Biological preparation for intervening or treating retinitis pigmentosa

Abstract

The invention discloses application of miRNA-142a-5p in preparation of a biological medicine for intervening or treating retinitis pigmentosa, and aims to solve the technical problem that retinitis pigmentosa lesion is difficult to intervene and treat. The research finds that miRNA-142a-5p directly participates in the process of retinitis pigmentosa of rd1 mice, the pathological process of the retinitis pigmentosa can be obviously delayed by down-regulating the expression of the miRNA-142a-5p, and an epigenetics potential precise treatment target is provided for reversing the retinitis pigmentosa; the scAAV virus vector for knocking down the miRNA-142a-5p is further constructed and is used for subretinal space injection, and the retinitis pigmentosa degeneration process can be obviously delayed.

Description

[0001] This application is a divisional application of a patent application entitled "Application of miRNA-142a-5p in the preparation of drugs for intervention or treatment of retinitis pigmentosa". The application date of the original application is July 22, 2022, and the application number is CN202210870461.9. Technical Field

[0002] The present invention relates to the field of biomedical technology, and in particular to a biological preparation for intervening or treating retinitis pigmentosa. Background Art

[0003] Vision is one of the main ways for humans to perceive external information, and the retina plays an important role in the process of visual formation. The retina is mainly composed of photoreceptor cells, bipolar cells, horizontal cells, ganglion cells, amacrine cells, Müller cells and microglia. Retinal photoreceptor cells convert light energy into changes in membrane potential, thereby changing the release of neurotransmitters (glutamate), and transmit signals to the visual center of the cerebral cortex through bipolar cells and ganglion cells to form vision. Müller cells and microglia mainly maintain the balance of retinal metabolism and homeostasis.

[0004] Retinitis pigmentosa (RP) is a hereditary blinding eye disease characterized by the loss of retinal photoreceptor cell function, with a global incidence of 1 / 3000. RP is mainly caused by gene mutations, and phosphodiesterase β subunit (PDE6B) is one of its mutated genes. Its inheritance mainly includes autosomal recessive inheritance, autosomal dominant inheritance and X-linked recessive inheritance. The first symptom of RP patients is night blindness, followed by loss of central vision and eventually blindness. Most patients develop the disease before the age of 40. Clinically, some children have congenital autosomal recessive inheritance, and the retinal cones and rods rapidly degenerate progressively at birth or within one year after birth, leading to severe loss of visual function. It is one of the main diseases causing congenital blindness in children, with an incidence of 10-20%. In typical RP, rods degenerate first, and the death of rods causes an increase in oxygen content in the retina, producing a large number of oxygen free radicals, which leads to oxidative damage to cones and eventually death, followed by death of retinal pigment epithelial cells. In addition, rods can produce rod-derived cone viability factor (RdCVF), and RdCVF-mediated glucose uptake stimulates aerobic glycolysis and promotes cone survival. After rods degenerate and die, the secretion of RdCVF in the retina decreases, accelerating the death of cones. Blindness caused by RP has caused a lot of confusion and pain in the lives of patients. So far, no effective treatment has been found clinically.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] miRNA is an endogenous non-coding small RNA molecule with a length of about 21-25 nt, which is encoded by the genome of higher eukaryotic organisms and is widely expressed in animals. Its expression is temporal and tissue-specific, and it can finely regulate gene expression. miRNA plays an important role in maintaining retinal cell homeostasis, cell function and survival. The biosynthesis of miRNA includes the following processes: ① Under the catalysis of RNA polymerase II, specific genes are transcribed to produce primary miRNA (Pri-miRNA), which is then processed into miRNA precursor (Pre-miRNA) by RNA polymerase III (Rnase III) Drosha and double-stranded RNA binding protein DGCR8; ② Then the transport protein Exportin5 transports pre-miRNA from the cytoplasm to the nucleus; ③ In the cytoplasm, Dicer enzyme further processes pre-miRNA to produce miRNA / miRNA* double-stranded molecules. The processed miRNA plays a role by participating in the synthesis of RNA-induced silencing complex (RISC). There are two ways to silence genes: one is to inhibit the translation of mRNA; the other is to degrade mRNA. MiRNA does not participate in protein coding, but is an important regulatory factor of gene expression. It plays a role in silencing gene expression by complementing target mRNA.

[0007] Through further research, the inventors found that miRNA-142a-5p can directly participate in the process of retinitis pigmentosa in rd1 mice. Knocking down the expression of miRNA-142a-5p significantly increased the thickness of the outer nuclear layer of the retina of rd1 mice, significantly delayed the pathological process of retinitis pigmentosa in rd1 mice, and increased the visual function of the retina. miRNA-142a-5p provides a potential epigenetic precision treatment target for reversing retinitis pigmentosa.

[0008] Therefore, the present application discloses the preparation of a drug for intervening or treating retinitis pigmentosa by using miRNA-142a-5p or a fragment thereof.

[0009] According to another aspect of the present disclosure, a biological agent for intervening or treating retinitis pigmentosa is provided, which is a vector capable of inhibiting or down-regulating the expression of miRNA-142a-5p.

[0010] In some embodiments of the present disclosure, the vector contains mmu-miRNA-142a-5p or a fragment thereof.

[0011] According to another aspect of the present disclosure, there is provided a method for preparing a carrier for treating retinitis pigmentosa, comprising the following steps:

[0012] (1) The mmu-miRNA-142a-5p fragment was cloned into the H13782pscAAV-U6-shRNA-CMV-EGFP-tWPA adeno-associated virus vector to form a recombinant expression plasmid;

[0013] (2) The recombinant expression plasmid and pAAV-RC are co-transfected into AAV-293 cells, and then AAV virus particles are recovered from the transfected AAV-293 cells, and then centrifuged, concentrated, and purified to obtain the target AAV virus particles; the packaged virus serum is AAV2 / 5.

[0014] In some embodiments of the present disclosure, the mmu-miRNA-142a-5p fragment sequence is: CAUAAAGUAGAAAGCACUACU.

[0015] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages:

[0016] 1. The study found that miRNA-142a-5p is directly involved in the pathological process of retinitis pigmentosa in rd1 mice. Downregulating the expression of miRNA-142a-5p in the retina can significantly delay the process of retinitis pigmentosa, which provides a potential epigenetic precision therapeutic target for reversing retinitis pigmentosa.

[0017] 2. Construct a scAAV viral vector that knocks down miRNA-142a-5p and injects it into the subretinal space to delay the pathological process of retinitis pigmentosa. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 HE staining of retinal tissue of rd1 mice of different ages and the corresponding normal control group according to an embodiment of the present application: A is a full-circumferential image of the retina of mice in the normal control group; B is the retinal layering mark and structural composition of mice in the normal control group; C is the retinal histological changes of rd1 mice of different ages (P8-P35) and the corresponding normal control group mice; D is the statistical analysis of the retinal ONL thickness of rd1 mice of different ages and the corresponding normal control group; rd1 mice of different ages and control group mice were compared with their previous age, two-way ANOVA, ****P<0.0001; the line segments indicate that the two groups were compared with each other, unpaired t-test, #P<0.05, ####P<0.0001.

[0019] Figure 2The electroretinogram test results of one embodiment of the present application: AB are the ERGs of dark-adapted 3.0 maximum mixed reactions and dark-adapted 0.01 reactions of rd1 mice and normal control mice at different time points; CD are the statistical graphs of a-wave and b-wave amplitudes of dark-adapted 3.0 maximum mixed reactions of rd1 mice and normal control mice at different time points; E is the statistical graph of b-wave amplitudes of dark-adapted 0.01 reactions of rd1 mice and normal control mice at different time points; mice in the rd1 mouse group and the normal control group at different ages were compared with their previous age, two-way ANOVA, ****P<0.0001; the line segments indicate comparison between the two groups, unpaired t-test, #P<0.05, ####P<0.0001.

[0020] Figure 3 The results of TUNEL apoptosis detection in rd1 mice according to one embodiment of the present application are as follows: TUNEL staining of retinal tissue sections of rd1 mice on days 6, 8, 10, 12, 14, 16, 18, and 21 after birth of rd1 mice. Blue is DAPI staining; green is TUNEL positive staining.

[0021] Figure 4 Visual behavior of an embodiment of the present application - behavioral changes in the black and white box: A is the trajectory diagram and density diagram of rd1 mice and normal control group mice at different time points after 10 minutes of observation in the black and white box; B is the percentage of the time each group of mice stayed in the white box and the time they stayed in the black box; C is a statistical diagram of the number of times each group of mice went from the black box to the white box; mice in the rd1 mouse group and the normal control group at different ages were compared with their previous age, two-way ANOVA, ****P<0.0001; the line segments represent the comparison between the two groups, unpaired t-test, #P<0.05, ####P<0.0001.

[0022] Figure 5 The visual behavioral changes in mice in the open field according to one embodiment of the present application: A is the trajectory diagram and density diagram of rd1 mice and normal control group mice at different time points after 10 minutes of observation in the open field; B is a statistical diagram of the total activity distance; C is a statistical diagram of the percentage of the time spent in the central area to the total activity time; D is a statistical diagram of the number of times the central area is entered; mice in the rd1 mouse group and the normal control group at different ages were compared with their previous age, two-way ANOVA, ****P<0.0001; the line segments indicate comparison between the two groups, unpaired t-test, #P<0.05, ####P<0.0001.

[0023] Figure 6 Pearson correlation analysis and cluster analysis between samples according to an embodiment of the present application: A is a sample clustering heat map; B is a Pearson correlation analysis between samples.

[0024] Figure 7This is a clustering analysis of differential miRNAs of an embodiment of the present application: A is a clustering heat map of differentially expressed miRNAs between the rd1 mouse group on the 9th day after birth and the normal control group; B is a clustering heat map of differentially expressed miRNAs between the rd1 mouse group on the 14th day after birth and the normal control group; C is a clustering heat map of differentially expressed miRNAs between the rd1 mouse group on the 14th day after birth and the rd1 mouse group on the 9th day after birth.

[0025] Figure 8 This is a GO enrichment bar graph of differential miRNA target genes in an embodiment of the present application: AB are GO enrichment bar graphs of target genes of upregulated miRNA and downregulated miRNA compared with the normal control group in rd1 mice on the 9th day after birth; CD are GO enrichment bar graphs of target genes of upregulated miRNA and downregulated miRNA compared with the normal control group in rd1 mice on the 14th day after birth; EF are GO enrichment bar graphs of target genes of upregulated miRNA and downregulated miRNA compared with rd1 mice on the 9th and 14th days after birth.

