A recombinant Bst DNA polymerase with high DNA polymerase activity and reverse transcriptase activity, and preparation and application thereof
By constructing a RecA-LAMP system using recombinant Bst DNA polymerase HpSt-G23 in conjunction with TthRecA protein, the problems of low reverse transcriptase activity and primer dimer formation during RNA template amplification of Bst DNA polymerase were solved, achieving efficient and simplified nucleic acid detection.
Patent Information
- Application Number
- CN202411785671.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2044-12-06
AI Technical Summary
Existing Bst DNA polymerase has low reverse transcriptase activity during RNA template amplification, requiring the addition of additional reverse transcriptase, which complicates the detection process and reduces sensitivity and accuracy. Meanwhile, primer dimer formation in the LAMP reaction leads to non-specific amplification, and existing technologies cannot simplify the system composition and improve amplification specificity.
By rearranging the amino acid sequences of the Headpiece domain of chicken velvet protein and the secondary domain of the Sto7d protein of the thermophilic archaea Sulfolobus tokodaii, and fusing them with a large fragment of Bst DNA polymerase, a recombinase HpSt-G23 was formed, which enhanced its reverse transcriptase activity and inhibitor resistance. The RecA-LAMP system was then constructed by pairing it with TthRecA protein.
HpSt-G23 significantly improves the detection sensitivity and amplification efficiency of RNA templates under isothermal conditions, reduces the number of primers, simplifies the reaction system, enhances tolerance to inhibitors, and achieves efficient detection of DNA and RNA templates.
Smart Images

Figure CN119592539B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a recombinant Bst DNA polymerase with both high DNA polymerase activity and reverse transcriptase activity, as well as its preparation and application. Background Technology
[0002] Loop-mediated isothermal amplification (LAMP) is a method for nucleic acid amplification and detection under isothermal (60-65℃) conditions. Compared with conventional PCR and qPCR, it does not require template thermal denaturation or temperature cycling, has low instrument dependence, and is simple, rapid, and highly specific. LAMP technology uses 4-6 primers designed for 6-8 regions on the target gene sequence of the template, relying on the polymerase activity and strand displacement activity of Bst DNA polymerase (derived from *Geobacillus stearothermophilus*) to amplify DNA under isothermal conditions. Although Bst DNA polymerase itself has been shown to have reverse transcriptase activity, when amplifying RNA templates, due to its lower reverse transcriptase activity, additional reverse transcriptase is still needed in the RT-LAMP reaction system. However, using reverse transcriptase and DNA polymerase simultaneously in one system complicates the detection process due to differences in their continuous synthesis capacity, stability, and activity temperature range, and may even lead to mutual inhibition, reducing the sensitivity and accuracy of the detection. If a single enzyme preparation can amplify both DNA and RNA templates, RNA reverse transcription can be performed without the addition of reverse transcriptase. Therefore, improving the reverse transcriptase activity of Bst DNA polymerase holds promise for simplifying RT-LAMP detection of RNA templates. Meanwhile, Bst DNA polymerase maintains good nucleic acid template amplification capabilities in the presence of various inhibitors, making it a promising candidate for rapid or on-site diagnostic applications.
[0003] Due to the unique nature of LAMP technology, the use of 4-6 primers with a polymerase lacking proofreading activity inevitably leads to primer dimer formation and nonspecific amplification. Introducing microorganisms into PCR and isothermal amplification... Thermus thermophilus ( Tth The heat-resistant TthRecA protein derived from HB8 can effectively reduce primer mismatches, improve the specificity of amplification reactions, and reduce primer dimerization by reducing the number of primers used in LAMP.
[0004] To simplify the composition of LAMP and RT-LAMP systems and reduce non-specific amplification caused by primer dimerization, it is urgent to develop novel Bst DNA polymerases that not only possess high polymerase and reverse transcriptase activity and strong inhibitor tolerance, but also can be matched with RecA to construct a simple RecA-LAMP system for the detection of DNA and RNA. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a recombinant Bst DNA polymerase that has both high DNA polymerase activity and reverse transcriptase activity.
[0006] Another object of the present invention is to provide a method for preparing the above-mentioned recombinant Bst DNA polymerase with both high DNA polymerase activity and reverse transcriptase activity.
[0007] Another object of the present invention is to provide the application of the above-mentioned recombinant Bst DNA polymerase which has both high DNA polymerase activity and reverse transcriptase activity.
[0008] The objective of this invention is achieved through the following technical solution: A recombinant Bst DNA polymerase, named HpSt-G23, possessing both high DNA polymerase and reverse transcriptase activity, has been developed, and its amino acid sequence is shown in SEQ ID NO.1. This recombinant Bst DNA polymerase is based on a truncated version of the headpiece domain of chicken velvet protein, Hp47, and thermophilic archaea. