Construction and application of anti-IgLON5 antibody-related encephalopathy active immune animal model

Abstract

The invention provides construction and application of an anti-IgLON5 antibody-related encephalopathy active immune animal model, and a construction method comprises the following steps: constructing a PKN-IgLON5 (1-313aa)-His (8 *) recombinant plasmid in vitro, and transfecting the plasmid into an HEK293S suspension cell to express protein; collecting cell supernate, purifying twice, and replacing a protein solvent with PBS (Phosphate Buffer Solution); an IgLON5 protein solution and a Freund's adjuvant are mixed to prepare an immune emulsion, the immune emulsion is subcutaneously injected into a mouse, the blood brain barrier is destroyed through pertussis toxin, a peripheral antibody is promoted to invade a central nervous system, and finally the active immune mouse model for resisting the IgLON5 antibody related encephalopathy is constructed. The invention discloses the construction method of the active immune animal model for the anti-IgLON5 antibody-related encephalopathy for the first time, the blank that no related research of the active immune model exists in the anti-IgLON5 antibody-related encephalopathy at present is filled, and the method is beneficial for reducing the full view of the antibody attacking the central nervous system and more comprehensively analyzing the phenotypes of cognition, sleep and dyskinesia.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, to the construction of an animal model, and in particular to the construction and application of an active immunization animal model of anti-IgLON5 antibody-related encephalopathy. Background Art

[0002] Anti-IgLON5 antibody-associated encephalopathy is a newly discovered rare autoimmune disease of the nervous system, characterized by the presence of anti-IgLON5 antibodies in the patient's serum and / or cerebrospinal fluid, and abnormalities in cognition, movement, sleep, gait, and medullary function. In addition, autopsy results of patients with anti-IgLON5 antibody-associated encephalopathy suggest the deposition of highly phosphorylated tau (p-tau) protein in the brain. Most patients show chronic onset and progression, and the clinical manifestations of different patients are highly heterogeneous. The neurodegenerative pathological manifestations represented by p-tau deposition increase the difficulty of diagnosis and treatment of the disease. At present, only a few hundred patients have been reported worldwide, and only dozens of cases in my country. As a newly discovered rare disease, the pathogenesis of anti-IgLON5 antibody-associated encephalopathy is still unclear, and the classic first-line and second-line immunotherapy has poor therapeutic effects on the disease. Animal models that can reproduce the clinical phenotypes of patients will help study the pathogenesis of the disease and provide more reliable directions and strategies for clinical diagnosis and treatment.

[0003] There are still few basic studies on anti-IgLON5 antibody-related encephalopathy reported so far, and most of them are in vitro cell experiments. Including: Sabater et al. (2016, 2020) used primary hippocampal neurons extracted from fetal mouse brains to study the mechanism of antibody action (Sabater L, Planagumà J, Dalmau J, Graus F. Cellular investigations with human antibodies associated with the anti-IgLON5 syndrome. J Neuroinflammation. 2016 Sep1; 13(1): 226.; Landa J, Gaig C, Plagumà J, Saiz A, Antonell A, Sanchez-Valle R, Dalmau J, Graus F, Sabater L. Effects of IgLON5 Antibodies on Neuronal Cytoskeleton: A Link between Autoimmunity and Neurodegeneration. Ann Neurol. 2020 Nov; 88(5): 1023-1027.); Ryding et al. (2021) used human neurons derived from induced pluripotent stem cells for research (Ryding M, Gamre M, Nissen MS, Nilsson AC, Okarmus J, Poulsen AAE, Meyer M, Blaabjerg M. Neurodegeneration Induced by Anti-IgLON5 Antibodies Studied in Induced Pluripotent Stem Cell-Derived Human Neurons. Cells. 2021Apr8; 10(4): 837.). Some studies used the mouse passive immunization model, that is, directly injecting the patient's serum antibodies into the specific brain area of ​​the mouse to induce the mouse to become ill.Including: Alvente et al. (2022) used an anti-IgLON5 antibody mouse model of patients with chronic lateral ventricular infusion to reproduce the phenotype of p-tau deposition in the patient brain reported clinically (Alvente S, Matteoli G, Molina-Porcel L, Landa J, Alba M, Bastianini S, Berteotti C, Graus F, Lo Martire V, Sabater L, Zoccoli G, Silvani A. Pilot Study of the Effects of Chronic Intracerebroventricular Infusion of Human Anti-IgLON5 Disease Antibodies in Mice. Cells. 2022 Mar 17; 11(6): 1024.).

[0004] The inventor team has established a passive immunization model of cognitive impairment in mice by injecting patient anti-IgLON5 antibodies into the lateral ventricle and hippocampus of mice (NiY, FengY, ShenD, ChenM, ZhuX, ZhouQ, GaoY, LiuJ, ZhangQ, ShenY, PengL, ZengZ, YinD, HuJ, ChenS. Anti-IgLON5 antibodies cause progressive behavior and neuropathological changes in mice. J Neuroinflammation. 2022Jun11; 19(1): 140.). In this model, patient-derived anti-IgLON5 antibodies can affect the synaptic homeostasis of neurons at the injection site for a long time, destroy cognitive-related neural circuits, and cause cognitive impairment and anxiety-like behavior in mice. In addition, the inventor team also established a passive immunization model of movement disorders by injecting the patient's anti-IgLON5 antibody into the substantia nigra of the mouse midbrain (Gao Y, Li H, Luo H, Ni Y, Feng Y, He L, Zhou Q, Hu J, Chen S. Purified Serum IgG from a Patient with Anti-IgLON5 Antibody Cause Long-Term Movement Disorders with Impaired Dopaminergic Pathways in Mice. Biomedicines. 2023 Sep 7; 11 (9): 2483.), which reveals that the patient's anti-IgLON5 antibody causes long-term damage to the substantia nigra-striatal dopaminergic system and can induce an increase in substantia nigra p-tau. The process of establishing the model animals mentioned above is the process of passive immunization of animals injected with human antibodies. Although the passive immunization method of injecting human antibodies into specific brain regions of animals provides a strategy for studying the "partial" pathogenicity of antibodies, it cannot provide a "full picture" of the occurrence of the disease, nor can it simulate the "whole process" of autoantibodies from generation to pathogenicity. In order to better explore the pathogenicity of autoantibodies, the establishment of an active immunization model is particularly important.