[0026] Fig. 9 These are potential target genes of the RP-related differential miRNAs according to one embodiment of the present application.

[0027] Fig.10 Verification of differential miRNAs associated with retinal degeneration in one embodiment of the present application: AC and DF are statistical graphs of the expression levels of miRNA-142a-5p, miRNA-653-5p and miRNA-25-3p in the retina of rd1 mice on the 14th and 9th days after birth, respectively; GI and JL are statistical graphs of the expression levels of miRNA-223-3p, miRNA-124-3p and miRNA-351-3p in the retina of rd1 mice on the 14th and 9th days after birth, respectively; compared with the normal control group (C57BL / 6J), unpaired t-test, *P<0.05, ***P<0.001.

[0028] Fig.11 This is a vector map of an embodiment of the present application: H13782 is the empty vector map before the insertion of the target gene, and Y18294 is the full vector map after the insertion of the target gene mmu-miRNA-142a-5p.

[0029] Fig.12 The adeno-associated virus transfection position confirmation and transfection status of one embodiment of the present application: A and C respectively show the expression of EGFP in the whole retina after subretinal injection; B and D respectively show the local expression site of EGFP in the outer nuclear layer of the retina.

[0030] Fig.13Knocking down miRNA-142a-5p in one embodiment of the present application delays the process of retinitis pigmentosa in rd1 mice: A shows that the outer nuclear layer of the retina of rd1 mice injected with miRNA-142a-5p viral vector in the subretinal cavity is significantly thickened; B shows the q-PCR test results showing that the expression level of miRNA-142a-5p is significantly reduced to 85% compared with the empty virus injection group; C-D shows that the ERG of the miRNA-142a-5p virus injection group is significantly different from that of the empty virus injection group. DETAILED DESCRIPTION

[0031] The main experimental materials and experimental methods involved in the following examples are:

[0032] 1. Experimental Animals

[0033] Animal handling and animal experiments were performed in accordance with the ARVO Statement on the Use of Animals in Ophthalmology and Vision Research, in accordance with the Regulations on the Administration of Experimental Animals in my country, and approved by the Life Science Animal Ethics Review Committee of Zhengzhou University (Ethics Number ZZUIRB2021-076). SPF-grade healthy adult C57BL / 6J mice were purchased from Beijing Weitong Lihua Company, and SPF-grade healthy adult rd1 mice were purchased from Jackson Laboratory in the United States. They were raised and bred in SPF-grade animal rooms with a temperature of 22-24°C, a humidity of 40-50%, and a 12-h light and 12-h dark cycle per day. In the following experimental studies, rd1 inbred mice of the same age and C57BL / 6J mice of the same age were used as normal controls for research, regardless of gender.

[0034] 2. Electroretinogram (ERG)

[0035] The mice in the experimental group and the control group that need to be tested are placed in a dark room and dark-adapted for at least 6 hours. The experimental mice are named. The mice are anesthetized by isoflurane, and a drop of compound tropicamide eye drops is dripped into each eye of the mouse to dilate the pupil. The mouth and nose of the mouse are facing the device with gaseous isoflurane for continuous anesthesia. The reference electrode is inserted into the cheek below the lower eyelid of the mouse, as close to the lower eyelid as possible. The ground electrode is inserted subcutaneously at the base of the mouse tail, and two ring electrodes are placed on the cornea of ​​the mouse. Sodium hyaluronate eye drops are dripped into both eyes to keep the cornea moist. The spherical flash stimulator is used for detection. The dark-adapted 3.0 maximum mixed response, dark-adapted 0.01 response, and dark-adapted 10.0 response are detected when the biowave is stable and there is no sine wave interference. Three mice were tested at each time point and statistical analysis was performed.

[0036] 3. Black and white box visual behavior detection

[0037] Mice hide during the day and come out at night, preferring dark and quiet environments. Although mice have a desire to explore, they are timid. In the black-and-white box test, the mice are placed in the white box with their eyes facing away from the small door in the middle of the black-and-white box. Mice with good vision will quickly find the door, enter the black box and stay in the black box for a long time. Mice with impaired vision are slow to find the door, so they stay in the white box for a long time. Since they cannot tell the difference between the white box and the black box, they will shuttle between the black and white boxes more often. Experimental steps:

[0038] (1) Place the mice in the operating room 2 hours in advance to acclimate them to the light environment. Keep the room quiet and the light stable during the experiment.

[0039] (2) Open Topscan Version 3.0 software, create a new experiment and set it up. Set up the observation area according to the black and white box experimental device area, set the experimental conditions, and observe the activities of mice in the black box and the activities in the white box as two events.

[0040] (3) Name the experimental animal and place the mouse in the center of the white box with its eyes facing away from the door in the middle of the black and white box. Quickly click the record button to start recording. The recording will automatically stop after ten minutes. During this process, statistical analysis of the mouse's behavioral indicators in the black and white box will be performed.

[0041] (4) Place the experimental mouse back into the cage, clean the black box and the white box with alcohol, click "Save As" and name the next experimental mouse, and repeat the experimental steps in (3) to perform the following experiment.

