleic acid therapy in a variety of methods. In some such methods, nucleic acids (e.g., oligomeric compounds) are introduced into preformed liposomes or lipid complexes consisting of a mixture of cationic lipids and neutral lipids. In some methods, a complex of DNA and a single or multiple cationic lipids is formed but neutral lipids are not present. In certain embodiments, the lipid moiety is selected to increase the distribution of the agent to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of the agent to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the agent to muscle tissue.

[0492] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents are used, such as dimethyl sulfoxide.

[0493] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0494] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems comprise, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, these co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is a VPD co-solvent system, which comprises 3% w / v benzyl alcohol, 8% w / v of a non-polar surfactant Polysorbate 80 TMand 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied considerably without significantly changing their solubility and toxicity characteristics. In addition, the nature of the cosolvent components can be varied: for example, other surfactants can be used in place of Polysorbate 80 TM ; The fraction size of polyethylene glycol can vary; other biocompatible polymers can replace polyethylene glycol, such as polyvinyl pyrrolidone; and other sugars or polysaccharides can replace dextrose.

[0495] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated into an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients (e.g., ingredients that contribute to solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Some pharmaceutical compositions for injection are presented in unit dosage form, such as ampoules or multi-dose containers. Some pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain preparatants, such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0496] VII. Certain compositions

[0497] 1. Compound No. 1238994

[0498] In certain embodiments, compound No. 1238994 is characterized as having the sequence (5' to 3') GTCATAATTTTCTTAGCTAC (SEQ ID NO:1914), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0499] In certain embodiments, compound number 1238994 is represented by the following chemical symbols (5' to 3'): Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m CEO Tes Aes m Ce (SEQ ID NO: 1914), wherein

[0500] A = adenine nucleobase,

[0501] m C=5-methylcytosine nucleobase,

[0502] G = guanine nucleobase,

[0503] T = thymine nucleobase,

[0504] e=2'-MOE modified sugar,

[0505] d = 2'-β-D-deoxyribosyl sugar,

[0506] s = phosphorothioate internucleoside linkage, and

[0507] o = phosphodiester internucleoside linkage.

[0508] In certain embodiments, Compound No. 1238994 is represented by the following chemical structure:

[0509]

[0510] (SEQ ID NO: 1914).

[0511] Structure 1. Compound No. 1238994

[0512] In certain embodiments, the sodium salt of Compound No. 1238994 is represented by the following chemical structure:

[0513]

[0514] (SEQ ID NO: 1914).

[0515] Structure 2. Sodium salt of compound number 1238994

[0516] 2. Compound No. 1373021

[0517] In certain embodiments, compound No. 1373021 is characterized as having the sequence (5' to 3') GTCATAATTTTCTTAGCTAC (SEQ ID NO:1914), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0518] In certain embodiments, compound number 1373021 is represented by the following chemical symbols (5' to 3'): Ges Teo m Ceo Aeo Teo Aeo Ads Tds Tds Tds Tds m Cds Tds Tds Ads Gds m CEO Tes Aes m Ce (SEQ ID NO: 1914), wherein

[0519] A = adenine nucleobase,

[0520] m C=5-methylcytosine nucleobase,

[0521] G = guanine nucleobase,

[0522] T = thymine nucleobase,

[0523] e=2'-MOE modified sugar,

[0524] d = 2'-β-D-deoxyribose sugar,

[0525] s = phosphorothioate internucleoside linkage, and

[0526] o = phosphodiester internucleoside linkage.

[0527] In certain embodiments, Compound No. 1373021 is represented by the following chemical structure:

[0528]

[0529] (SEQ ID NO: 1914).

[0530] Structure 3. Compound No. 1373021

[0531] In certain embodiments, the sodium salt of Compound No. 1373021 is represented by the following chemical structure:

[0532]

[0533] (SEQ ID NO: 1914).

[0534] Structure 4. Sodium salt of compound number 1373021

[0535] 3. Compound No. 1373022

[0536] In certain embodiments, compound No. 1373022 is characterized as having the sequence (5' to 3') GCTTATTATTCATGTTCTCC (SEQ ID NO:1939), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0537] In certain embodiments, compound number 1373022 is represented by the following chemical symbols (5' to 3'): Ges m CeoTeo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CEO Tesm Ces m Ce (SEQ ID NO: 1939), wherein

[0538] A = adenine nucleobase,

[0539] m C=5-methylcytosine nucleobase,

[0540] G = guanine nucleobase,

[0541] T = thymine nucleobase,

[0542] e=2'-MOE modified sugar,

[0543] d = 2'-β-D-deoxyribose sugar,

[0544] s = phosphorothioate internucleoside linkage, and

[0545] o = phosphodiester internucleoside linkage.

[0546] In certain embodiments, Compound No. 1373022 is represented by the following chemical structure:

[0547]

[0548] (SEQ ID NO: 1939).

[0549] Structure 5. Compound No. 1373022

[0550] In certain embodiments, the sodium salt of Compound No. 1373022 is represented by the following chemical structure:

[0551]

[0552] (SEQ ID NO: 1939).

[0553] Structure 6. Sodium salt of compound number 1373022

[0554] 4. Compound No. 1373023

[0555] In certain embodiments, compound No. 1373023 is characterized as having the sequence (5' to 3') GTGTCATAATTTTCTTAGCT (SEQ ID NO:2302), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0556] In certain embodiments, compound number 1373023 is represented by the following chemical symbols (5' to 3'): Ges TeoGeo Teo m Ceo Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m Ces Te (SEQ ID NO: 2302), wherein

[0557] A = adenine nucleobase,

[0558] m C=5-methylcytosine nucleobase,

[0559] G = guanine nucleobase,

[0560] T = thymine nucleobase,

[0561] e=2'-MOE modified sugar,

[0562] d = 2'-β-D-deoxyribose sugar,

[0563] s = phosphorothioate internucleoside linkage, and

[0564] o = phosphodiester internucleoside linkage.

[0565] In certain embodiments, Compound No. 1373023 is represented by the following chemical structure:

[0566]

[0567] (SEQ ID NO:2302).

[0568] Structure 7. Compound No. 1373023

[0569] In certain embodiments, the sodium salt of Compound No. 1373023 is represented by the following chemical structure:

[0570]

[0571] (SEQ ID NO:2302).

[0572] Structure 8. Sodium salt of compound number 1373023

[0573] 5. Compound No. 1373057

[0574] In certain embodiments, compound No. 1373057 is characterized as having the sequence (5' to 3') GTCATAATTTTCTTAGCTA (SEQ ID NO:2750), wherein each of nucleosides 1-5 and 15-19 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-14 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, and 18 to 19 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0575] In certain embodiments, compound number 1373057 is represented by the following chemical symbols (5' to 3'): Ges Teo m Ceo Aeo Teo Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aes Geo m Ceo Tes Ae (SEQ ID NO: 2750), wherein

[0576] A = adenine nucleobase,

[0577] m C=5-methylcytosine nucleobase,

[0578] G = guanine nucleobase,

[0579] T = thymine nucleobase,

[0580] e=2'-MOE modified sugar,

[0581] d = 2'-β-D-deoxyribose sugar,

[0582] s = phosphorothioate internucleoside linkage, and

[0583] o = phosphodiester internucleoside linkage.

[0584] In certain embodiments, Compound No. 1373057 is represented by the following chemical structure:

[0585]

[0586] (SEQ ID NO:2750).

[0587] Structure 9. Compound No. 1373057

[0588] In certain embodiments, the sodium salt of Compound No. 1373057 is represented by the following chemical structure:

[0589]

[0590] (SEQ ID NO:2750).

[0591] Structure 10. Sodium salt of compound number 1373057

[0592] 6. Compound No. 1411016

[0593] In certain embodiments, compound No. 1411016 is characterized as having the sequence (5' to 3') ACGTCCATTTTCTGTGCTTT (SEQ ID NO:2739), wherein each of nucleosides 1-5 and 16-19 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0594] In certain embodiments, compound number 1411016 is represented by the following chemical symbols (5' to 3'): Aes m CEO Geo Teo m Ces m Cds Ads Tds Tds Tds Tds m Cds Tds Gds Tds Geo mCeo Tes Tes Te (SEQ ID NO: 2739), wherein

[0595] A = adenine nucleobase,

[0596] m C=5-methylcytosine nucleobase,

[0597] G = guanine nucleobase,

[0598] T = thymine nucleobase,

[0599] e=2'-MOE modified sugar,

[0600] d = 2'-β-D-deoxyribose sugar,

[0601] s = phosphorothioate internucleoside linkage, and

[0602] o = phosphodiester internucleoside linkage.

[0603] In certain embodiments, Compound No. 1411016 is represented by the following chemical structure:

[0604]

[0605] (SEQ ID NO:2739).

[0606] Structure 11. Compound No. 1411016

[0607] In certain embodiments, the sodium salt of Compound No. 1411016 is represented by the following chemical structure:

[0608]

[0609] (SEQ ID NO:2739).

[0610] Structure 12. Sodium salt of compound number 1411016

[0611] VIII. Certain comparative compositions

[0612] In certain embodiments, compound No. 169746 is a 5-10-5MOE spacer having the sequence (5' to 3')GTTATACTTTTACTGGCCTG (SEQ ID NO: 291), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein each of nucleosides 1-5 and 16-20 comprises a 2'-MOE modified sugar, which 2'-MOE modified sugar was previously described in WO2010 / 019270, which is incorporated herein by reference, and the compound is a comparative compound.

[0613] In certain embodiments, compound No. 169750 is a 5-10-5MOE spacer having the sequence (5' to 3')TGCATATTTCAAAGACCTGT (SEQ ID NO: 11), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein each of nucleosides 1-5 and 16-20 comprises a 2'-MOE modified sugar, which 2'-MOE modified sugar was previously described in WO2010 / 019270, which is incorporated herein by reference, and the compound is a comparative compound.

[0614] In certain embodiments, compound No. 169753 is a 5-10-5MOE spacer having the sequence (5' to 3')GCCACATATAGGGTCCTTTA (SEQ ID NO: 66), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein each of nucleosides 1-5 and 16-20 comprises a 2'-MOE modified sugar, which 2'-MOE modified sugar was previously described in WO2010 / 019270, which is incorporated herein by reference, and the compound is a comparative compound.

[0615] In certain embodiments, compound No. 169764 is a 5-10-5MOE spacer having the sequence (5' to 3')AGGGTCCTTTAAACATCTAA (SEQ ID NO: 450), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, and wherein each of nucleosides 1-5 and 16-20 comprises a 2'-MOE modified sugar, which 2'-MOE modified sugar was previously described in WO2010 / 019270, which is incorporated herein by reference, and the compound is a comparative compound.

[0616] Compound Nos. 169746, 169750, 169753 and 169764 were selected as comparative compounds because according to WO2010 / 019270 these compounds achieved >90% inhibition of PRNP RNA in human cell lines.