[0005] Freund's adjuvant is currently an adjuvant commonly used for active immunization of autoimmune diseases. Freund's adjuvant is mixed with "antigen" to prepare a "water-in-oil" emulsion. The mixed emulsion is injected subcutaneously into animals to slowly release the antigen, produce a highly stimulating and long-lasting antibody response, and ultimately induce the occurrence of autoimmune diseases. The mycobacteria in complete Freund's adjuvant can attract other cells such as macrophages to the injection site, thereby enhancing the immune response. Usually, complete Freund's adjuvant is used for initial injections, and incomplete Freund's adjuvant is used for booster injections. The method of preparing immune emulsion by mixing Freund's adjuvant with antigen has been used in the study of neuroimmunological diseases. For example, the experimental autoimmune encephalomyelitis (EAE) animal model of multiple sclerosis is induced by mixing Freund's adjuvant with allergens such as myelin basic protein (MBP) or myelin oligodendrocyte glycoprotein (MOG) polypeptide (Constantinescu CS, Farooqi N, O'Brien K, Gran B. Experimental autoimmune encephalomyelitis (EAE) as a model for multiple sclerosis (MS). Br J Pharmacol. 2011 Oct; 164 (4): 1079-106.); the active immunization model of myasthenia gravis is induced by mixing Freund's adjuvant with acetylcholine receptor (AChR) protein or peptide (Li Z, Li M, Wood K, Hettwer S, Muley SA, Shi FD, Liu Q, Ladha SS. Engineered agrin atte nuates the severity of experimental autoimmune myastheniagravis.MuscleNerve.2018May;57(5):814-820.). In the spectrum of autoimmune encephalitis, Wagnon et al. used the NMDAR receptor sequence containing N368 / G369 amino acids to immunize mice and constructed an anti-NMDAR encephalitis active immune animal model (Wagnon I, Hélie P, Bardou I, Regnauld C, Lesec L, Leprince J, Naveau M, Delaunay B, Toutirais O, Lemauff B, Etard O, Vivien D, Agin V, Macrez R, Maubert E, Docagne F. Autoimmune encephalitis mediated by B-cell response against N-methyl-d-aspartate receptor. Brain.2020Oct 1;143(10):2957-2972.).

[0006] In anti-IgLON5 antibody-related encephalopathy, there has been no relevant research on the active immunization model. Compared with more research on the pathophysiological changes in specific brain regions by passive immunization, active immunization can better restore the全貌 of antibody attack on the central nervous system. Therefore, on the basis of studying the damage of different brain regions by passive transfer of IgLON5 antibodies, it is very urgent and important to further establish an animal model of anti-IgLON5 antibody-related encephalopathy by active immunization for a more comprehensive phenotypic analysis (cognitive, sleep, and movement disorder phenotypes). Summary of the Invention

[0007] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide an active immunization animal model for anti-IgLON5 antibody-related encephalopathy. The second purpose is to provide the application of the active immunization animal model for anti-IgLON5 antibody-related encephalopathy, such as its application in mechanism research or drug screening.

[0008] The present invention mainly provides a method for in vitro synthesis and purification of IgLON5 protein, and provides the methods and steps for establishing an active immunization animal model for anti-IgLON5 antibody-related encephalopathy.

[0009] The research process of the present invention is outlined as follows: Combining the NCBI database and previous literature reports, the extracellular domain sequence of IgLON5 protein, namely IgLON5(1-313aa), was determined, and the gene sequence after removing the GPI anchor site (the 314th amino acid) was removed, so that the IgLON5 protein could be freely expressed in the cell supernatant for easy collection and purification. By homologous recombination technology, a recombinant plasmid PKN-IgLON5(1-313aa)-His(8×) was constructed in vitro, and the plasmid was transfected into HEK293S suspension cells to express the protein. The cell supernatant was collected, and the IgLON5(1-313aa) protein was purified using a HisCap Smart 6FF pre-packed column. Further, a AKTApurifyer 10 protein chromatography system was used for secondary purification, and the protein solvent was replaced with PBS. By WB( Figure 1 )、Coomassie staining( Figure 2 、 Figure 3 ), and mass spectrometry sequencing, the obtained protein solution was identified as IgLON5 protein solution.

[0010] The IgLON5 protein solution was mixed with Freund's adjuvant to prepare an immunization emulsion, which was subcutaneously injected into C57BL6 / J mice, and pertussis toxin was used to disrupt the blood-brain barrier to promote the invasion of peripheral antibodies into the central nervous system, and finally an active immunization mouse model for anti-IgLON5 antibody-related encephalopathy was constructed. Behavioral and peripheral serum antibody detection( Figure 4) The results showed that mice injected with IgLON5 immunogens showed gradually progressive anxiety-like behaviors, cognitive impairment and motor disorders, and high titers of serum anti-IgLON5 antibodies were detected 1 month and 3 months after injection. The above results show that mice injected with IgLON5 immunogens showed emotional, cognitive and motor abnormalities similar to those of patients, and anti-IgLON5 antibodies were present in the mouse serum. This model can be used to study the antibody production mechanism and pathogenic mechanism of anti-IgLON5 antibody-related encephalopathy.

[0011] Specifically, the steps for constructing the active immunization animal model of anti-IgLON5 antibody-related encephalopathy of the present invention are as follows:

[0012] A. Construction of PKN-IgLON5-His recombinant plasmid in vitro

[0013] Using the IgLON51-939 gene sequence (i.e., 1-313 amino acid sequence) in the pUC57-IgLON5 plasmid and the PKN-His plasmid sequence as templates, IgLON5 and PKN-vector primers were designed respectively, and the primer sequences are shown in SEQ ID NO.1-4; PCR amplification was then performed and product verification was performed;

[0014] IgLON5: forward primer GGGTACCCGGTTCTACCGGCATGCCCCCCCCTGCGCCCGG (SEQ ID NO.1),

[0015] Reverse primer TTAGTGGTGGTGGTGGTGGTGGTGGTGCTCCAGGGATCCTGGGCGC AG (SEQ IDNO.2);

[0016] PKN-vector: forward primer TGCGCCCAGGATCCCTGGAGCACCACCACCACCACCA CCACCACTAAG (SEQ ID NO.3),

[0017] Reverse primer: CGCAGGGGGGGGGCATGCCGGTAGAACCGGGTACCC (SEQ ID NO. 4).

[0018] The PKN-IgLON5-His recombinant plasmid was constructed by seamless DNA cloning and transformed into competent cells. A single clone was selected to extract the plasmid for restriction digestion and sequencing identification.

[0019] B. Synthesis and purification of IgLON5 recombinant protein

[0020] The PKN-IgLON5-His recombinant plasmid was extracted and diluted to 1 mg / ml with double distilled water. 250 ml HEK293S cells were transiently transfected with PEI (DNA: PEI = 1:6). 4 hours after transfection, 250 ml of culture medium was added, mixed and half of the volume was divided into another new culture bottle and placed in a shaker for culture. 24 hours after transfection, when the cell density was about 3×10 6 cells / ml, add 500μl of sodium valproate to each bottle; add 2.5ml of D-glucose to each bottle between 48-72 hours of transfection, and collect the supernatant for protein purification after 5-6 days of culture.

[0021] First, a 5 ml HisCap Smart 6FF prepacked column and a 30 kDa concentrator were used for the first purification and concentration, and then an AKTApurifyer 10 protein chromatography system was used for the second purification, and in this step, the protein solution solvent was replaced with PBS;

[0022] C. Construction of immune mouse model

[0023] Prepare a protein solution with a final concentration of 0.4 mg / ml of IgLON5 protein, add an equal volume of complete Freund's adjuvant or incomplete Freund's adjuvant and emulsify completely; at the same time, prepare a pertussis toxin solution with a final concentration of 2 μg / ml;

[0024] Immunization:

[0025] (1) On day 0, the first subcutaneous injection of protein and complete Freund's adjuvant immune emulsion was given to the mice at four points, including the shoulders and back of the lower limbs. At the same time, the first intraperitoneal injection of pertussis toxin was given.

[0026] (2) A second intraperitoneal injection of pertussis toxin was given on day 2;

[0027] (3) On day 14, the second subcutaneous injection of protein and incomplete Freund's adjuvant immune emulsion was given, with the injection site and dose being the same as before.

[0028] In a second aspect, the present invention provides an active immune animal model of anti-IgLON5 antibody-related encephalopathy, which is constructed using the method described above.

[0029] In a third aspect, the present invention provides the use of the above-mentioned anti-IgLON5 antibody-related encephalopathy active immunization animal model in the construction of an anti-IgLON5 antibody-related encephalopathy mechanism model or in the screening of therapeutic drugs. The results showed that mice injected with IgLON5 immunogens showed emotional, cognitive and motor abnormalities similar to those of patients, and anti-IgLON5 antibodies were present in the mouse serum. The model can be used to study the antibody production mechanism and pathogenic mechanism of anti-IgLON5 antibody-related encephalopathy.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The present invention discloses for the first time a method for constructing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, which fills the gap in the current research on active immunization models in anti-IgLON5 antibody-related encephalopathy, and helps to restore the full picture of antibody attack on the central nervous system. Therefore, on the basis of passive transfer of IgLON5 antibodies to study damage to different brain regions, further establishing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy is helpful for more comprehensive phenotypic analysis of cognition, sleep, movement disorders, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The results of IgLON5 expression detection in HEK293S suspension cell lysate and cell supernatant;

[0033] Figure 2 , Figure 3 The results of the staining test showing the purification efficiency of IgLON5 protein;