[0042] (5) Statistical analysis: GraphPad Prism 7.0 software was used for statistical analysis. All experimental data were presented as mean ± standard deviation (Mean ± SD), and Student's t-test or Two-way ANOVA were used to compare the differences between two or more groups of data (*P < 0.05; **P < 0.01; ***P < 0.001).

[0043] 4. Open field visual behavior detection

[0044] Mice prefer the edge area, which is safer, but the desire to explore drives them to explore the central area. Mice with good vision will quickly move from the middle to the edge area and stay in the edge area for a long time. Due to the desire to explore, mice enter the middle area more often, but each stay is very short. Mice with impaired vision will stay in the edge area after reaching the edge area, their desire to explore decreases, and their activity level decreases significantly. Experimental steps:

[0045] (1) Place the mice in the operating room 2 hours in advance to acclimate to the light environment. Keep the room quiet and the light stable during the experiment.

[0046] (2) Open Topscan Version 3.0 software, create a new experiment and set it up. Set the observation area according to the open field experimental apparatus, and observe the activities of the experimental mice in the central area, in the edge area, and in the entire open field apparatus as three events.

[0047] (3) Create a file and name the experimental mouse, place the mouse in the center of the open field, and quickly click the record button to record the video for ten minutes. During this process, the behavioral indicators of the experimental mouse in the open field device are recorded and analyzed.

[0048] (4) After the experiment is completed, put the experimental mouse back into the cage, clean the open field with alcohol, click "Save As" to create a file for the next experimental mouse, and repeat the experimental step (3) to conduct the following experiment.

[0049] (5) Statistical analysis: GraphPad Prism 7.0 software was used for statistical analysis. All experimental data were presented as mean ± standard deviation (Mean ± SD), and Student's t-test or Two-way ANOVA were used to compare the differences between two or more groups of data (*P < 0.05; **P < 0.01; ***P < 0.001).

[0050] 5. Paraffin Sectioning and HE Staining of Retinal Tissue

[0051] After isoflurane gas anesthesia was performed on the rd1 mice in the experimental group and the C57BL / 6J mice in the control group, the eyeballs were removed and placed in eyeball fixative for more than 48 hours. The cornea was cut off along the corneal scleral margin of the fixed eyeball, and the lens and iris were removed. The optic cup was placed in a fully automatic dehydrator and sequentially dehydrated with gradient alcohol, transparentized with xylene, immersed in paraffin, embedded, sliced ​​with 4 μm thickness, baked, dewaxed, HE stained, and sealed with neutral resin. The pictures were taken at a distance of 200 μm from the optic nerve under a 40x microscope, and the thickness of the retinal outer nuclear layer was measured using the instrument's own software, and statistical analysis was performed.

[0052] 6.TUNEL cell apoptosis detection

[0053] According to the above method, retinal tissue paraffin sections, wax immersion, embedding, 4 μm thick sections, baking, dewaxing and other steps were prepared. The excess water on the paraffin sections was absorbed with filter paper, and 20 μL of DNase-free proteinase K (20 μg / mL) was added to each retina, incubated at room temperature for 30 minutes, and washed with PBS 3 times, each time for 5 minutes. TdT enzyme and fluorescent marker solution were prepared into TUNEL working solution at a ratio of 1:9, and 20 μL was added to each retina. The treated paraffin sections were placed in a moisturizing box and incubated in an oven in the dark for 60 minutes, then washed with PBS 3 times, each time for 5 minutes. Each retinal tissue section was stained with 15 μL DAPI, incubated at room temperature in the dark for 3 minutes, washed with PBS 3 times, each time for 5 minutes, and then soaked in pure water for 10 minutes. The excess water in the paraffin sections was absorbed with filter paper, and a drop of anti-fluorescence quencher was added to each retinal tissue to seal the slide, nail polish was dripped on the four corners of the cover glass to fix it, and photographed under a fluorescence microscope.

[0054] 7. miRNA-Sequencing

[0055] (1) Collection of miRNA sequencing samples: After fully anesthetizing the mouse by placing a cotton ball soaked in isoflurane in the mouse nostrils, the mouse retina was quickly removed and placed in liquid nitrogen for quick freezing for 10 to 15 minutes, and then transferred to -80°C for temporary storage. After all samples were obtained, they were transported on dry ice to Wuhan Kangce Technology Co., Ltd. for sequencing.

[0056] (2) miRNA-seq library construction, sequencing and analysis: Total RNA of retinal samples was extracted, and the quality and integrity of the total RNA samples were evaluated. The RNA samples were reverse transcribed into cDNA fragments and amplified. At the same time, the molecules amplified by PCR from the reverse transcription products were all labeled with the same UMI (Unique Molecular Identifier) ​​to construct the miRNA-seq library and sequenced on an Illumina Hiseq X-10PE150.

[0057] (3) Bioinformatics analysis: Process the raw data to obtain optimized data and data quality control, perform correlation analysis between samples to detect the rationality of sample selection, and evaluate the reliability of expression patterns between samples. Perform distribution analysis of differentially expressed miRNAs; predict differential miRNA target genes; perform GO enrichment analysis; use the KEGG pathway database to find pathways with significant enrichment of differential miRNA target genes, and screen signal pathways related to the research purpose.