[0617] In certain embodiments, the compounds described herein are superior to the compounds described in WO2010 / 019270 in that they exhibit one or more improved properties, such as in vivo efficacy and tolerability.

[0618] For example, as described herein, certain compounds Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 are more potent in vivo than comparable compounds. For example, as provided in Example 5, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057 and Compound No. 1411016 achieved average expression levels (control %) of 27% (Tables 65 and 75), 25% (Tables 66 and 75), 30% (Tables 66 and 75), 18% (Tables 66 and 75), 25% (Tables 66 and 75) and 24% (Tables 71 and 72) in the spinal cord of transgenic mice, respectively, while comparative compounds Compound No. 169746, Compound No. 169750 and Compound No. 169764 achieved average expression levels (control %) of 52% (Table 62), 61% (Table 62) and 61% (Table 62) in the spinal cord of transgenic mice, respectively. Thus, certain compounds described herein were more potent than comparative compounds Compound No. 169746, Compound No. 169750, and Compound No. 169764 in this assay.

[0619] For example, as provided in Example 5, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057 and Compound No. 1411016 achieved average expression levels (control %) of 44% (Tables 65 and 75), 33% (Tables 66 and 75), 35% (Tables 66 and 75), 28% (Tables 66 and 75), 52% (Tables 66 and 75) and 36% (Tables 71 and 72) in the cortex of transgenic mice, respectively, while comparative compounds Compound No. 169746, Compound No. 169750 and Compound No. 169764 achieved average expression levels (control %) of 67% (Table 62), 73% (Table 62) and 77% (Table 62) in the cortex of transgenic mice, respectively. Thus, certain compounds described herein were more potent than the comparative compounds, Compound No. 169746, Compound No. 169750, and Compound No. 169764, in this assay.

[0620] For example, as described herein, at a dose of 700 μg, certain compounds Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 achieved an average 3-hour FOB score of 0 (Table 83), 2.5 (Table 84), 1.8 (Table 84), 0 (Table 84), 0 (Table 85), and 1.8 (Table 94) in mice, respectively. Compound No. 169753 achieved a 3-hour FOB score of 4.2 (Table 83) in mice. Therefore, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 described herein are more tolerated than the comparative compound Compound No. 169753 in this assay.

[0621] For example, as described herein, at a dose of 3 mg, certain compounds Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057 and Compound No. 1411016 achieved an average 3-hour FOB score of 1.0 (Table 107), 3.0 (Table 97), 1.5 (Table 97), 1.3 (Table 97), 0.8 (Table 98) and 3.3 (Table 108) in rats, respectively. Compound No. 169753 achieved a 3-hour FOB score of 5.5 (Table 106) in rats. Thus, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 described herein were better tolerated than the comparative compound Compound No. 169753 in this assay.

[0622] For example, as described herein, certain compounds, Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016, are more tolerated than the comparative compound No. 169753 in long-term studies in rats. For example, as provided in Example 8, no adverse events occurred during the course of the study for Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016. In contrast, each rat treated with Compound No. 169753 had adverse events by 5 weeks after treatment. Therefore, certain compounds described herein are more tolerated than the comparative compound Compound No. 169753 in this assay.

[0623] IX. Some hot spots

[0624] 1. Nucleobases 5635-5677 of SEQ ID NO: 2

[0625] In certain embodiments, the nucleobases 5635-5677 of SEQ ID NO:2 comprise hotspots. In certain embodiments, the modified oligonucleotides are complementary within the nucleobases 5635-5677 of SEQ ID NO:2. In certain embodiments, the length of the modified oligonucleotides is 16 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 17 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 19 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 20 nucleobases. In certain embodiments, the modified oligonucleotides are spacers. In certain embodiments, the modified oligonucleotides are 5-10-5, 6-10-4, 4-10-6, 5-9-5, 4-8-5 or 4-8-4 spacers. In certain embodiments, the spacers are MOE spacers. In certain embodiments, the spacers are mixed wing spacers. In certain embodiments, the mixed-wing spacer has a sugar motif in 5' to 3' order: eeeeeddddddddddkkeee, ee eeeeddddddddddkkee, eeeeedddddddddkkeee, eeeeddddddddkkeee, or eeeeddddddddkkee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the 5' to 3' order: soooossssssssssoooss, soooosssssssssssoos s, sooooosssssssssssoss, sooooosssssssssoos, soossssssssssooss, or soossss ssssssoos.

[0626] The nucleobase sequences of SEQ ID NO:530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793 and 2803-2806 are complementary within nucleobases 5635-5677 of SEQ ID NO:2.

[0627] Compounds 1238994, 1238995, 1238996, 1238997, 1238998, 1238999, 1239000, 1239001, 1239002, 1239003, 1270398, 1270399, 1270400, 1270564, 1270668, 1373021, 1373023, 1373032, 1373034, 1373050, 1373057, 1373063, 1373065, 1418398-1418403, 1418418-1418420, 1418423 and 1418425 are in SEQ ID NO:2 is complementary within nucleobases 5635-5677.

[0628] In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO: 2 achieve at least a 36% reduction in PRNP RNA in a standard in vitro cellular assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO: 2 achieve an average of 79% reduction in PRNP RNA in a standard in vitro cellular assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO: 2 achieve an average of 44% reduction in cortical PRNP RNA in a standard in vivo assay.

[0629] 2. Nucleobases 5791-5826 of SEQ ID NO: 2

[0630] In certain embodiments, the nucleobases 5791-5826 of SEQ ID NO:2 comprise hotspots. In certain embodiments, the modified oligonucleotides are complementary within the nucleobases 5791-5826 of SEQ ID NO:2. In certain embodiments, the length of the modified oligonucleotides is 16 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 17 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 18 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 19 nucleobases. In certain embodiments, the length of the modified oligonucleotides is 20 nucleobases. In certain embodiments, the modified oligonucleotides are spacers. In certain embodiments, the modified oligonucleotides are 5-10-5, 6-10-4, 4-10-6, 3-10-7, 7-10-3 or 4-8-5 spacers. In certain embodiments, the spacers are MOE spacers. In certain embodiments, the spacers are mixed wing spacers. In certain embodiments, the mixed-wing spacer has a sugar motif in the order of 5' to 3': eeeeeddddddddddkkeee or eeeeddddddddkkeee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the spacer comprises a 2'-substituted nucleoside in the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at position 2 of the gap (5' to 3'). In certain embodiments, the spacer has a sugar motif in the order of 5' to 3': eeeeedyddddddddeeeee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OM e sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order of 5' to 3': soossssssssssooooss, soooosssssssssssoooss, soooosssssssssssooss, sooooo ssssssssssoss, ssooooossssssssssos or soosssssssssooss.The nucleobase sequences of SEQ ID No: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2744, 2798-2801 are complementary within nucleobases 5791-5826 of SEQ ID NO: 2.

[0631] Compounds 1239051, 1239052, 1239053, 1239054, 1270415, 1270416, 1270417, 1270418, 1270419, 1270565, 1270596, 1355720, 1411004-1411007, 1411013-1411016, 1418412-1418415, 1418426, 1423120-1423123, and 1423126 are complementary within nucleobases 5791-5826 of SEQ ID NO:2.

[0632] In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve at least 55% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve an average of 77% reduction in PRNP RNA in a standard in vitro cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5791-5826 of SEQ ID NO:2 achieve an average of 52% reduction in cortical PRNP RNA in a standard in vivo assay.

[0633] 3. Nucleobases 14366-14410 of SEQ ID NO:2

[0634] In certain embodiments, the nucleobases 14366-14410 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary within the nucleobases 14366-14410 of SEQ ID NO:2. In certain embodiments, the length of the modified oligonucleotide is 17 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 18 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 19 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 20 nucleobases. In certain embodiments, the modified oligonucleotide is a spacer. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 5-9-5 or 4-8-5 spacer. In certain embodiments, the spacer is a MOE spacer. In certain embodiments, the spacer is a mixed wing spacer. In certain embodiments, the mixed-wing spacer has a sugar motif in 5' to 3' order: eeeeeddddddddddkkeee, eeeeeed dddddddddkkee, or eeeeddddddddkkeee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in a 5' to 3' order: soossssssssssooooss, soooosssssssssssoooss, soooosssssssssssooss, soooooss sssssssooss, soosssssssssooss.

[0635] The nucleobase sequences of SEQ ID NO:555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766 and 2794-2797 are complementary within nucleobases 14366-14410 of SEQ ID NO:2.

[0636] Compounds 1239543, 1239544, 1239545, 1239546, 1239547, 1239548, 1239549, 1239550, 1239551, 1239552, 1239553, 1239554, 1270516, 1270517, 1270518, 1270519, 1270520, 1270521, 1270571, 1270640, 1355714, 1355734, 1373022, 1373031, 1373051, 1373061, 1418404-1418407, 1418421 and 1418424 are in SEQ ID NO:2 is complementary within nucleobases 14366-14410.

[0637] In certain embodiments, modified oligonucleotides complementary within nucleobases 14366-14410 of SEQ ID NO: 2 achieve at least a 44% reduction in PRNP RNA in a standard in vitro cellular assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 14366-14410 of SEQ ID NO: 2 achieve an average of 62% reduction in PRNP RNA in a standard in vitro cellular assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 14366-14410 of SEQ ID NO: 2 achieve an average of 39% reduction in cortical PRNP RNA in a standard in vivo assay.

[0638] 4. Other hot spots

[0639] In certain embodiments, the ranges described in the table below include hotspots. Each hotspot begins at the nucleobase of SEQ ID NO: 1 identified in the "Starting Site SEQ ID NO: 1" column and ends at the nucleobase of SEQ ID NO: 1 identified in the "Stop Site SEQ ID NO: 1" column, and / or begins at the nucleobase of SEQ ID NO: 2 identified in the "Starting Site SEQ ID NO: 2" column and ends at the nucleobase of SEQ ID NO: 2 identified in the "Stop Site SEQ ID NO: 2" column. In certain embodiments, the modified oligonucleotide is complementary in any one of hotspots 1-21, as defined in the table below. In certain embodiments, the length of the modified oligonucleotide is 16 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 17 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 18 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 19 nucleobases. In certain embodiments, the length of the modified oligonucleotide is 20 nucleobases. In certain embodiments, the modified oligonucleotide is a spacer. In certain embodiments, the modified oligonucleotide is a 5-10-5, 6-10-4, 4-10-6, 3-10-7, 7-10-3, 5-9-5, 5-8-5, 4-8-4 or 5-8-4 spacer. In certain embodiments, the spacer is a MOE spacer. In certain embodiments, the spacer is a mixed wing spacer. In certain embodiments, the mixed wing spacer has a sugar motif in the order of 5' to 3': eeeeeddddddddddkkeee, eeeeeeddddddddddkkee, eeeeedddddddddkkeee, eeeeddddddddkkeee or eeeeddddddddkkee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the spacer comprises a 2'-substituted nucleoside in the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at position 2 of the gap (5' to 3'). In certain embodiments, the spacer has a sugar motif in the order of 5' to 3': eeeeedyddddd dddeeeee or eeeeedyddddddeeeee; wherein "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are connected by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in a 5' to 3' order: soossssssssssooooss, soooosssssssssssoooss, soooosssssssssssooss, soooosssssssssssooss, soooooosssssssssooss, or soosssssssssoos.