[0034] Figure 4 The modeling process and verification results of the anti-IgLON5 antibody-related encephalopathy mouse model are shown, including the modeling flow chart (A). Open field test: At one month (1M) and three months (3M), there was no statistical difference in the total moving distance between the two groups of mice (B). Elevated plus maze: At one month, IgLON5 1-313 The time mice spent in the open arms was reduced (n=10, p<0.05, t-test); at three months, there was no statistical difference between the two groups (C). 1-313 The correct rate of mice in the Y maze decreased (n=10 (Control) and 11 (IgLON5 1-313 ), p<0.001, t test); at three months, IgLON5 1-313 The correct rate of the mice in the Y-maze test decreased (n=10 and 11, p<0.01, t-test) (D). Rotarod test: At one month, there was no statistical difference between the two groups; at three months, IgLON5 1-313 The time mice stayed on the rotarod was reduced (n=10, p<0.05, t-test) (E). There was no statistical difference in body weight between the two groups of mice (F). 1-313 Mouse serum anti-IgLON5 antibody test was positive (1:600) (G). At three months, IgLON5 1-313Mouse serum anti-IgLON5 antibody detection was positive (1:100-1:300) (H). OFT: Open Field Test; EPM: Elevated Plus Maze; RT: Rotarod Test. Scale bar = 50 μm. DETAILED DESCRIPTION

[0035] The present invention will be described in detail below in conjunction with the embodiments and drawings, but the implementation of the present invention is not limited thereto.

[0036] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to literature methods. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to conventional conditions, or according to the conditions recommended by the manufacturer.

[0037] Example 1: Construction of an active immunization animal model of anti-IgLON5 antibody-related encephalopathy

[0038] 1. IgLON5 protein synthesis, purification and identification

[0039] 1. Construction of PKN-IgLON5(1-313aa)-His(8×) plasmid

[0040] (1) Using the IgLON5 (1-939 bp) sequence in the pUC57-IgLON5 plasmid and the PKN-His (8×) plasmid sequence as templates, IgLON5 primers were designed according to the instructions of the Clon Express II One Step Cloning Kit of Vazyme (Table 1).

[0041] (2) Using the IgLON5 (1-939 bp) sequence in the pUC57-IgLON5 plasmid and the PKN-His (8x) plasmid sequence as templates, PKN-vector primers were designed (Table 1).

[0042] Table 1 PCR primer sequences

[0043]

[0044] (2) PCR amplification of IgLON5 (1-939 bp) and PKN-His (8×) was performed using 2× PhantaMax Master Mix (Vazyme), wherein DMSO (1 / 40 total volume) was added to the IgLON5 amplification system.

[0045] (3) PCR amplification product electrophoresis verification and gel excision recovery: The products after PCR amplification were respectively detected by 1.5% (IgLON5 fragment) and 1% (PKN fragment) agarose gel electrophoresis (130V, 35min), and the band size was verified according to the marker. The band with the correct position was observed under ultraviolet light and gel excision was recovered (Vazyme gel recovery kit). The recovered DNA concentration was detected using Nanodrop instrument, and the concentration and time were recorded. The DNA was stored at -20°C.

[0046] (4) Seamless cloning and transformation: Use Vazyme's ClonExpressIIOneStepCloningKit kit for DNA seamless cloning to construct PKN-IgLON5(1-313aa)-His(8×) recombinant plasmid. Thaw DH5αCompetentE.coliStrain cells (50μl) on ice, take 5μl of the crude product and add it to 50μl of competent cells, flick the tube wall to mix (do not shake), and let it stand on ice for 30min. Heat shock in a 42℃ water bath for 90 seconds, and immediately cool on ice for 3-5 minutes. Add 900μl LB liquid culture medium (without antibiotics) and shake at 37℃ for 1 hour (speed 200-250rpm). Centrifuge the transformation product at 5000rpm for 5 minutes, discard the supernatant, and keep about 200μl of culture medium to resuspend the bacteria, drop it on a plate (with ampicillin resistance), and gently spread it on the plate with a sterile spreader. Incubate upside down in a 37°C incubator for 12-16 hours.

[0047] (5) Picking a single clone and amplifying by shaking: Add 3 ml of LB liquid culture medium and 3 μl (1:1000) of ampicillin to a 15 ml centrifuge tube. Use a sterilized pipette tip to pick a single clone and insert the pipette tip into the centrifuge tube. Shake the tube at 37°C for 12 hours.

[0048] (6) Plasmid extraction: Use the FastPurePlasmidMiniKit plasmid extraction kit from Vazyme.

[0049] (7) Enzyme digestion identification: Use 10x Fast Digest Green Buffer (Thermo Fisher Scientific) for enzyme digestion, and prepare the enzyme digestion reaction system (10 μl), as shown in Table 2:

[0050] Table 2 Enzyme digestion reaction system

[0051]

[0052] The reaction was carried out in a 37°C water bath for 30 min and detected by 1% agarose gel electrophoresis (130 V, 35 min).

[0053] (8) Plasmid sequencing: Select the plasmid solution with the correct enzyme digestion and have it sequenced and identified by Shanghai Saiheng Biotechnology Co., Ltd.

[0054] 2. IgLON5-His (8×) protein synthesis

[0055] (1) PKN-IgLON5(1-313aa)-His(8×) plasmid extraction: Use NucleoBondXtraMidi / Maxi from MACHEREY-NAGEL for plasmid extraction. Use Nanodrop instrument to measure the concentration. Use ddH 2 O Dilute the plasmid to 1 mg / ml. Store the plasmid at -20°C.