[0058] 8. Real-Time qPCR

[0059] (1) Extraction of total retinal RNA: Retinal samples from the experimental group and the control group were quickly obtained on ice, total retinal RNA was extracted, and the RNA concentration and purity were tested (A260 / A280 was within the range of 1.8-2.0, and A260 / A230 was within the range of 1.8-2.0). The RNA concentration was adjusted to 1 μg / μL.

[0060] (2) Synthesis of cDNA by stem-loop reverse transcription: Follow the instructions of the reverse transcription kit. The specific reaction system is shown in Table 1, and the specific reaction conditions are shown in Table 2.

[0061] Table 1 Stem-loop reverse transcription reaction system

[0062]

[0063] Table 2 Stem-loop reverse transcription reaction conditions

[0064]

[0065] The concentration and purity of cDNA were tested, requiring A260 / A280 to be within the range of 1.8 to 2.0 and A260 / A230 to be within the range of 1.8 to 2.0. The cDNA concentration was adjusted to 1 μg / μL and stored at -20°C until use.

[0066] (3) miRNA stem-loop primer design: The sequences are shown in Table 3. The universal downstream primer sequence is AGTGCAGGGTCCGAGGTATT.

[0067] Table 3 Stem-loop primer sequences

[0068]

[0069] (4) Real-Time qPCR: Select specific reaction conditions according to the Tm value of specific miRNA primers, set up the reaction system (see Table 4), perform detection on the machine, and use U6 as the internal reference to calculate the 2-ΔΔCt value.

[0070] Table 4 Real-Time qPCR reaction system

[0071]

[0072] 9. Preparation of Adeno-associated Virus Vector

[0073] The fragment mmu-miRNA-142a-5p (sequence: CAUAAAGUAGAAAGCACUACU) carrying the miRNA-142a-5p blocking sequence was cloned into the H13782 pscAAV-U6-shRNA-CMV-EGFP-tWPA adeno-associated virus vector to form the recombinant expression vector pscAAV-U6-Decoy(mmu-miRNA-142a-5p)-CMV-EGFP-tWPA. The control virus vector was pcscAAV-tCMV-EGFP-tWPA.

[0074] 10. Subretinal Injection

[0075] (1) Anesthesia: The experimental mice were born on the 8th day and were relatively young. Gas anesthesia was used. A cotton ball soaked in isoflurane was placed in the nostrils of the mice for about 1 minute. The anesthesia time should not be too long to avoid the death of the mice. After the mice were anesthetized, compound tropicamide eye drops were instilled into the experimental eyes to dilate the pupils, and then the topical anesthetic proparacaine hydrochloride was instilled for eye anesthesia.

[0076] (2) Preparation before operation: Turn on the mouse heating pad and when the temperature is maintained at 37°C, place the deeply anesthetized mouse on the heating pad. Adjust the microscope to the optimal observation state.

[0077] (3) Preparation for virus injection: Thaw the virus solution in advance and place it on ice. Use the Hamilton microinjector to draw pure water 50 times to clean the internal cavity. Use one Hamilton microinjector to draw 1 μL of the target virus solution for later use, and use the other Hamilton microinjector to draw 1 μL of the control virus solution for later use.

[0078] (4) Operation steps: Use ophthalmic forceps to clamp the superior temporal conjunctiva with your left hand to fix the eyeball, and use the needle of an insulin syringe to pierce the sclera outside the corneoscleral limbus with your right hand. Then use a Hamilton microinjector with virus solution to enter the subretinal cavity along the puncture hole, and slowly and evenly inject the virus solution. After the virus solution is pushed out, stay for tens of seconds, then slowly pull out the needle. The scleral incision closes automatically, and observe that there is no reflux of the virus solution. Apply tobramycin dexamethasone eye ointment to the wound to prevent infection. Put the pups in the incubator promptly and observe them carefully. After they wake up, put them back to the mother.

[0079] A total of 8 rd1 mice at day 8 after birth were injected with 1 μL of pscAAV-U6-Decoy(mmu-miRNA-142a-5p)-CMV-EGFP-tWPA virus into the subretinal space of the right eye, and the left eye served as a control and was injected with 1 μL of pcscAAV-tCMV-EGFP-tWPA virus into the subretinal space.

[0080] 11. Preparation of frozen sections and DAPI staining:

[0081] The following experiments were performed on day 10 after viral vector injection:

[0082] (1) After the mouse is fully anesthetized with gas, ophthalmic curved scissors are inserted from the conjunctival sac to cut off the tissue around the eyeball to the posterior end of the eyeball to cut off the optic nerve and remove the eyeball. The eyeball is then immersed in eyeball fixative and moved under a microscope. A hole is pierced at the limbus of the cornea and sclera with a 30G needle and the eyeball is immersed in eyeball fixative for 2 hours.

[0083] (2) After the eyeball is fixed for 2 hours, the anterior segment and lens are removed, and the optic cup is placed in 30% sucrose for dehydration overnight. A small amount of OCT (optimal cutting temperature) embedding agent is added to the sample holder, and the sample holder is placed on a cold table. After the OCT solidifies, the optic cup is fixed on the sample holder and then embedded with OCT embedding agent. After the OCT is completely solidified, the eye cup is sliced, and the slice thickness is set to 10 μm.

[0084] (3) Place the frozen sections at room temperature for 10-15 minutes, and wash them three times with PBS, 5 minutes each time. Use absorbent paper to dry the water around the tissue, and circle it with an immunohistochemistry pen. Add 20 μL of 0.3% Triton to each retinal tissue to break the membrane, and incubate at room temperature for 15 minutes.