[0640] The nucleobase sequences of the compounds listed in the "Compound Number in Range" column in the following table are complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 within the specified hotspot region. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO: in Range" column in the following table are complementary to the target sequence, SEQ ID NO: 1 and / or SEQ ID NO: 2 within the specified hotspot region.

[0641] In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least a PRNP RNA "In vitro Min. % Red." (minimum % reduction relative to untreated control cells) in a standard cell assay in vitro, as indicated in the following table. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average PRNP RNA "In vitro Avg. % Red." (average % reduction relative to untreated control cells) in a standard cell assay in vitro, as indicated in the following table. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum PRNP RNA "In vitro Max. % Red." (maximum % reduction relative to untreated control cells) in a standard cell assay in vitro, as indicated in the following table.

[0642] Table 1 Hotspots of PRNP

[0643]

[0644]

[0645]

[0646]

[0647] Non-limiting disclosure and incorporated by reference

[0648] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0649] Although some compounds, compositions and methods described herein have been described with specificity according to certain embodiments, the following examples are only used to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. cited in this application is incorporated herein by reference in its entirety.

[0650] Although the sequence listing attached to the present application identifies each sequence as "RNA" or "DNA" as required, in fact, those sequences can be modified with any combination of chemical modifications. It will be readily understood by those skilled in the art that names such as "RNA" or "DNA" used to describe modified oligonucleotides are arbitrary in some cases. For example, an oligonucleotide comprising a nucleoside including a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH replaces one 2'-H of DNA), or as an RNA with a modified base (thymine (methylated uracil) replaces uracil of RNA). Therefore, the nucleic acid sequences provided herein (including but not limited to those in the sequence listing) are intended to cover nucleic acids containing any combination of natural or modified RNA and / or DNA, including (but not limited to) such nucleic acids with modified nucleobases. As a further example and not limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having that nucleobase sequence, whether modified or unmodified, including but not limited to such compounds comprising RNA bases, such as those having the sequence "AUCGAUCG" and those having some DNA bases and some RNA bases (e.g., "AUCGATCG"), as well as compounds having other modified nucleobases (e.g., "ATCGATCG"). m CGAUCG"), wherein m C indicates a cytosine base containing a methyl group at the 5-position.

[0651] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), α or β (e.g., for mutarotomers of sugars), or (D) or (L) (e.g., for amino acids, etc.). Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise indicated, compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Likewise, unless otherwise indicated, tautomeric forms of the compounds herein are also included. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0652] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive isotopes or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include each 1 All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions contemplated for the compounds herein include, but are not limited to: 2 H or 3 H Substitution 1 H, 13 C or 14 C Alternative 12 C, 15 N Substitution 14 N, 17 O or 18 O Substitution 16 O, and 33 S. 34 S. 35 S or 36 S Substitution 32 S. In certain embodiments, non-radioactive isotope substitution can impart novel properties to the oligomeric compound that are useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can render the compound suitable for research or diagnostic purposes, such as imaging.

[0653] The present invention also provides the following embodiments:

[0654] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PRNP nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

[0655] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases of any one of SEQ ID NOs: 27-2744.

[0656] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18 or 19 nucleobases of any one of SEQ ID NOs: 2745-2766.

[0657] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17 or 18 nucleobases of any one of SEQ ID NOs: 2767-2780.

[0658] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 nucleobases of any one of SEQ ID NOs: 2781-2802.

[0659] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15 or 16 nucleobases of any one of SEQ ID NOs: 2803-2806.

[0660] Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence:

[0661] an equal length portion of nucleobases 5,635-5,677 of SEQ ID NO:2;

[0662] An equal length portion of nucleobases 5,791-5,826 of SEQ ID NO:2; or

[0663] An equal length portion of nucleobases 14,366-14,410 of SEQ ID NO:2.

[0664] Embodiment 8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases selected from the following nucleobase sequences:

[0665] SEQ ID No: 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793;

[0666] SEQ ID No: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2798-2801; or

[0667] SEQ ID No:555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2 334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, 2794-2797.

[0668] Embodiment 9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence:

[0669] an equal length portion of nucleobases 4,902-4,929 of SEQ ID NO:2;

[0670] an equal length portion of nucleobases 5,000-5,026 of SEQ ID NO:2;

[0671] an equal length portion of nucleobases 5,073-5,100 of SEQ ID NO:2;

[0672] an equal length portion of nucleobases 5,515-5,559 of SEQ ID NO:2;

[0673] an equal length portion of nucleobases 5,595-5,632 of SEQ ID NO:2;

[0674] an equal length portion of nucleobases 5,666-5,690 of SEQ ID NO:2;

[0675] an equal length portion of nucleobases 5,857-5,881 of SEQ ID NO:2;

[0676] an equal length portion of nucleobases 9,352-9,377 of SEQ ID NO:2;

[0677] an equal length portion of nucleobases 11,331-11,358 of SEQ ID NO:2;

[0678] an equal length portion of nucleobases 16,292-16,328 of SEQ ID NO:2;

[0679] An equal length portion of nucleobases 17,120-17,151 of SEQ ID NO:2;

[0680] An equal length portion of nucleobases 17,211-17,241 of SEQ ID NO:2;

[0681] an equal length portion of nucleobases 17,281-17,331 of SEQ ID NO:2;

[0682] an equal length portion of nucleobases 17,410-17,445 of SEQ ID NO:2;

[0683] an equal length portion of nucleobases 17,601-17,641 of SEQ ID NO:2;

[0684] an equal length portion of nucleobases 17,635-17,670 of SEQ ID NO:2;

[0685] an equal length portion of nucleobases 17,663-17,712 of SEQ ID NO:2;

[0686] An equal length portion of nucleobases 17,753-17,781 of SEQ ID NO:2; or

[0687] An equal length portion of nucleobases 17,985-18,016 of SEQ ID NO:2.

[0688] Embodiment 10. The oligomeric compound of any one of embodiments 1 to 9, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 when measured over the entire nucleobase sequence of the modified oligonucleotide.

[0689] Embodiment 11. The oligomeric compound of any one of embodiments 1 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0690] Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0691] Embodiment 13. The oligomeric compound of embodiment 12, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0692] Embodiment 14. An oligomeric compound as described in embodiment 13, wherein the modified oligonucleotide comprises at least one modified nucleoside, and the at least one modified nucleoside comprises a bicyclic sugar portion, and the bicyclic sugar portion has a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2-; and -O-CH(CH3)-.

[0693] Embodiment 15. The oligomeric compound of any one of embodiments 11 to 14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

[0694] Embodiment 16. An oligomeric compound as described in embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside, wherein the at least one modified nucleoside comprises a non-bicyclic modified sugar moiety, and the non-bicyclic modified sugar moiety comprises a 2'-MOE modified sugar or a 2'-OMe modified sugar.

[0695] Embodiment 17. The oligomeric compound of any one of embodiments 11 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

[0696] Embodiment 18. The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from the group consisting of morpholino and PNA.

[0697] Embodiment 19. The oligomeric compound of any one of embodiments 1 to 12 or 15 to 18, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.

[0698] Embodiment 20. The oligomeric compound of any one of embodiments 1 to 19, wherein the modified oligonucleotide has a sugar motif comprising:

[0699] A 5' region consisting of 1 to 7 5' region nucleosides;

[0700] A central region consisting of 6-10 linked central region nucleosides; and

[0701] A 3' region consisting of 1 to 7 linked 3' region nucleosides; wherein

[0702] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0703] Embodiment 21. An oligomeric compound as described in Embodiment 20, wherein the modified oligonucleotide has

[0704] A 5' region consisting of 4 linked 5' region nucleosides;

[0705] A central region consisting of 8 linked central region nucleosides; and

[0706] A 3' region consisting of four linked 3' region nucleosides; wherein

[0707] Each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0708] Embodiment 22. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0709] A 5' region consisting of 4 linked 5' region nucleosides;

[0710] A central region consisting of 8 linked central region nucleosides; and

[0711] A 3' region consisting of five linked 3' region nucleosides; wherein

[0712] Each of the 5' region nucleosides comprises a 2'-MOE modified sugar, each of the 3' region nucleosides comprises a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0713] Embodiment 23. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0714] A 5' region consisting of five linked 5' region nucleosides;

[0715] A central region consisting of 8 linked central region nucleosides; and

[0716] A 3' region consisting of five linked 3' region nucleosides; wherein

[0717] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0718] Embodiment 24. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0719] A 5' region consisting of five linked 5' region nucleosides;

[0720] A central region consisting of 9 linked central region nucleosides; and

[0721] A 3' region consisting of five linked 3' region nucleosides; wherein

[0722] Each of the 3' region nucleosides comprises a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0723] Embodiment 25. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0724] A 5' region consisting of five linked 5' region nucleosides;

[0725] A central region consisting of 9 linked central region nucleosides; and

[0726] A 3' region consisting of five linked 3' region nucleosides; wherein

[0727] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0728] Embodiment 26. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0729] A 5' region consisting of 6 5' region nucleosides linked together;

[0730] A central region consisting of 10 linked central region nucleosides; and

[0731] A 3' region consisting of four linked 3' region nucleosides; wherein

[0732] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0733] Embodiment 27. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0734] A 5' region consisting of 6 5' region nucleosides linked together;

[0735] A central region consisting of 10 linked central region nucleosides; and

[0736] A 3' region consisting of four linked 3' region nucleosides; wherein

[0737] Each of the 3' region nucleosides comprises a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0738] Embodiment 28. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0739] A 5' region consisting of five linked 5' region nucleosides;

[0740] A central region consisting of 10 linked central region nucleosides; and

[0741] A 3' region consisting of five linked 3' region nucleosides; wherein

[0742] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0743] Embodiment 29. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0744] A 5' region consisting of five linked 5' region nucleosides;

[0745] A central region consisting of 10 linked central region nucleosides; and

[0746] A 3' region consisting of five linked 3' region nucleosides; wherein

[0747] Each of the 3' region nucleosides comprises a 2'-MOE modified sugar or a cEt modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0748] Embodiment 30. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has a sugar motif comprising:

[0749] A 5' region consisting of 4 linked 5' region nucleosides;

[0750] A central region consisting of 10 linked central region nucleosides; and

[0751] A 3' region consisting of 6 linked 3' region nucleosides; wherein

[0752] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0753] Embodiment 31. An oligomeric compound as described in embodiment 20, wherein the modified oligonucleotide has

[0754] A 5' region consisting of three linked 5' region nucleosides;

[0755] A central region consisting of 10 linked central region nucleosides; and

[0756] A 3' region consisting of 7 linked 3' region nucleosides; wherein

[0757] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0758] Embodiment 32. The oligomeric compound of embodiment 20, wherein the modified oligonucleotide has

[0759] A 5' region consisting of 7 5' region nucleosides linked together;

[0760] A central region consisting of 10 linked central region nucleosides; and

[0761] A 3' region consisting of three linked 3' region nucleosides; wherein

[0762] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar.