[0056] (2) Cell culture: HEK293S suspension cells were cultured using 293ProCD293M serum-free medium (Shanghai Yuanpei Biotechnology Co., Ltd., catalog number: H731KJ). 100 μl of cell suspension was taken for counting, and the required cell suspension was calculated based on the cell density so that the final inoculation concentration was 0.5×10 6 Cells / ml. Inoculate the cell suspension into a new 1L cell culture flask, add culture medium to 250ml, take 100μl of cell suspension for cell counting, and record the cell density and date of subculture. Place the culture flask at 37℃ and 8% CO 2 Culture in an incubator with a shaker speed of 120 rpm.

[0057] (3) Plasmid transient transfection: Two days before transfection, add 250 ml of culture medium to a 1 L cell shake flask and inoculate 293 suspension cells at a density of 0.8 × 10 6 cells / ml. Cell count was performed on the day of transfection, and the cell density was 3.5-4×10 6 cells / ml. Dilute 250μg plasmid with 2.5ml serum-free medium. Dilute 1500μg PEI (DNA:PEI=1:6) (Polyscience) with 2.5ml serum-free medium, immediately add 2.5ml plasmid to 2.5ml PEI and mix well, let stand at room temperature for 5 minutes. Add the plasmid / PEI mixture to the cell suspension and culture in a 37℃ shaker. 4 hours after transfection, add 250ml culture medium, mix well, and divide half of the volume into another new 1L culture bottle and culture in a shaker. 24 hours after transfection, wait until the cell density is about 3×10 6 When the cells / ml, 500 μl of sodium valproate (Sigma) was added to each bottle (final concentration was 3.8 mM). Between 48 and 72 hours of transfection, 2.5 ml of D-glucose (Sangon Biotech) was added to each bottle (final concentration was 4 g / L). After 5-6 days of culture, the supernatant was collected for protein purification.

[0058] 3. IgLON5-His (8x) protein purification

[0059] Protein purification was performed using 5 ml HisCap Smart 6FF prepacked columns from Tiandirenhe Biotechnology Co., Ltd. at 4 °C.

[0060] (1) Prepare solution A (balance solution) (1M Tris 7.425ml, 5M NaCl 15ml, 1M DTT 0.5ml, ddHO) 2 O) and solution B (elution buffer) (1M Tris 7.425ml, 5M sodium chloride 15ml, 1M DTT 0.5ml, 2M imidazole 62.5ml, ddH 2 O) were filtered through a 0.22 μm filter membrane and stored at 4°C for later use.

[0061] (2) Collect protein solution: Pour the cell suspension into a centrifuge bottle, centrifuge at 4000 rpm for 20 minutes at 4°C, collect the supernatant, and filter with a 0.45 μm filter membrane. The protein solution can be temporarily stored at -20°C, and needs to be frozen at -80°C for long-term storage.

[0062] (3) Connect the sample tube to the protein purifier, start the instrument, and press the fast forward button to fill the sample tube with liquid A and expel air bubbles.

[0063] (4) Connect the prepacked column to the sample tube, set the flow rate to 5 ml / min, and equilibrate with solution A for at least 10 minutes.

[0064] (5) After balancing, place the sample tube in the protein solution, set the flow rate to less than 5 ml / min, and start protein loading. Calculate the required time to prevent empty flow and bubble generation.

[0065] (6) Use 20mM imidazole (92% A solution + 8% B solution) to wash 50ml in a centrifuge tube. Use 100mM imidazole (60% A solution + 40% B solution) to elute the target protein 50ml in a centrifuge tube. Keep the washing solution and the elution solution on ice.

[0066] (7) Equilibrate the pre-packed column: After purification, use 15 ml of solution A, 25 ml of ddH 2 O, equilibrate the pre-packed column with 25 ml of 20% ethanol and store it at 4°C.

[0067] 4. IgLON5-His (8×) protein concentration

[0068] (1) Use a 30 kDa concentrator (Millipore) to concentrate. Add solution A to the concentrator and centrifuge at 3000 x g for 5 min to rinse the concentrator. Add an appropriate amount of protein eluent to the concentrator and centrifuge at 4°3000 x g for 20 min. Repeat until all the eluent is concentrated.

[0069] (2) Use Nanodrop instrument to detect the concentration of protein concentrate, divide into 1.5 ml EP tubes and mark them, freeze them in liquid nitrogen, and store them at -80°C.

[0070] 5. Protein purification efficiency detection

[0071] (1) Prepare 10% SDS-PAGE gel. Load the balance solution, eluate solution and wash solution samples and perform electrophoresis: 80V, 30min; 100V, 80min.

[0072] (2) Staining: After electrophoresis is complete, remove the gel. 2 Wash away the electrophoresis buffer with ddHO and discard. 2 O, boil in microwave for 1 minute, be careful to avoid gel curling due to too long heating time, shake slowly for 3-5 minutes, and discard. Add Coomassie brilliant blue dye, heat in microwave for 1 minute, shake slowly for 5-10 minutes, and recover the dye. ddH 2 Wash with ddHO and discard. 2 O, microwave for 1-2 minutes, shake slowly for 5-10 minutes, and discard. Add ddH 2 O, microwave for 1-2 minutes, wash on a slow shaker for 5-10 minutes.

[0073] 6. Secondary purification using AKTApurifyer 10 protein chromatography system

[0074] Purification was performed using an AKTApurifyer 10 protein chromatography system, and the protein solution solvent was replaced with PBS.