[0085] (4) Aspirate the 0.3% Triton on the tissue, add 10 μL DAPI to each retinal tissue to stain the nucleus, incubate at room temperature for 5 min, wash 3 times with PBS, each time for 5 min, seal with anti-fluorescence quenching sealing agent, and take pictures under a 40X fluorescence microscope.

[0086] 12. Statistical Analysis

[0087] Statistical analysis was performed using GraphPad Prism 7.0 software. All experimental data were presented as mean ± standard deviation (Mean ± SD), and statistical methods such as Student's t-test or Two-way ANOVA were used to compare the differences between two or more groups of data (*P < 0.05; **P < 0.01).

[0088] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0089] Example 1: Selection and evaluation of animal models of retinitis pigmentosa

[0090] The rd1 mouse is one of the commonly used animal models for studying retinitis pigmentosa. The pathogenesis of retinitis pigmentosa is a nonsense mutation in exon 7 of the Pde6b gene on chromosome 5. Retinal degeneration in rd1 mice occurs early and the lesions are severe, similar to the progression of congenital infantile retinal degeneration. Therefore, rd1 mice were used as research subjects to explore the potential mechanisms of retinal degeneration, study the process and characteristics of retinitis pigmentosa in rd1 mice, and seek new treatment strategies.

[0091] 1. Histological changes of retina in rd1 mice:

[0092] The thickness of the outer nuclear layer of the retina of rd1 mice began to thin on the 10th day after birth. On the 12th day after birth, the average thickness of the outer nuclear layer of the retina of rd1 mice was 40μm, and the average thickness of the outer nuclear layer of the retina of the control mice was 59μm. There was a statistically significant difference between the two groups (P < 0.0001). As time passed after birth, the outer nuclear layer gradually became thinner. On the 18th day after birth, the thickness of the outer nuclear layer of the retina of rd1 mice was only 7.58μm. The gaps between the photoreceptor cells in the outer nuclear layer of rd1 mice increased, and the outer segments became shorter. On the 35th day after birth, the outer nuclear layer of the retina completely disappeared ( Figure 1 C). During the whole retinal degeneration process, the outer nuclear layer of rd1 mice changed most significantly from day 12 to day 18 after birth, which was statistically different from the control group (P < 0.0001) ( Figure 1 D). The above results show that the morphological changes of retinal degeneration in rd1 mice begin around the 10th day after birth, with an acute change trend and progressive aggravation until the outer nuclear layer of the retina completely disappears on the 28th to 35th day after birth.

[0093] 2. Electroretinogram (ERG)

[0094] After 6 hours of dark adaptation, the experimental mice were anesthetized with isoflurane and subjected to full-field electroretinogram. Compared with the normal control group mice at the corresponding time point, the amplitudes of the a-wave and b-wave of the dark-adapted 3.0 maximum mixed response and the b-wave of the dark-adapted 0.01 response of the rd1 mice on the 18th day after birth were significantly reduced ( Figure 2 AB), until the 28th and 35th days, the amplitudes of the a-wave and b-wave of the dark-adapted 3.0 maximum mixed response and the b-wave of the dark-adapted 0.01 response decreased to the baseline position ( Figure 2 CE). The results showed that the retinal function of rd1 mice was significantly reduced on the 18th day after birth and was completely lost after the 28th day.

[0095] 3. TUNEL cell apoptosis detection results

[0096] TUNEL staining was performed on paraffin sections of retina of rd1 mice at day 6, 8, 10, 12, 14, 16, 18, and 21 after birth ( Figure 3 As shown in the figure, TUNEL-positive cells began to appear in the outer nuclear layer of the retina of rd1 mice on the 8th day after birth, and the number of TUNEL-positive cells increased significantly on the 10th day. The number of TUNEL-positive cells reached the highest on the 14th day. On the 18th and 21st days, only one layer of the outer nuclear layer of the retina remained, and there were still TUNEL-positive cells. The results showed that the outer nuclear layer of the retina of rd1 mice began to apoptose from the 8th day after birth and gradually worsened. The apoptosis of photoreceptor cells in the outer nuclear layer reached a peak on the 14th day, and then the outer nuclear layer continued to have apoptosis.

[0097] 4. Changes in black and white box visual behavior detection

[0098] The rd1 mice and control mice on days 18, 21, 28, and 35 after birth were tested for behavioral characteristics in a double-blind crossover manner ( Figure 4 A). Compared with the normal control group mice at different time points, the rd1 mice on days 18-35 spent significantly longer time in the white box ( Figure 4 B), the number of times of shuttling between the black and white boxes also increased significantly ( Figure 4 C) The results showed that the rd1 mice on days 18 to 35 after birth showed increasingly severe visual impairment in behavior, which was consistent with the HE and ERG results.

[0099] 5. Changes in open-field visual behavior

[0100] The open field behavior test was performed on rd1 mice and control mice on days 18, 21, 28, and 35 after birth in a double-blind crossover manner. Figure 5 A), compared with normal control mice at different time points, the total activity of rd1 mice on days 28 and 35 after birth was significantly reduced ( Figure 5 B), except for the rd1 mice on day 18 after birth, the rd1 mice of other ages entered and exited the central area less frequently than the corresponding control mice ( Figure 5 C), short stay in the central area ( Figure 5 D).