[0763] Embodiment 33. The oligomeric compound of any one of embodiments 20 to 32, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.

[0764] Embodiment 34. The oligomeric compound of any one of embodiments 1 to 19, wherein the modified oligonucleotide has a sugar motif comprising:

[0765] A 5' region consisting of 1 to 6 5' region nucleosides;

[0766] A central region consisting of 6-10 linked central region nucleosides; and

[0767] A 3' region consisting of 1 to 6 linked 3' region nucleosides; wherein

[0768] each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar,

[0769] And the central region has the following formula:

[0770] (Nd)(Nx)(Nd)n

[0771] wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside;

[0772] And n is 6 to 8.

[0773] Embodiment 35. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0774] A 5' region consisting of five linked 5' region nucleosides;

[0775] A central region consisting of 8 linked central region nucleosides; and

[0776] A 3' region consisting of five linked 3' region nucleosides; wherein

[0777] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar,

[0778] And the central region has the following formula:

[0779] (Nd)(Nx)(Nd)n

[0780] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0781] And n is 6.

[0782] Embodiment 36. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0783] A 5' region consisting of five linked 5' region nucleosides;

[0784] A central region consisting of 8 linked central region nucleosides; and

[0785] A 3' region consisting of five linked 3' region nucleosides; wherein

[0786] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar,

[0787] And the central region has the following formula:

[0788] (Nd)(Nx)(Nd)n

[0789] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0790] And n is 6.

[0791] Embodiment 37. The oligomeric compound of embodiment 34, wherein the modified oligonucleotide has a sugar motif comprising:

[0792] A 5' region consisting of five linked 5' region nucleosides;

[0793] A central region consisting of 10 linked central region nucleosides; and

[0794] A 3' region consisting of five linked 3' region nucleosides; wherein

[0795] Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar,

[0796] And the central region has the following formula:

[0797] (Nd)(Nx)(Nd)n

[0798] wherein Nx is a nucleoside comprising a 2'-OMe sugar and each Nd is a nucleoside comprising a 2'-deoxyribosyl sugar;

[0799] And n is 8.

[0800] Embodiment 38. The oligomeric compound of any one of embodiments 34 to 37, wherein the 2'-deoxyribosyl sugar is a 2'-β-D-deoxyribosyl sugar.

[0801] Embodiment 39. The oligomeric compound of any one of embodiments 1 to 38, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0802] Embodiment 40. The oligomeric compound of embodiment 39, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0803] Embodiment 41. The oligomeric compound of embodiment 39 or 40, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0804] Embodiment 42. The oligomeric compound of embodiment 39 or 41, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0805] Embodiment 43. The oligomeric compound of any one of embodiments 39, 41 or 42, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0806] Embodiment 44. The oligomeric compound of any one of embodiments 1 to 43, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0807] Embodiment 45. The oligomeric compound of embodiment 44, wherein the modified nucleobase is 5-methylcytosine.

[0808] Embodiment 46. The oligomeric compound of any one of embodiments 1 to 45, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

[0809] Embodiment 47. The oligomeric compound of any one of embodiments 1 to 21, 33, 34, or 38 to 46, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0810] Embodiment 48. The oligomeric compound of any one of embodiments 1 to 20, 22, 33, 34, or 38 to 46, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0811] Embodiment 49. The oligomeric compound of any one of embodiments 1 to 20, 23, 33, 34 to 36, or 38 to 46, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0812] Embodiment 50. The oligomeric compound of any one of embodiments 1 to 20, 24, 25, 33, 34, or 38 to 46, wherein the modified oligonucleotide consists of 19 linked nucleosides.

[0813] Embodiment 51. The oligomeric compound of any one of embodiments 1 to 20, 26 to 34, or 37 to 46, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0814] Embodiment 52. An oligomeric compound as described in embodiment 39, wherein the modified oligonucleotide has an internucleoside linkage motif soosssssssssssooooss, soooossssss ssssoooss, soooossssssssssssooss, sooooossssssssssssooss, sooooosssssssssssooss, ssooooosssssssssss sos, soooossssssssssooss, soosssssssssooss, soooos ssssssssooss or soossssssssssoos, wherein "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.

[0815] Embodiment 53. The oligomeric compound of any one of embodiments 1 to 52, consisting of the modified oligonucleotide.

[0816] Embodiment 54. The oligomeric compound of any one of embodiments 1 to 52, comprising a conjugate group comprising a conjugate portion and a conjugate linker.

[0817] Embodiment 55. An oligomeric compound as described in Embodiment 54, wherein the conjugate group comprises a GalNAc cluster, and the GalNAc cluster comprises 1-3 GalNAc ligands.

[0818] Embodiment 56. The oligomeric compound of embodiment 54 or 55, wherein the conjugate linker consists of a single bond.

[0819] Embodiment 57. The oligomeric compound of embodiment 54, wherein the conjugate linker is cleavable.

[0820] Embodiment 58. The oligomeric compound of embodiment 54, wherein the conjugate linker comprises 1-3 linker-nucleosides.

[0821] Embodiment 59. The oligomeric compound of any one of embodiments 54 to 58, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0822] Embodiment 60. The oligomeric compound of any one of embodiments 54 to 58, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0823] Embodiment 61. The oligomeric compound of any one of Embodiments 1 to 60, comprising a terminal group.

[0824] Embodiment 62. The oligomeric compound of any one of embodiments 1 to 61, wherein the oligomeric compound is a single-chain oligomeric compound.

[0825] Embodiment 63. The oligomeric compound of any one of embodiments 1 to 57 or 59 to 62, wherein the oligomeric compound does not comprise a linker-nucleoside.

[0826] Embodiment 64. An oligomeric duplex comprising the oligomeric compound of any one of embodiments 1 to 61 or 63.

[0827] Embodiment 65. An antisense compound comprising or consisting of the oligomeric compound of any one of embodiments 1 to 63 or the oligomeric duplex of embodiment 64.

[0828] Embodiment 66. A pharmaceutical composition comprising the oligomeric compound of any one of embodiments 1 to 63 or the oligomeric duplex of embodiment 64 and a pharmaceutically acceptable carrier or diluent.

[0829] Embodiment 67. A pharmaceutical composition as described in Embodiment 66, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline or artificial cerebrospinal fluid.

[0830] Embodiment 68. The pharmaceutical composition of Embodiment 67, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.

[0831] Embodiment 69. A method comprising administering to an animal the pharmaceutical composition of any one of embodiments 66 to 68.

[0832] Embodiment 70. A method of treating a disease associated with PRNPs, the method comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of Embodiments 66 to 68 to an individual suffering from or at risk of suffering from a disease associated with PRNPs; and thereby treating the disease associated with PRNPs.

[0833] Embodiment 71. A method of reducing PrP protein in the CSF of an individual having or at risk of developing a disease associated with PRNP, a therapeutically effective amount of a pharmaceutical composition according to any one of Embodiments 66 to 68; and thereby reducing PrP protein in the CSF.

[0834] Embodiment 72. A method according to embodiment 71, wherein the PrP protein is PrP C .

[0835] Embodiment 73. A method as described in embodiment 71, wherein the PrP protein is PrP Sc .

[0836] Embodiment 74. A method according to embodiment 71, wherein the PrP protein is PrP C PrP Sc both.

[0837] Embodiment 75. The method of embodiment 70 or 71, wherein the administration is by intrathecal administration.

[0838] Embodiment 76. The method of embodiment 70 or 71, wherein the disease associated with PRNP is a neurodegenerative disease.

[0839] Embodiment 77. A method as described in embodiment 76, wherein the neurodegenerative disease is selected from prion disease, Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease or Parkinson's disease.

[0840] Embodiment 78. The method of any one of Embodiments 70 to 77, wherein at least one symptom or marker of the neurodegenerative disease is improved.

[0841] Embodiment 79. The method of embodiment 78, wherein the symptom or sign is any of: spongiform changes in the brain, formation of abnormal protein aggregates, neuronal loss, markers of neuronal loss, rapidly progressive dementia, or death.

[0842] Embodiment 80. A method of reducing PRNP RNA in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 63, an oligomeric duplex according to embodiment 64, or an antisense compound according to embodiment 65; and thereby reducing PRNP RNA in the cell.

[0843] Embodiment 81. A method of reducing PrP protein in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 63, an oligomeric duplex according to embodiment 64, or an antisense compound according to embodiment 65; and thereby reducing PrP in the cell.

[0844] Embodiment 82. A method as described in embodiment 81, wherein the PrP protein is PrP C .

[0845] Embodiment 83. A method as described in embodiment 81, wherein the PrP protein is PrP Sc .

[0846] Embodiment 84. A method as described in embodiment 81, wherein the PrP protein is PrP C PrP Sc both.

[0847] Embodiment 85. The method of any one of Embodiments 80 to 84, wherein the cell is in an animal.

[0848] Embodiment 86. A modified oligonucleotide according to the following chemical structure:

[0849]

[0850] (SEQ ID NO: 1914), or a salt thereof.

[0851] Embodiment 87. A modified oligonucleotide according to the following chemical structure:

[0852]

[0853] (SEQ ID NO: 1914).

[0854] Embodiment 88. A modified oligonucleotide according to the following chemical structure:

[0855]

[0856] (SEQ ID NO: 1914), or a salt thereof.

[0857] Embodiment 89. A modified oligonucleotide according to the following chemical structure:

[0858]

[0859] (SEQ ID NO: 1914).

[0860] Embodiment 90. A modified oligonucleotide according to the following chemical structure:

[0861]

[0862] (SEQ ID NO: 1939), or a salt thereof.

[0863] Embodiment 91. A modified oligonucleotide according to the following chemical structure:

[0864]

[0865] (SEQ ID NO: 1939).

[0866] Embodiment 92. A modified oligonucleotide according to the following chemical structure:

[0867]

[0868] (SEQ ID NO: 2302), or a salt thereof.

[0869] Embodiment 93. A modified oligonucleotide according to the following chemical structure:

[0870]

[0871] (SEQ ID NO:2302).

[0872] Embodiment 94. A modified oligonucleotide according to the following chemical structure:

[0873]

[0874] (SEQ ID NO: 2750), or a salt thereof.

[0875] Embodiment 95. A modified oligonucleotide according to the following chemical structure:

[0876]

[0877] (SEQ ID NO:2750).

[0878] Embodiment 96. A modified oligonucleotide according to the following chemical structure:

[0879]

[0880] (SEQ ID NO: 2739), or a salt thereof.