[0075] (1) Use PBS, ddH 2 O, NaOH, ddH 2O. Clean the superdex 20010 / 300 chromatography column and the loading pipe with PBS. Remove the loading needle, install a new syringe, rinse the loading needle and syringe with PBS, and empty the bubbles in the syringe. Draw up 1ml of PBS with the loading needle and push it into the loading loop for rinsing. The loading needle slowly draws up the protein solution (1ml each time, avoiding bubbles), and slowly and evenly pushes the solution into the loading loop. Set the instrument parameters: Select the superdex 20010 / 300 program, set the flow rate to 0.5ml / min, column pressure (MPa) 3.0, empty loop with 1.5ml, length of elution 1.3 column volumes. Start the program and start loading. Repeat the above steps until all protein solutions are purified.

[0076] (2) After purification, the protein solution was tested for concentration using Nanodrop. A small amount was taken for staining and the rest was dispensed into 1.5 ml EP tubes, marked, quickly frozen in liquid nitrogen, and stored at -80°C.

[0077] 7. Protein spectrum identification: Shanghai Zhongke New Life Biotechnology Co., Ltd. will conduct mass spectrometry identification on the final protein solution.

[0078] 8. Results Analysis

[0079] WB detection of IgLON5 expression in HEK293S suspension cell lysate and cell supernatant proved that PKN-IgLON5(1-313aa)-His(8×) was successfully transfected into HEK293S suspension cells and expressed IgLON5 protein in cell supernatant ( Figure 1 ).

[0080] The equilibrium solution, washing solution, elution solution and elution solution after secondary purification of IgLON5 protein were detected by Coomassie Brilliant Blue staining, which proved that IgLON5 protein was successfully purified ( Figure 2 , Figure 3 ).

[0081] Mass spectrometry sequencing identified and confirmed that the final protein solution contained IgLON5 protein.

[0082] 2. Construction of an active immunization mouse model of anti-IgLON5 antibody-related encephalopathy

[0083] 1. Preparation of immune emulsion

[0084] The immune emulsion was prepared in a clean bench and used immediately. The experimental group drug was prepared by mixing protein solution and Freund's adjuvant, and the control group drug was prepared by mixing PBS and Freund's adjuvant.

[0085] (1) Complete Freund's adjuvant (Chondrex, Catalog No.: 7023) or incomplete Freund's adjuvant (Sigma, Catalog No.: F5506), vortex thoroughly.

[0086] (2) Calculate the required protein solution dosage and PBS volume so that the final concentration of IgLON5 protein is 0.4 mg / ml. Take a 5 ml EP tube, add the corresponding dose of PBS and protein solution in sequence, and mix thoroughly.

[0087] (3) Connect two syringes with a three-way tube, remove the piston of one of the syringes, and add the diluted protein solution to the bottom of the syringe. Add an equal amount of Freund's adjuvant or incomplete Freund's adjuvant and mix well by pipetting. Install the piston, push the mixed solution into the other syringe, adjust the connection state of the three-way tube, and slowly empty the bubbles in the syringe.

[0088] (4) Bury the device in ice and push the two syringes back and forth to mix the emulsion, maintaining a frequency of about 100 times / minute for about 1 hour.

[0089] (5) Determine the end point of emulsion preparation: drop the emulsion on water and it will remain without spreading for 1 minute.

[0090] (6) Push the prepared emulsion into a 1 ml syringe, remove air bubbles, and place in ice for later use.

[0091] 2. Pertussis toxin preparation (List labs, item number: 180): Add 1 ml of ddH 2 O, making the final concentration 50μg / ml. Add 24ml PBS, making the final concentration 2μg / ml. Dispense into 1.5ml EP tubes and store at 4℃.

[0092] 3. Immunization

[0093] (1) The first subcutaneous injection of immune emulsion was performed on day 0, and the mice were injected subcutaneously at four points, including the shoulders and backs of the lower limbs. Each point was injected with 50 μl of immune emulsion, for a total of 200 μl / mouse. The immune emulsion injected into the experimental group was a mixture of protein solution (40 μg IgLON5 protein / mouse) and complete Freund's adjuvant; the immune emulsion injected into the control group was a mixture of PBS and complete Freund's adjuvant. In addition, both the experimental and control groups were intraperitoneally injected with 200 ng / mouse of pertussis toxin for the first time.

[0094] (2) On day 2 (48 hours later), 200 ng of pertussis toxin was injected intraperitoneally per mouse for the second time.

[0095] (3) The second subcutaneous injection of immune emulsion was performed on day 14, and the injection site was the same as before. The immune emulsion injected into the experimental group was a mixture of protein solution (40 μg IgLON5 protein / mouse) and incomplete Freund's adjuvant; the immune emulsion injected into the control group was a mixture of PBS and incomplete Freund's adjuvant.

[0096] Behavioral tests were performed at the first and third months after immunization of mice. Figure 4 A). The results showed that compared with the control group mice, the mice immunized with IgLON5 showed anxiety-like behavior and spatial cognitive impairment one month after the first injection, and still showed spatial cognitive impairment three months after the first injection, and had new movement disorders ( Figure 4 B-4E).

[0097] Serum antibody detection was performed at the first and third months after immunization of mice. Figure 4 G-4H). The results showed that compared with the control group mice, the IgLON5-immunized mice had higher titers of serum anti-IgLON5 antibodies one month (titer 1:600) and three months (titer 1:100-1:300) after the first injection.

[0098] The above results indicate that the present invention successfully synthesized and purified the IgLON5 (1-313aa) protein, and successfully established the world's first anti-IgLON5 antibody-related encephalopathy active immunization mouse model.