[0101] The above results showed that the visual behavior of rd1 mice showed decreased vision from the 21st day to the 35th day after birth, which was consistent with the results of HE and ERG.

[0102] Example 2: Screening of miRNAs closely related to retinitis pigmentosa

[0103] 1. Correlation analysis of whole-genome miRNA expression levels

[0104] Pearson correlation analysis was used to evaluate the correlation of the whole genome miRNA expression levels of each mouse sample. In each pair of experimental group and control group, the correlation coefficient R2 between samples between groups was ≥0.85, and the correlation coefficient R2 between samples within a group was ≥0.85.

[0105] The results showed that the whole genome miRNA expression patterns of each two groups of samples were almost the same. Sample cluster analysis of whole genome miRNA levels ( Figure 6 AB), the results showed that the three biological samples in each group had good repeatability.

[0106] 2. Cluster analysis of differentially expressed miRNAs

[0107] Cluster analysis was performed on miRNAs with significant differences and displayed in the form of a heat map, as shown in the figure. Figure 7 As shown. Red represents high level, blue represents low level, the higher the expression level, the darker the red, the lower the expression level, the darker the blue. The above results show that the miRNA expression profile of rd1 mice undergoes significant changes in the early stage, peak stage and degeneration process of retinitis pigmentosa.

[0108] 3. GO enrichment analysis of differential miRNA target genes

[0109] According to the P value ranking, the top 20 most significant GO Terms are selected to draw a GO enrichment analysis graph. The horizontal axis represents the significance of enrichment, and the vertical axis represents the enriched GO Terms. Figure 8 As shown in the figure, the target genes of the enriched differential miRNAs are involved in biological regulation, metabolism of various substances in cells and other processes. The results show that these differential miRNAs may participate in the above biological processes by regulating the target genes, thereby affecting the process of retinal pigment degeneration in rd1 mice.

[0110] 4. Prediction of differentially expressed miRNA target genes associated with retinal degeneration

[0111] miRNAs play a role by binding to mRNAs to downregulate their expression levels or inhibit their translation, which suggests that differential miRNAs may participate in the process of retinitis pigmentosa in rd1 mice through this mechanism. Therefore, the target genes of miRNA-142a-5p, miRNA-223-3p, miRNA-25-3p, and miRNA-653-5p were predicted by RNAhybrid and miRanda databases, such as Fig. 9As shown. The predicted targets of miRNA-142a-5p include Kitl, Kit, Bag4, Flt1, Efna5, Mcl1, etc., among which Bag4 and Mcl1 are involved in anti-apoptotic response, and Kitl / Kit signaling pathway is closely related to retinal diseases. The predicted targets of miRNA-25-3p include Flt1, Xiap, Igf1r, Caspase9, Itgb3, Akt1, etc., among which Xiap and Caspase9 are closely related to the apoptotic process; miRNA-2 The predicted targets of 23-3p include Cftr, Atp2b4, Atp2b1, Bdkrb2, Adcy1, Prkce, etc., among which Bdkrb2 is involved in inflammatory response, and Prkce is an anti-apoptotic gene; the predicted targets of miRNA-653-5p include Pkia, Nedd4l, Pex7, Acaa1a, Acaa1b, etc., among which Nedd4l is closely related to autophagy. The biological processes involved in some target genes of these differential miRNAs are closely related to RP.

[0112] The above results indicate that these differentially expressed miRNAs may play a role in the retinal degeneration process of mice by regulating the above-mentioned target genes.

[0113] 5. Validation of the role of miRNA in mouse retinitis pigmentosa

[0114] According to the prediction results of the differentially expressed miRNA target genes, the qPCR validation results showed that the expression trends of miRNA-142a-5p, miRNA-223-3p, miRNA-25-3p, and miRNA-653-5p were consistent with the sequencing results ( Fig.10 As shown). Among the four most important miRNAs closely related to retinal degeneration, only miRNA-142 was expressed in different degrees in four retinal degeneration mouse models, namely P347S-Rhodopsin transgenic mice, Δ307-rds mice, Rho- / - mice and rd10- / - mice, and its target genes included anti-apoptotic genes such as Xiap, Birc3, Bcl2, Bcl2l2 and Mcl1. The experimental results suggest that miRNA-142a-5p plays an important role in the retinal degeneration of rd1 mice. The expression level of miRNA-142a-5p was slightly lower than that of the corresponding control group on the 9th day after birth of rd1 mice, and the expression level was significantly increased on the 14th day after birth (P<0.0001), indicating that the expression level of miRNA-142a-5p gradually increased during the retinal degeneration of rd1 mice. Combined with the results of bioinformatics analysis, it was shown that miRNA-142a-5p was directly involved in the process of retinitis pigmentosa in rd1 mice.

[0115] Example 3: Construction of miRNA-142a-5p adeno-associated virus vector

[0116] (1) Information on plasmid construction: gene name: mmu-miRNA-142a-5p, gene bank ID: MINMAT0000154.