[0881] Embodiment 97. A modified oligonucleotide according to the following chemical structure:

[0882]

[0883] (SEQ ID NO:2739).

[0884] Embodiment 98. The modified oligonucleotide of embodiment 86, 88, 90, 92, 94 or 96, wherein the modified oligonucleotide is a sodium salt of the chemical structure.

[0885] Embodiment 99. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo m Ceo Aeo Tes Ads Ads Tds Tds Tds Tds m Cds Tds Tds Ads Geo m CeoTes Aes m Ce (SEQ ID NO: 1914), wherein

[0886] A = adenine nucleobase,

[0887] m C=5-methylcytosine nucleobase,

[0888] G = guanine nucleobase,

[0889] T = thymine nucleobase,

[0890] e=2'-MOE modified sugar,

[0891] d = 2'-β-D-deoxyribose sugar,

[0892] s = phosphorothioate internucleoside linkage, and

[0893] o = phosphodiester internucleoside linkage.

[0894] Embodiment 100. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo m Ceo Aeo Teo Aeo Ads Tds Tds Tds Tds m Cds Tds Tds Ads Gds m CeoTes Aes m Ce (SEQ ID NO: 1914), wherein

[0895] A = adenine nucleobase,

[0896] m C=5-methylcytosine nucleobase,

[0897] G = guanine nucleobase,

[0898] T = thymine nucleobase,

[0899] e=2'-MOE modified sugar,

[0900] d = 2'-β-D-deoxyribose sugar,

[0901] s = phosphorothioate internucleoside linkage, and

[0902] o = phosphodiester internucleoside linkage.

[0903] Embodiment 101. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges m Ceo Teo Teo Aeo Teo Tds Ads Tds Tds m Cds Ads Tds Gds Tds Tds m CeoTes m Ces m Ce (SEQ ID NO: 1939), wherein

[0904] A = adenine nucleobase,

[0905] m C=5-methylcytosine nucleobase,

[0906] G = guanine nucleobase,

[0907] T = thymine nucleobase,

[0908] e=2'-MOE modified sugar,

[0909] d = 2'-β-D-deoxyribose sugar,

[0910] s = phosphorothioate internucleoside linkage, and

[0911] o = phosphodiester internucleoside linkage.

[0912] Embodiment 102. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo Geo Teo m Ceo Aeo Tds Ads Ads Tds Tds Tds Tds m Cds Tds Tds Aeo Ges m CesTe (SEQ ID NO: 2302), wherein

[0913] A = adenine nucleobase,

[0914] mC=5-methylcytosine nucleobase,

[0915] G = guanine nucleobase,

[0916] T = thymine nucleobase,

[0917] e=2'-MOE modified sugar,

[0918] d = 2'-β-D-deoxyribose sugar,

[0919] s = phosphorothioate internucleoside linkage, and

[0920] o = phosphodiester internucleoside linkage.

[0921] Embodiment 103. A compound comprising a modified oligonucleotide according to the following chemical symbols: Ges Teo mCeo Aeo Teo Ads Ads Tds Tds Tds Tds mCds Tds Tds Aes Geo mCeoTes Ae (SEQ ID NO: 2750), wherein,

[0922] A = adenine nucleobase,

[0923] mC=5-methylcytosine nucleobase,

[0924] G = guanine nucleobase,

[0925] T = thymine nucleobase,

[0926] e=2'-MOE modified sugar,

[0927] d = 2'-β-D-deoxyribose sugar,

[0928] s = phosphorothioate internucleoside linkage, and

[0929] o = phosphodiester internucleoside linkage.

[0930] Embodiment 104. A compound comprising a modified oligonucleotide according to the following chemical symbols: Aes mCeo Geo Teo mCes mCds Ads Tds Tds Tds Tds mCds Tds Gds Tds Geo mCeoTes Tes Te (SEQ ID NO: 2739), wherein,

[0931] A = adenine nucleobase,

[0932] mC=5-methylcytosine nucleobase,

[0933] G = guanine nucleobase,

[0934] T = thymine nucleobase,

[0935] e=2'-MOE modified sugar,

[0936] d = 2'-β-D-deoxyribose sugar,

[0937] s = phosphorothioate internucleoside linkage, and

[0938] o = phosphodiester internucleoside linkage.

[0939] Embodiment 105. The compound of any one of embodiments 99 to 104, comprising the modified oligonucleotide covalently linked to a conjugate group.

[0940] Embodiment 106. A chirally enriched population of modified oligonucleotides as described in any of embodiments 86 to 105, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0941] Embodiment 107. The chiral enriched population of Embodiment 106, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a (Sp) or (Rp) configuration.

[0942] Embodiment 108. The chirally enriched population of Embodiment 106, wherein the population is enriched for modified oligonucleotides having an independently selected specific stereochemical configuration at each phosphorothioate internucleoside linkage.

[0943] Embodiment 109. The chirally enriched population of Embodiment 106, wherein the population is enriched for modified oligonucleotides having the (Sp) or the (Rp) configuration at each phosphorothioate internucleoside linkage.

[0944] Embodiment 110. A chirally enriched population as described in Embodiment 106, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one specific phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0945] Embodiment 111. The chiral enriched population of Embodiment 106 or 108, wherein the population is enriched for modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the configuration of Sp, Sp, and Rp in the 5' to 3' direction.

[0946] Embodiment 112. A population of modified oligonucleotides as described in any one of embodiments 86 to 105, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0947] Embodiment 113. A pharmaceutical composition comprising a population of modified oligonucleotides as described in any one of Embodiments 106 to 112 and a pharmaceutically acceptable carrier or diluent.

[0948] Embodiment 114. A pharmaceutical composition as described in any one of embodiments 86 to 105 and a pharmaceutically acceptable diluent or carrier.

[0949] Embodiment 115. The pharmaceutical composition of embodiment 114, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0950] Embodiment 116. The pharmaceutical composition of Embodiment 115, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate-buffered saline or artificial cerebrospinal fluid.

[0951] Example

[0952] The following examples illustrate some embodiments of the present disclosure and are not restrictive. In addition, in the case of providing specific embodiments, the inventor has envisioned the general application of those specific embodiments. For example, the disclosure of the oligonucleotide with a specific motif provides reasonable support for other oligonucleotides with the same or similar motif. And, for example, unless otherwise stated, when specific high-affinity modification occurs at a specific position, other high-affinity modifications at the same position are considered suitable.

[0953] Example

[0954] Example 1: Effect of a single dose of modified oligonucleotides on human PRNP RNA in vitro

[0955] Modified oligonucleotides complementary to the human PRNP nucleic acid were synthesized and tested for their effects on PRNP RNA levels in vitro.

[0956] The modified oligonucleotides in the following table are 5-10-5MOE spacers containing mixed internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the central gap segment consists of 10 2'-β-D-deoxynucleosides and the 3' and 5' wings are each composed of 5 2'-MOE modified nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeddddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The internucleoside linkage motif of the spacer is (5' to 3'): soooosssssssssssooss; wherein "o" represents phosphodiester internucleoside linkages and "s" represents thiophosphate internucleoside linkages. Each cytosine residue is 5-methylcytosine.

[0957] "Start site" indicates the most 5'-nucleoside complementary to the spacer in the human gene sequence. "Termination site" indicates the most 3'-nucleoside complementary to the spacer in the human gene sequence. Most of the modified oligonucleotides listed in the following table are complementary to the human PRNP mRNA sequence (referred to herein as SEQ ID NO: 1 (GENBANK accession number: NM_000311.4)) and / or the human PRNP genomic sequence (referred to herein as SEQ ID NO: 2 (GENBANK accession number: NC_000020.11, truncated from nucleotides 4683001 to 4705000)). In addition, some modified oligonucleotides are complementary to human PRNP mRNA (referred to herein as SEQ ID NO: 3 (GENBANK accession number: NM_001080123.2)). "N / A" indicates that the modified oligonucleotide is not complementary to this particular gene sequence with 100% complementarity.

[0958] A-431 cells cultured at a density of 20,000 cells / well were treated with 4,000 nM of modified oligonucleotides by free uptake. After a treatment period of about 48 hours, total RNA was isolated from cells and PRNP RNA levels were measured by quantitative real-time RTPCR. Human PRNP primer probe set RTS42354 (leader sequence CCTCTCCTCACGACCGA, referred to herein as SEQ ID NO: 21; reverse sequence CCCAGTGTTCCATCCTC CA, referred to herein as SEQ ID NO: 22; probe sequence CCACAAAGAGAA CCAGCATCCAGCA, referred to herein as SEQ ID NO: 23) was used to measure RNA levels. In addition, mRNA levels regulated by the modified oligonucleotides described in Tables 12 and 13 herein were measured using another human PRNP primer probe set RTS42359 (leader sequence AG TGGAACAAGCCGAGTAAG, referred to herein as SEQ ID NO: 24; reverse sequence CCTCATAGTCACTGCCGAAAT, referred to herein as SEQ ID NO: 25; probe sequence AACCAACATGAAGCACATGGCTGG, referred to herein as SEQ ID NO: 26). PRNP RNA levels were normalized. The results are presented in the table below, normalized to PRNP RNA levels in untreated control cells (UTC). Values ​​marked with asterisks (*) are from oligonucleotides complementary to the amplicon region of the primer probe set. Other assays can be used to measure the effectiveness and efficacy of modified oligonucleotides complementary to the amplicon region.