[0099] Compared with the passive immunity model, the active immunity model has the following advantages:

[0100] (1) The active immunization model showed a wider spectrum of symptoms, with mice injected with IgLON5 immunogens showing progressive behavioral abnormalities and persistent serum anti-IgLON5 antibodies. The symptoms exhibited by the active immunization mouse model covered the behavioral abnormalities of the two previously established passive immunization mouse models, including anxiety, cognitive and movement disorders.

[0101] (2) The active immunization model is more flexible in modeling scheme. Disease models of different conditions can be established by adjusting the single protein injection dose, injection number and interval time. For example, a large dose of immunogen can be given once to establish an acute or explosive disease model (such as the active immunization model of anti-NMDAR encephalitis), or a small dose of immunogen can be given multiple times to establish a chronic progressive disease model (such as the dose currently used in the present invention).

[0102] (3) In terms of operation and efficiency, the passive immunization model requires stereotactic injection of antibodies into the brain, which is difficult to operate, takes a long time to inject a single mouse, and has low efficiency. The active immunization model is mainly established through subcutaneous injection and intraperitoneal injection, which is easy to operate, more convenient and quick, and therefore suitable for large-scale modeling.

[0103] (4) In terms of mechanical damage to the mouse brain, the passive immunization model requires stereotactic injection, which causes serious damage to the mouse brain tissue and the possibility of local infection. The active immunization model can avoid this situation.

[0104] In summary, the active immunization model is superior to the passive immunization model in simulating the patient's disease process, presenting the full picture of the disease, modeling flexibility, operation difficulty and efficiency, and mechanical damage to the mouse brain. Therefore, it is conducive to the study of the disease mechanism of anti-IgLON5 antibody-related encephalopathy.

[0105] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A method for constructing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, characterized in that: The method comprises the following steps: constructing a PKN-IgLON5-His recombinant plasmid in vitro, transfecting the plasmid into HEK293S suspension cells to express the protein; collecting the cell supernatant, purifying it twice, and replacing the protein solvent with PBS; mixing the IgLON5 protein solution with Freund's adjuvant to prepare an immune emulsion, injecting it subcutaneously into mice, and destroying the blood-brain barrier by pertussis toxin to promote the invasion of peripheral antibodies into the central nervous system, and finally constructing an active immune mouse model of anti-IgLON5 antibody-related encephalopathy.

2. The construction method according to claim 1, characterized in that: The steps include: A. Construction of PKN-IgLON5-His recombinant plasmid in vitro Using the 1-939 nucleotide sequence of IgLON5 in the pUC57-IgLON5 plasmid and the PKN-His plasmid sequence as templates, IgLON5 and PKN-vector primers were designed respectively, and the primer sequences are shown in SEQ ID NOs. 1-4; Then PCR amplification was performed and product verification was performed; PKN-IgLON5-His recombinant plasmid was constructed by DNA seamless cloning, and competent cells were transformed. Single clones were selected to extract plasmids for restriction digestion and sequencing identification. Among them, nucleotides 1 to 939 correspond to the amino acid sequence of positions 1 to 313 of the extracellular segment of the IgLON5 protein; the His tag is an 8×His tag; B. Synthesis and purification of IgLON5 recombinant protein The PKN-IgLON5-His recombinant plasmid was extracted and diluted to 1 mg / ml with sterile double distilled water. A certain volume of HEK293S cells was transiently transfected with PEI at a ratio of DNA:PEI=1:

6. After 4 hours of transfection, the culture medium with the same volume of cells was added, mixed and half of the volume was divided into another new culture bottle and placed on a shaker for culture. After 24 hours of transfection, when the cell density was about 3×10 6 When the cell volume is 1 / 500, valproic acid sodium salt is added to each bottle; between 48-72 hours of transfection, 1 / 100 of the culture medium volume of D-glucose is added to each bottle, and the supernatant is collected for protein purification after 5-6 days of culture. First, HisCap Smart 6FF prepacked columns and 30 kDa concentrators were used for the first purification and concentration, and then AKTApurifyer 10 protein chromatography system was used for the second purification, and in this step, the protein solution solvent was replaced with PBS; C. Construction of immune mouse model Prepare IgLON5 protein solution with a final concentration of 0.4 mg / ml using PBS, add an equal volume of complete Freund's adjuvant or incomplete Freund's adjuvant, and mix thoroughly; prepare pertussis toxin solution with a final concentration of 2 μg / ml using PBS; Immunization: (1) On day 0, the first subcutaneous injection of the immune emulsion of protein and complete Freund's adjuvant was given to the mice at four points, namely, the shoulders and the back of the lower limbs. At the same time, the first intraperitoneal injection of pertussis toxin was given; (2) A second intraperitoneal injection of pertussis toxin was given on day 2; (3) On day 14, a second subcutaneous injection of immune emulsion containing protein and incomplete Freund's adjuvant was given, with the injection site and dose being the same as before.

3. The construction method according to claim 2, characterized in that: in, In step A, 2× PhantaMax Master Mix was used to perform PCR amplification of IgLON5 and PKN-His, wherein 1 / 40 of the total volume of DMSO was added to the IgLON5 amplification system; The method for transforming competent cells is as follows: thaw DH5αCompetent E.coli Strain cells on ice, take the recombinant product and add it to 10 times the volume of competent cells, flick the tube wall to mix, and let it stand on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds, and immediately put it on ice to cool for 3-5 minutes; add LB liquid culture medium without antibiotics with a volume of 180 times the volume of the recombinant product, and shake the bacteria at 37°C and 200-250rpm for 1 hour; centrifuge the transformation product at 5000rpm for 5 minutes, discard the supernatant, keep an appropriate amount of culture medium to resuspend the bacteria, drop it on the plate, and gently spread it on the ampicillin-resistant plate with a sterile spreader stick, and invert and culture it in a 37°C incubator for 12-16 hours; Ampicillin was used for monoclonal screening, and the correct plasmid solution was selected after plasmid extraction, restriction digestion and sequencing identification.