[0117] Table 5 Plasmid construction information

[0118]

[0119] (2) Carrier map:

[0120] Fig.11 The fragment of miRNA-142a-5p blocking sequence is shown. The sequence CAUAAAGUAGAAAGCACUACU of mmu-mi142a-5p was cloned into the H13782pscAAV-U6-shRNA-CMV-EGFP-tWPA adeno-associated virus vector to form the recombinant expression vector pscAAV-U6-Decoy(mmu-miRNA-142a-5p)-CMV-EGFP-tWPA. The control virus vector is pcscAAV-tCMV-EGFP-tWPA.

[0121] (3) Construction and detection of adeno-associated virus of miRNA-142a-5p:

[0122] The successfully constructed plasmid was packaged with adeno-associated virus, and the recombinant expression plasmid and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). After 2 to 3 days of transfection, the recombinant AAV was assembled in the packaging cells. Then, AAV virus particles were recovered from the transfected AAV-293 cells, centrifuged, concentrated and purified to obtain the target AAV virus particles; the packaging virus serum was AAV2 / 5.

[0123] The titer was determined by qPCR, and the average titer of pscAAV-U6-Decoy(mmu-miRNA-142a-5p)-CMV-EGFP-tWPA virus was 2.52E+12, and the average titer of pcscAAV-tCMV-EGFP-tWPA virus was 3.98E+12. The titer of the standard used in this experiment was 2E+13 v.g / ml. Detailed information on the titer determination and standard curve of adeno-associated virus vectors is shown in Tables 6-7.

[0124] Table 6pscAAV-U6-Decoy(mmu-miR-142a-5p)-CMV-EGFP-tWPA

[0125]

[0126] Table 7pcscAAV-tCMV-EGFP-tWPA

[0127]

[0128] Example 4: Intervention Function and Application of miRNA-142a-5p

[0129] (1) Select the time window for miRNA-142a-5p intervention and observation of effects:

[0130] In order to verify whether miRNA-142a-5p is involved in the process of retinitis pigmentosa in rd1 mice, miRNA-142a-5p in the retina of rd1 mice will be knocked down to observe the changes in the outer nuclear layer of the retina of rd1 mice after intervention. From the results of previous experiments, it can be seen that the outer nuclear layer of the retina of rd1 mice begins to apoptosis from the 8th day after birth, so this part of the experiment will knock down the expression of miRNA-142a-5p on the 8th day after birth of rd1 mice, because there is only one layer of photoreceptor cells in the outer nuclear layer of the retina on the 18th day after birth, so the apoptotic cells begin to appear in the outer nuclear layer of the retina of rd1 mice on the 8th day after birth, and miRNA-142a-5p intervention treatment is carried out. When there is only one outer nuclear layer in the outer nuclear layer of the retina on the 18th day after birth, the 8th day after birth of rd1 is selected as the starting point for subretinal injection of miRNA-142a-5p, and the 18th day is selected as the time point for observing the effect of miRNA-142a-5p intervention.

[0131] (2) Confirmation of the AAV transfection site and transfection status

[0132] On the 8th day after birth, the scAAV virus vector knocking down miRNA-142a-5p was injected into the subretinal space of rd1 mice, and the expression of green fluorescent protein EGFP in the retina was observed using a fluorescence microscope. Fig.12 As shown, EGFP is widely expressed in the retina, and most of its expression is located in the outer nuclear layer of the retina.

[0133] (3) Knockdown of miRNA-142a-5p delays the progression of retinitis pigmentosa in rd1 mice

[0134] After knocking down miRNA-142a-5p, the outer nuclear layer of the retina of rd1 mice showed significant changes ( Fig.13 As shown in A), compared with the AAV-control group, the thickness of the retinal outer nuclear layer of rd1 mice injected with the subretinal cavity carrying the miRNA-142a-5p target virus was 15.97 μm thicker than that of the empty virus injection group, and the retinal outer nuclear layer was significantly thickened (P < 0.001). Fig.13After B virus vector injection, q-PCR test results showed that the expression level of miRNA-142a-5p was significantly reduced by about 85% compared with the empty virus injection group after miRNA-142a-5p target virus vector injection, with significant statistical difference (****P<0.0001). Fig.13 CD electroretinogram showed that the ERG of the miRNA-142a-5p target virus injection group was significantly different from that of the empty virus injection group. The above research results indicate that inhibiting the expression of miRNA-142a-5p can significantly delay the pathological process of retinitis pigmentosa in rd1 mice.

[0135] Although some preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0136] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of this application and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A biological agent for intervention or treatment of retinitis pigmentosa, characterized in that: Contains a vector that inhibits or downregulates the expression of miRNA-142a-5p in the retina.

2. The biological agent according to claim 1, characterized in that The vector contains mmu-miRNA-142a-5p or a fragment thereof.

3. The biological agent according to claim 2, characterized in that The mmu-miRNA-142a-5p fragment sequence is: CAUAAAGUAGAAAGCACUACU.

4. The biological agent according to claim 2, characterized in that The carrier is prepared by the following steps: (1) The mmu-miRNA-142a-5p fragment was cloned into the H13782pscAAV-U6-shRNA-CMV-EGFP-tWPA adeno-associated virus vector to form a recombinant expression plasmid; (2) The recombinant expression plasmid and pAAV-RC are co-transfected into AAV-293 cells, and then AAV virus particles are recovered from the transfected AAV-293 cells, and then centrifuged, concentrated, and purified to obtain the target AAV virus particles.

Images