[0959] Table 2

[0960] Reduction of PRNP RNA

[0961]

[0962]

[0963]

[0964]

[0965] Table 3

[0966] Reduction of PRNP RNA

[0967]

[0968]

[0969]

[0970]

[0971]

[0972] Table 4

[0973] Reduction of PRNP RNA

[0974]

[0975]

[0976]

[0977]

[0978] Table 5

[0979] Reduction of PRNP RNA

[0980]

[0981]

[0982]

[0983]

[0984]

[0985] Table 6

[0986] Reduction of PRNP RNA

[0987]

[0988]

[0989]

[0990]

[0991] Table 7

[0992] Reduction of PRNP RNA

[0993]

[0994]

[0995]

[0996]

[0997] Table 8

[0998] Reduction of PRNP RNA

[0999]

[1000]

[1001]

[1002]

[1003] Table 9

[1004] Reduction of PRNP RNA

[1005]

[1006]

[1007]

[1008]

[1009] Table 10

[1010] Reduction of PRNP RNA

[1011]

[1012]

[1013]

[1014]

[1015]

[1016] Table 11

[1017] Reduction of PRNP RNA

[1018]

[1019]

[1020]

[1021]

[1022] Table 12

[1023] Reduction of PRNP RNA

[1024]

[1025]

[1026]

[1027]

[1028] Table 13

[1029] Reduction of PRNP RNA

[1030]

[1031]

[1032]

[1033]

[1034] Table 14

[1035] Reduction of PRNP RNA

[1036]

[1037]

[1038]

[1039]

[1040] Table 15

[1041] Reduction of PRNP RNA

[1042]

[1043]

[1044]

[1045]

[1046] Table 16

[1047] Reduction of PRNP RNA

[1048]

[1049]

[1050]

[1051]

[1052] Table 17

[1053] Reduction of PRNP RNA

[1054]

[1055]

[1056]

[1057]

[1058] Table 18

[1059] Reduction of PRNP RNA

[1060]

[1061]

[1062]

[1063]

[1064] Table 19

[1065] Reduction of PRNP RNA

[1066]

[1067]

[1068]

[1069]

[1070] Table 20

[1071] Reduction of PRNP RNA

[1072]

[1073]

[1074]

[1075]

[1076] Table 21

[1077] Reduction of PRNP RNA

[1078]

[1079]

[1080]

[1081]

[1082] Table 22

[1083] Reduction of PRNP RNA

[1084]

[1085]

[1086]

[1087]

[1088]

[1089] Table 23

[1090] Reduction of PRNP RNA

[1091]

[1092]

[1093]

[1094]

[1095] Table 24

[1096] Reduction of PRNP RNA

[1097]

[1098]

[1099]

[1100]

[1101] Table 25

[1102] Reduction of PRNP RNA

[1103]

[1104]

[1105]

[1106]

[1107] Table 26

[1108] Reduction of PRNP RNA

[1109]

[1110]

[1111]

[1112]

[1113] Table 27

[1114] Reduction of PRNP RNA

[1115]

[1116]

[1117]

[1118]

[1119]

[1120] Table 28

[1121] Reduction of PRNP RNA

[1122]

[1123]

[1124]

[1125]

[1126] Table 29

[1127] Reduction of PRNP RNA

[1128]

[1129]

[1130]

[1131]

[1132] Table 30

[1133] Reduction of PRNP RNA

[1134]

[1135] Example 2: Effect of a single dose of 5-10-5MOE spacers containing mixed internucleoside linkages on human PRNP RNA in vitro

[1136] Modified oligonucleotides complementary to the human PRNP nucleic acid were synthesized and tested for their effects on PRNP RNA levels in vitro.

[1137] The modified oligonucleotides in the following table are 5-10-5MOE spacers containing mixed internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the central gap segment consists of 10 2'-β-D-deoxynucleosides and the 3' and 5' wings are each composed of 5 2'-MOE modified nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeddddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The internucleoside linkage motif of the spacer is (5' to 3'): soooosssssssssssooss; wherein "o" represents phosphodiester internucleoside linkages and "s" represents thiophosphate internucleoside linkages. Each cytosine residue is 5-methylcytosine.

[1138] "Start site" indicates the 5'-nucleoside in the human sequence that is complementary to the spacer. "Stop site" indicates the 3'-nucleoside in the human sequence that is complementary to the spacer. Each of the modified oligonucleotides listed in the following table is complementary to the human PRNP nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to this particular nucleic acid with 100% complementarity. As shown below, the modified oligonucleotides complementary to the nucleobase sequence of human PRNP reduce the amount of human PRNP RNA.

[1139] A-431 cells cultured at a density of 20,000 cells / well were treated with 4,000 nM of modified oligonucleotides by free uptake. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and PRNP RNA levels were measured by quantitative real-time RTPCR using primer probe set RTS42354 as described in Example 1. PRNP RNA levels were normalized. The results are presented in the table below, normalized to PRNP RNA levels in untreated control cells (UTC). Values ​​marked with asterisks (*) are from oligonucleotides complementary to the amplicon region of the primer probe set. Other assays can be used to measure the effectiveness and efficacy of modified oligonucleotides complementary to the amplicon region.

[1140] Table 31

[1141] Reduction of PRNP RNA

[1142]

[1143]

[1144]

[1145]

[1146] Table 32

[1147] Reduction of PRNP RNA

[1148]

[1149]

[1150]

[1151]

[1152]

[1153] Table 33

[1154] Reduction of PRNP RNA

[1155]

[1156]

[1157]

[1158]

[1159] Table 34

[1160] Reduction of PRNP RNA

[1161]

[1162]

[1163]

[1164]

[1165] Table 35

[1166] Reduction of PRNP RNA

[1167]

[1168]

[1169]

[1170]

[1171] Table 36

[1172] Reduction of PRNP RNA

[1173]

[1174]

[1175]

[1176]

[1177] Example 3: Effects of multiple doses of modified oligonucleotides on human PRNP RNA in vitro

[1178] The modified oligonucleotides selected from the above examples were tested at multiple doses in A-431 cells. Cells were plated at a density of 10,000 cells / well and treated with multiple doses of the modified oligonucleotides by free uptake, as specified in the table below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and PRNP RNA levels were measured by quantitative real-time PCR using primer probe set RTS42354, as described in Example 1. PRNP RNA levels were normalized. The results are presented in the table below as % PRNP RNA relative to untreated control cells (UTC). The half maximal inhibitory concentration (IC 50 ). IC was calculated using linear regression of the log / linear plot of the data in Excel. 50 The modified oligonucleotides marked with an asterisk (*) are complementary to the amplicon region of the primer probe set. Other assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[1179] Table 37

[1180] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1181]

[1182] Table 38

[1183] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1184]

[1185]

[1186] Table 39

[1187] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1188]

[1189]

[1190] Table 40

[1191] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1192]

[1193] Table 41

[1194] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1195]

[1196] Table 42

[1197] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1198]

[1199]

[1200] Table 43

[1201] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1202]

[1203] Table 44

[1204] Dose-dependent reduction of human PRNP RNA expression in A-431 cells

[1205]

[1206]

[1207] Example 4: Design and synthesis of MOE spacer-modified oligonucleotides complementary to human PRNP nucleic acid

[1208] Modified oligonucleotides complementary to human PRNP nucleic acid were designed and synthesized.

[1209] "Start site" indicates the most 5'-nucleoside complementary to the spacer in the human gene sequence. "Termination site" indicates the most 3'-nucleoside complementary to the spacer in the human gene sequence. Most of the modified oligonucleotides listed in the following table are complementary to the human PRNP mRNA sequence (referred to herein as SEQ ID NO: 1 (described above)) and / or the human PRNP genomic sequence (referred to herein as SEQ ID NO: 2 (described above)). In addition, some modified oligonucleotides are complementary to human PRNP mRNA (referred to herein as SEQ ID NO: 4 (ENSEMBL accession number: ENST00000424424.1)). "N / A" indicates that the modified oligonucleotide is not complementary to this particular gene sequence with 100% complementarity.

[1210] The modified oligonucleotides in the following table are 3-10-7MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 20 nucleosides in length and has a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 3 2'-MOE nucleosides, and a 3' wing segment consisting of 7 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeddddddddddeeeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soossssssssssooooss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1211] Table 45

[1212] 3-10-7MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1213]

[1214] The modified oligonucleotides in the following table are 4-10-6MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 20 nucleosides in length and has a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 4 2'-MOE nucleosides, and a 3' wing segment consisting of 6 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeddddddddddeeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soooossssssssssoooss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1215] Table 46

[1216] 4-10-6MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1217]

[1218]

[1219] The modified oligonucleotides in Tables 47 and 48 below are 5-10-5MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 20 nucleosides in length and has a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 5 2'-MOE nucleosides, and a 3' wing segment consisting of 5 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeddddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soooosssssssssssooss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1220] Table 47

[1221] 5-10-5MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1222]

[1223]

[1224]

[1225]

[1226] Table 48

[1227] 5-10-5MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1228]

[1229]

[1230] The modified oligonucleotides in the following table are 6-10-4MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 20 nucleosides in length and has a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 6 2'-MOE nucleosides, and a 3' wing segment consisting of 4 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeeddddddddddeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soooooossssssssssoss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1231] Table 49

[1232] 6-10-4MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1233]

[1234]

[1235] The modified oligonucleotides in the following table are 7-10-3MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 20 nucleosides in length and has a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 7 2'-MOE nucleosides, and a 3' wing segment consisting of 3 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeeeddddddddddeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): ssooooosssssssssos; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1236] Table 50

[1237] 7-10-3MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1238]

[1239] The modified oligonucleotides in the following table are 5-10-5MOE spacers containing 2'-OMe modified nucleosides at position 2 of the gap and mixed PO / PS internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the 5' wing segment is composed of 5 2'-MOE nucleosides and the 3' wing segment is composed of 5 2'-MOE nucleosides. The length of the gap is 10 nucleosides, and there are nucleosides of 2'-β-D-deoxyribose sugar moieties at positions 1, 3, 4, 5, 6, 7, 8, 9 and 10 (counting from the 5' end) of the gap and 2'-OMe nucleosides at position 2 (counting from the 5' end) of the gap. The sugar motif of the mixed altered spacer is (5' to 3'): eeeeedyddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "y" represents 2'-O-methylribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE sugar. The spacer has an internucleoside linkage motif (5' to 3'): soooossssssssssooss; wherein "s" represents phosphorothioate internucleoside linkage and "o" represents phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosine.

[1240] Table 51

[1241] 2'-OMe at position 2 with gap and mixed PO / PS internucleoside linkages

[1242] PRNP-complementary 5-10-5MOE spacer

[1243]

[1244] The modified oligonucleotides in the table below are 5-10-5 mixed MOE / cEt spacers containing mixed PO / PS internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the central gap segment consists of 10 2'-β-D-deoxynucleosides, the 5' wing segment consists of 5 2'-MOE nucleosides, and the 3' wing segment consists of 2 cEt nucleosides and 3 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeddddddddddkkeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE modified ribosyl sugar. The gapmer has an internucleoside linkage motif (5' to 3'): sooosssssssssssooss; wherein "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosine.

[1245] Table 52

[1246] 5-10-5MOE / cEt hybrid winged spacer with hybrid PO / PS internucleoside linkages complementary to human PRNP

[1247]

[1248]

[1249] The modified oligonucleotides in the table below are 6-10-4 mixed MOE / cEt spacers containing mixed PO / PS internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the central gap segment consists of 10 2'-β-D-deoxynucleosides, the 5' wing segment consists of 6 2'-MOE nucleosides, and the 3' wing segment consists of 2 cEt nucleosides and 2 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeeddddddddddkkee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE modified ribosyl sugar. The gapmer has an internucleoside linkage motif (5' to 3'): sooooosssssssssssoss; wherein "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosine.

[1250] Table 53

[1251] 6-10-4MOE / cEt hybrid winged spacer with hybrid PO / PS internucleoside linkages complementary to human PRNP

[1252]

[1253] The modified oligonucleotides in the following table are 6-10-4 mixed MOE spacers containing 2'-OMe modified nucleosides at position 2 of the gap and mixed PO / PS internucleoside linkages. The length of the spacer is 20 nucleosides, wherein the 5' wing segment is composed of 6 2'-MOE nucleosides, and the 3' wing segment is composed of 4 2'-MOE nucleosides. The length of the gap is 10 nucleosides, and there are nucleosides of 2'-β-D-deoxyribose sugar moieties at positions 1, 3, 4, 5, 6, 7, 8, 9 and 10 (counting from the 5' end) of the gap and 2'-OMe nucleosides at position 2 (counting from the 5' end) of the gap. The sugar motif of the mixed altered spacer is (5' to 3'): eeeeeedyddddddddeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "y" represents 2'-O-methylribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE sugar. The spacer has an internucleoside linkage motif (5' to 3'): sooooossssssssssoss; wherein "s" represents phosphorothioate internucleoside linkage and "o" represents phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosine.