4. The construction method according to claim 2, characterized in that: in, In step B, the operation steps of plasmid transient transfection are as follows: two days before transfection, add 1 / 4 volume of culture medium to the cell shake flask and inoculate HEK293S suspension cells at a density of 0.8×10 6 cells / ml; cells were counted on the day of transfection, and the cell density was 3.5-4×10 6 cells / ml; dilute the plasmid with serum-free medium at a volume-to-mass ratio of 10:1, and dilute PEI with serum-free medium at a volume-to-mass ratio of 5:3; immediately add the plasmid to an equal volume of PEI and mix thoroughly, wherein plasmid DNA:PEI=1:6, and let stand at room temperature for 5 minutes; add the plasmid / PEI mixture to the cell suspension and culture in a 37°C shaker; 4 hours after transfection, add an equal volume of culture medium, mix well, and divide half of the volume into another new culture bottle, and culture in a shaker.

5. The construction method according to claim 2, Features: in, In step B, the steps for protein purification using HisCap Smart 6FF prepacked columns at 4°C are as follows: (1) Prepare Liquid A balance solution and Liquid B eluent, filter them with a 0.22 μm filter membrane and place them at 4°C for later use. The balance solution is composed of the following components in volume percentage: 5% 1M Tris buffer solution with a pH of 7.4, 3% 5M sodium chloride solution, 0.1% 1M DTT, and the balance is ddH2O. The eluent consisted of the following components in volume percentage: 5% 1M Tris buffered saline solution, pH 7.4, 3% 5M sodium chloride solution, 0.1% 1M DTT, 12.5% ​​2M imidazole, and the balance was ddH2O; (2) Collecting protein solution: Pour the cell suspension into a centrifuge bottle, centrifuge at 4°C, 4000 rpm for 20 minutes, collect the supernatant, and filter with a 0.45 μm filter membrane. The protein solution can be temporarily stored at -20°C, and needs to be frozen at -80°C for long-term storage; (3) Connect the sample tube to the peristaltic pump, start the instrument, press the fast forward button to fill the sample tube with liquid A, exhaust air bubbles, connect the pre-loaded column to the sample tube, and equilibrate the sample tube with equilibration solution for at least 10 minutes. After equilibration, set the flow rate to less than 5 ml / min, start protein loading and prevent empty flow and bubble generation; (4) Wash the impurities with 50 ml of 20 mM imidazole washing solution composed of 92% A solution + 8% B solution in a centrifuge tube, and elute the target protein with 50 ml of 100 mM imidazole elution solution composed of 60% A solution + 40% B solution in a centrifuge tube. Place the washing solution and elution solution on ice in advance; (5) Equilibration of pre-packed column: After purification, equilibrate the pre-packed column with 15 ml of solution A, 25 ml of ddH2O, and 25 ml of 20% ethanol in sequence and store at 4°C. The process of protein concentration is as follows: add balancing solution to the concentrator tube, centrifuge at 3000×g for 5 min to rinse the concentrator tube, add appropriate amount of protein elution solution to the concentrator tube, and centrifuge at 4° and 3000×g for 20 min; Repeat the above process until all the eluate is concentrated.

6. The construction method according to claim 2, characterized in that: in, In step B, the steps of the second purification using the AKTApurifyer 10 protein chromatography system are as follows: Use PBS, ddH2O, NaOH, ddH2O, and PBS to clean the superdex 20010 / 300 chromatography column and the sample tube in turn; remove the sample needle, install a new syringe, rinse the sample needle and syringe with PBS, and empty the bubbles in the syringe. The sample needle absorbs PBS and pushes it into the sample loop for rinsing; the sample needle slowly absorbs the protein solution, 1ml each time, avoids bubbles, and slowly and evenly pushes the solution into the sample loop, set the instrument parameters: select the superdex 20010 / 300 program, set the flow rate to 0.5ml / min, column pressure (MPa) 3.0, empty loop with 1.5ml, length ofelution 1.3 column volumes; start the program, start loading, and repeat the above steps until all protein solutions are purified; The concentration of the purified protein solution was tested using Nanodrop, a small amount was taken for staining test, and the rest was dispensed into 1.5 ml EP tubes, marked, quick-frozen in liquid nitrogen, and stored at -80°C.

7. The construction method according to claim 2, characterized in that: in, In step C, the criteria for judging whether the emulsification is complete are as follows: if the emulsion is dropped on water and does not spread within 1 minute, The injection dose of IgLON5 protein at each injection point of each mouse was 50 μl of emulsion, and each mouse was injected with a total of 40 μg of protein in 200 μl of emulsion; the injection dose of pertussis toxin was 200 ng / time for each mouse.

8. An active immunization animal model of anti-IgLON5 antibody-related encephalopathy, characterized in that: The method according to any one of claims 1 to 7 is used to construct the present invention.

9. Use of the anti-IgLON5 antibody-related encephalopathy active immunization animal model according to claim 8 in the construction of an anti-IgLON5 antibody-related encephalopathy mechanism model or in the screening of therapeutic drugs.

Images