[1254] Table 54

[1255] 6-10-4MOE spacer with 2'-OMe at position 2 of the gap and mixed PO / PS internucleoside linkages complementary to human PRNP

[1256]

[1257] The modified oligonucleotides in the following table are 5-9-5MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 19 nucleosides in length and has a central gap segment consisting of 9 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 5 2'-MOE nucleosides, and a 3' wing segment consisting of 5 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeedddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents ribosyl sugar modified by 2'-MOE. The spacer has an internucleoside linkage motif (5' to 3'): sooooosssssssssoos; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1258] Table 55

[1259] 5-9-5MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1260]

[1261] The modified oligonucleotides in the following table are 5-9-5MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 19 nucleosides in length and has a central gap segment consisting of 9 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 5 2'-MOE nucleosides, and a 3' wing segment consisting of 5 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeedddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): sooooosssssssssooss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1262] Table 56

[1263] 5-9-5MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1264]

[1265] The modified oligonucleotides in the following table are 5-9-5 mixed MOE / cEt spacers containing mixed PO / PS internucleoside linkages. The length of the spacer is 19 nucleosides, wherein the central gap segment consists of 9 2'-β-D-deoxynucleosides, the 5' wing segment consists of 5 2'-MOE nucleosides, and the 3' wing segment consists of 2 cEt nucleosides and 3 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeedddddddddkkeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): sooooossssssssssoos; wherein "s" represents phosphorothioate internucleoside linkages and "o" represents phosphodiester internucleoside linkages. All cytosine residues are 5-methylcytosine.

[1266] Table 57

[1267] 5-9-5MOE / cEt hybrid winged spacer with hybrid PO / PS internucleoside linkages complementary to human PRNP

[1268]

[1269] The modified oligonucleotides in the following table are 5-8-5MOE spacers containing mixed PO / PS internucleoside linkages. The spacer is 18 nucleosides in length and has a central gap segment consisting of 8 2'-β-D-deoxynucleosides, a 5' wing segment consisting of 5 2'-MOE nucleosides, and a 3' wing segment consisting of 5 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeeddddddddeeeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soooossssssssooss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.

[1270] Table 58

[1271] 5-8-5MOE spacer with mixed PO / PS internucleoside linkages complementary to human PRNP

[1272]

[1273] The modified oligonucleotide in the following table is a 5-8-5MOE spacer containing a 2'-OMe modified nucleoside at position 2 of a gap and a mixed PO / PS internucleoside linkage. The length of the spacer is 18 nucleosides, wherein the 5' wing segment is composed of 5 2'-MOE nucleosides and the 3' wing segment is composed of 5 2'-MOE nucleosides. The length of the gap is 8 nucleosides, and there is a nucleoside containing a 2'-β-D-deoxyribose sugar moiety at position 1, 3, 4, 5, 6, 7 and 8 (counted from the 5' end) of the gap and a 2'-OMe nucleoside at position 2 (counted from the 5' end) of the gap. The sugar motif of the spacer is (5' to 3'): eeeeedyddddddeeeee; wherein "d" represents 2'-β-D-deoxyribose sugar, "y" represents 2'-O-methyl ribose sugar, and "e" represents 2'-MOE sugar. The gapmer has an internucleoside linkage motif (5' to 3'): sooosssssssssooss; wherein "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosine.

[1274] Table 59

[1275] 5-8-5MOE spacer with 2'-OMe at position 2 of the gap and mixed PO / PS internucleoside linkages complementary to human PRNP

[1276]

[1277] The modified oligonucleotides in the table below are 4-8-5 mixed MOE / cEt spacers containing mixed PO / PS internucleoside linkages. The length of the spacer is 17 nucleosides, wherein the central gap segment consists of 8 2'-β-D-deoxynucleosides, the 5' wing segment consists of 4 2'-MOE nucleosides, and the 3' wing segment consists of 2 cEt nucleosides and 3 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeddddddddkkeee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soosssssssssooss; wherein "s" represents phosphorothioate internucleoside linkages and "o" represents phosphodiester internucleoside linkages. All cytosine residues are 5-methylcytosine.

[1278] Table 60

[1279] 4-8-5MOE / cEt hybrid winged spacer with hybrid PO / PS internucleoside linkages complementary to human PRNP

[1280]

[1281] The modified oligonucleotides in the table below are 4-8-4 mixed MOE / cEt spacers containing mixed PO / PS internucleoside linkages. The length of the spacer is 17 nucleosides, wherein the central gap segment consists of 8 2'-β-D-deoxynucleosides, the 5' wing segment consists of 4 2'-MOE nucleosides, and the 3' wing segment consists of 2 cEt nucleosides and 2 2'-MOE nucleosides. The sugar motif of the spacer is (5' to 3'): eeeeddddddddkkee; wherein "d" represents 2'-β-D-deoxyribosyl sugar, "k" represents cEt sugar, and "e" represents 2'-MOE modified ribosyl sugar. The spacer has an internucleoside linkage motif (5' to 3'): soosssssssssoos; wherein "s" represents phosphorothioate internucleoside linkages and "o" represents phosphodiester internucleoside linkages. All cytosine residues are 5-methylcytosine.

[1282] Table 61

[1283] 4-8-4MOE / cEt hybrid winged spacer with hybrid PO / PS internucleoside linkages complementary to human PRNP

[1284]

[1285] Example 5: Activity of modified oligonucleotides complementary to human PRNP in transgenic mice

[1286] The above-modified oligonucleotides were tested in a human PRNP knock-in mouse model. Humanization of the PRNP gene was performed by CRISPR / Cas-9-mediated gene editing, allowing the generation of a model with constitutive expression of the human PRNP gene. The targeting strategy was based on NCBI transcripts NM_011170.3 (mouse) and NM_000311.1 (human). The mouse genomic sequence from exon 1 (5' untranslated region, UTR) to exon 3 (3' UTR) was replaced with its human counterpart. A plasmid allowing the expression of Cas9 mRNA and a specific gRNA, a plasmid containing a puromycin resistance cassette, and a plasmid containing the homologous regions of the mouse PRNP gene and the replaced human regions were co-transfected into the Taconic Biosciences C57BL / 6N Tac ES cell line. Homologous recombinant clones were isolated using positive puromycin selection, and humanized alleles were obtained after Cas9-mediated gene editing. Strain C57BL / 6N Tac-Prnp<em5804_E-D05 (PRNP) was used in these experiments. Human PRNP RNA expression was found in the brain and spinal cord.

[1287] Treatment

[1288] The PRNP knock-in mice were divided into groups of 2-3 mice each. Each mouse received a single ICV infusion of 300 μg of the above-modified oligonucleotides. A group of 2-4 mice received PBS as a negative control in each study. Comparative compounds 169746, 169750, 169753, and 169764 described hereinabove and in WO2010 / 019270 were also tested in one study.

[1289] RNA analysis

[1290] Two weeks after treatment, mice were killed and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis using human primer probe set RTS42354 (described above) and primer probe set RTS42356 (leader sequence GGTGGTGTCTCACTCTTTCTTC, referred to herein as SEQ ID NO: 12; reverse sequence CCAGCATCTCAGGTCTACTCTA, referred to herein as SEQ ID NO: 13; probe sequence AATACCCTTGGCACTGATGGGC A, referred to herein as SEQ ID NO: 14) to measure the amount of PRNP RNA. Results are presented as human PRNP RNA % relative to PBS control normalized to mouse cyclophilin A. Each study is presented in a separate table. Cyclophilin A was amplified using primer probe set m_cy clo24 (leader sequence TCGCCGCTTGCTGCA, referred to herein as SEQ ID NO: 18; reverse sequence ATCGGCCGTGATGTCGA, referred to herein as SEQ ID NO: 19; probe sequence CCATGGTCAACCCCACCGTGTTC, referred to herein as SEQ ID NO: 20). In some cases, the RTPCR value of a certain sample was not defined and was marked as ND (undefined). The value marked with the (*) symbol indicates that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Other assays (including testing with a second primer probe set) can be used to measure the effectiveness and efficacy of the modified oligonucleotide complementary to the amplicon region.

[1291] As shown in the table below, treatment with modified oligonucleotides reduced PRNP RNA compared to PBS controls.

[1292] Table 62

[1293] Reduction of human PRNP RNA in knock-in mice

[1294]

[1295] Note that values ​​are based on single animals and are not averages.

[1296] Table 63

[1297] Reduction of human PRNP RNA in knock-in mice

[1298]

[1299]

[1300] Table 64

[1301] Reduction of human PRNP RNA in knock-in mice

[1302]

[1303]

[1304]

[1305] Table 65

[1306] Reduction of human PRNP RNA in knock-in mice

[1307]

[1308]

[1309] Note that values ​​are based on single animals and are not averages.

[1310] Table 66

[1311] Reduction of human PRNP RNA in knock-in mice

[1312]

[1313]

[1314]

[1315] Table 67

[1316] Reduction of human PRNP RNA in knock-in mice

[1317]

[1318]

[1319] Table 68

[1320] Reduction of human PRNP RNA in knock-in mice

[1321]

[1322] Table 69

[1323] Reduction of human PRNP RNA in knock-in mice

[1324]

[1325] Table 70

[1326] Reduction of human PRNP RNA in knock-in mice

[1327]

[1328] Table 71

[1329] Reduction of human PRNP RNA in knock-in mice

[1330]

[1331] Table 72

[1332] Reduction of human PRNP RNA in knock-in mice

[1333]

[1334]

[1335] Table 73

[1336] Reduction of human PRNP RNA in knock-in mice

[1337]

[1338] Table 74

[1339] Reduction of human PRNP RNA in knock-in mice

[1340]

[1341] Table 75

[1342] Reduction of human PRNP RNA in knock-in mice

[1343]

[1344]

[1345] Example 6: Efficacy of modified oligonucleotides complementary to human PRNP in knock-in mice

[1346] The modified oligonucleotides described above were tested in the human PRNP knock-in mouse model as described above.

[1347] treat

[1348] PRNP knock-in mice were divided into 3-4 mice per group. Each mouse received a single ICV bolus injection of the modified oligonucleotide at the indicated dosage in the table below. Each study had a group of 4 mice receiving PBS as a negative control. Each table below represents an independent study.

[1349] RNA analysis

[1350] Two weeks after treatment, mice were killed and RNA was extracted from cortical brain tissue, spinal cord and brain stem for RTPCR analysis using human primer probe set RTS42356 (described above) to measure the amount of PRNP RNA. In some cases, the level of PRNP RNA in hippocampus was also checked. The results are presented as normalized to the human PRNP RNA% relative to PBS control of mouse cyclophilin A. Cyclophilin A was amplified using primer probe set m_cyclo24 (described above). N / A indicator value is not available.

[1351] As shown in the table below, treatment with modified oligonucleotides reduced the amount of PRNP RNA compared to PBS controls.

[1352] Table 76

[1353] Reduction of human PRNP RNA in knock-in mice

[1354]

[1355] Table 77

[1356] Reduction of human PRNP RNA in knock-in mice

[1357]

[1358]

[1359] Table 78

[1360] Reduction of human PRNP RNA in knock-in mice

[1361]

[1362] Table 79

[1363] Reduction of human PRNP RNA in knock-in mice

[1364]

[1365] Table 80

[1366] Reduction of human PRNP RNA in knock-in mice

[1367]

[1368]

[1369] Example 7: Tolerability of modified oligonucleotides complementary to human PRNP in a 3-hour study in wild-type mice

[1370] The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate the tolerability of the oligonucleotides. Comparative compound No. 169753 described above and in WO2010 / 019270 was also tested in a study. Wild-type female C57 / Bl6 mice each received a single ICV dose of 700 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of 2-4 mice. Each study had a group of 4 mice receiving PBS as a negative control (identified in a separate table below). At 3 hours after injection, the mice were evaluated according to seven different criteria. These criteria are (1) the mice are alert, alert and responsive; (2) the mice stand or arch their backs without stimulation; (3) the mice show any movement without stimulation; (4) the mice show forward movement after being lifted; (5) the mice show any movement after being lifted; (6) the mice respond to tail clamping; (7) regular breathing. For each of the 7 criteria, a sub-score of 0 was given if the mouse met the criteria and a sub-score of 1 was given if the criteria were not met (functional observational battery score or FOB). After evaluating all 7 criteria, the scores for each mouse were summed and the total score for each animal was reported individually. The results are presented in the table below.

[1371] Table 81

[1372] Tolerability score at 700 μg dose in mice

[1373]

[1374]

[1375] Table 82

[1376] Tolerability score at 700 μg dose in mice

[1377]

[1378]

[1379] Table 83

[1380] Tolerability score at 700 μg dose in mice

[1381]

[1382] Table 84

[1383] Tolerability score at 700 μg dose in mice

[1384]

[1385]

[1386] Table 85

[1387] Tolerability score at 700 μg dose in mice

[1388]

[1389] Table 86

[1390] Tolerability score at 700 μg dose in mice

[1391]

[1392] Table 87

[1393] Tolerability score at 700 μg dose in mice

[1394]

[1395]

[1396] Table 88

[1397] Tolerability score at 700 μg dose in mice

[1398]

[1399]

[1400] Table 89

[1401] Tolerability score at 700 μg dose in mice

[1402]

[1403] Table 90

[1404] Tolerability score at 700 μg dose in mice

[1405]

[1406]

[1407] Table 91

[1408] Tolerability score at 700 μg dose in mice

[1409]

[1410] Table 92

[1411] Tolerability score at 700 μg dose in mice

[1412]

[1413]

[1414] Table 93

[1415] Tolerability score at 700 μg dose in mice

[1416]

[1417] Table 94

[1418] Tolerability score at 700 μg dose in mice

[1419]

[1420]

[1421] Example 8: Tolerance of a 3 mg dose of modified oligonucleotides complementary to human PRNP in rats 3 hours after administration

[1422] The modified oligonucleotides described above were tested in rats to evaluate the tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of the oligonucleotides listed in the table below. Comparative compound No. 169753 described herein above and in WO2010 / 019270 was also tested in one study. Each treatment group consisted of 2-4 rats. In each study, a group of 4 rats received PBS as a negative control (shown in a separate table below). At 3 hours after injection, each rat was evaluated for movement in 7 different parts of the body. The 7 body parts were (1) the tail of the rat; (2) the rear position of the rat; (3) the hind limbs of the rat; (4) the hind paws of the rat; (5) the front paws of the rat; (6) the front position of the rat; (7) the head of the rat. For each of the 7 different body parts, each rat was given a subscore of 0 if the body part was moving and a subscore of 1 if the body part was paralyzed (Functional Observation Composite Score or FOB). After each of the 7 body parts were evaluated, the subscores for each rat were summed and then the total score for each individual animal was reported. For example, if a rat's tail, head, and all other assessed body parts moved 3 hours after a 3 mg IT dose, its total score would be 0. If another rat did not move its tail 3 hours after a 3 mg IT dose, but all other assessed body parts were moving, it would receive a score of 1.

[1423] Table 95

[1424] Tolerability scores at 3 mg dose in rats

[1425]

[1426] Table 96

[1427] Tolerability scores at 3 mg dose in rats

[1428]

[1429]

[1430] Table 97

[1431] Tolerability scores at 3 mg dose in rats

[1432]

[1433] Table 98

[1434] Tolerability scores at 3 mg dose in rats

[1435]

[1436]

[1437] Table 99

[1438] Tolerability scores at 3 mg dose in rats

[1439]

[1440]

[1441] Table 100

[1442] Tolerability scores at 3 mg dose in rats

[1443]

[1444]

[1445] Table 101

[1446] Tolerability scores at 3 mg dose in rats

[1447]

[1448] Table 102

[1449] Tolerability scores at 3 mg dose in rats

[1450]

[1451]

[1452] Table 103

[1453] Tolerability scores at 3 mg dose in rats

[1454]

[1455] Table 104

[1456] Tolerability scores at 3 mg dose in rats

[1457]

[1458] Table 105

[1459] Tolerability scores at 3 mg dose in rats

[1460]

[1461] Table 106

[1462] Tolerability scores at 3 mg dose in rats

[1463]

[1464]

[1465] Table 107

[1466] Tolerability scores at 3 mg dose in rats

[1467]

[1468] Table 108

[1469] Tolerability scores at 3 mg dose in rats

[1470]

[1471]

[1472] Table 109

[1473] Tolerability scores at 3 mg dose in rats

[1474]

[1475] Table 110

[1476] Tolerability scores at 3 mg dose in rats

[1477]

[1478] Example 9: Tolerability of modified oligonucleotides complementary to human PRNP in long-term evaluation in rats

[1479] In a separate study run under the same conditions, the above modified oligonucleotides were tested in the Stuart-Dow rats to evaluate the long-term tolerance of the oligonucleotides. The comparative compound 169753 described above and in WO2010 / 019270 was also tested. Stuart-Dow rats each received a single intrathecal (IT) delivery dose of 3 mg oligonucleotides or PBS. Each animal was weighed and adverse events were assessed by a trained observer each week. Adverse events are defined as atypical neurological dysfunction in PBS-treated control animals, including, but not limited to: abnormal limb opening, abnormal gait, tremor, abnormal breathing, paralysis and spasm. The occurrence of adverse events is defined as the week after the administration of the first recorded dysfunction. The occurrence of adverse events is usually associated with stunted development, which is defined as insufficient weight gain / maintenance, similar to PBS-treated animals. Animals treated with Compound No. 1238994, Compound No. 1373021, Compound No. 1373022, Compound No. 1373023, Compound No. 1373057, and Compound No. 1411016 experienced no adverse events during the study. In contrast, every animal treated with Comparative Compound No. 169753 experienced one or more adverse events by five weeks post-treatment.

[1480] Example 10: Human clinical trials using modified oligonucleotides complementary to human PRNP

[1481] The safety, tolerability, pharmacokinetics, pharmacodynamics and efficacy of modified oligonucleotides complementary to human PRNP will be evaluated in a clinical trial setting. During this study, the safety of the patients will be closely monitored. Safety and tolerability assessments will include: physical examination, standard neurological evaluation, vital signs, ECG, AEs and concomitant medications, CSF safety labs, plasma lab tests and urinalysis.

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PRNP nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases of any one of SEQ ID NOs: 27-2744.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18 or 19 nucleobases of any one of SEQ ID NOs: 2745-2766.

4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17 or 18 nucleobases of any one of SEQ ID NOs: 2767-2780.

5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16 or 17 nucleobases of any one of SEQ ID NOs: 2781-2802.

6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15 or 16 nucleobases of any one of SEQ ID NOs: 2803-2806.

7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence: an equal length portion of nucleobases 5,635-5,677 of SEQ ID NO:2; An equal length portion of nucleobases 5,791-5,826 of SEQ ID NO:2; or An equal length portion of nucleobases 14,366-14,410 of SEQ ID NO:

2.

8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases selected from the group consisting of: SEQ ID No: 530, 607, 684, 761, 838, 915, 1914, 1992, 2069, 2146, 2237, 2301, 2302, 2536, 2640, 2750, 2759, 2760, 2764, 2788-2793; SEQ ID No: 1225, 1302, 1379, 1456, 2240, 2307, 2308, 2383, 2471, 2537, 2568, 2647, 2736-2739, 2798-2801; or SEQ ID No:555, 632, 709, 786, 863, 940, 1017, 1862, 1939, 2017, 2094, 2171, 2257, 2 334, 2407, 2408, 2488, 2508, 2543, 2612, 2659, 2677, 2757, 2766, 2794-2797.

9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein the portion is complementary to the sequence: an equal length portion of nucleobases 4,902-4,929 of SEQ ID NO:2; an equal length portion of nucleobases 5,000-5,026 of SEQ ID NO:2; an equal length portion of nucleobases 5,073-5,100 of SEQ ID NO:2; an equal length portion of nucleobases 5,515-5,559 of SEQ ID NO:2; an equal length portion of nucleobases 5,595-5,632 of SEQ ID NO:2; an equal length portion of nucleobases 5,666-5,690 of SEQ ID NO:2; an equal length portion of nucleobases 5,857-5,881 of SEQ ID NO:2; an equal length portion of nucleobases 9,352-9,377 of SEQ ID NO:2; an equal length portion of nucleobases 11,331-11,358 of SEQ ID NO:2; an equal length portion of nucleobases 16,292-16,328 of SEQ ID NO:2; An equal length portion of nucleobases 17,120-17,151 of SEQ ID NO:2; An equal length portion of nucleobases 17,211-17,241 of SEQ ID NO:2; an equal length portion of nucleobases 17,281-17,331 of SEQ ID NO:2; an equal length portion of nucleobases 17,410-17,445 of SEQ ID NO:2; an equal length portion of nucleobases 17,601-17,641 of SEQ ID NO:2; an equal length portion of nucleobases 17,635-17,670 of SEQ ID NO:2; an equal length portion of nucleobases 17,663-17,712 of SEQ ID NO:2; An equal length portion of nucleobases 17,753-17,781 of SEQ ID NO:2; or An equal length portion of nucleobases 17,985-18,016 of SEQ ID NO:

2.

10. The oligomeric compound of any one of claims 1 to 9, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 when measured over the entire nucleobase sequence of the modified oligonucleotide.

Images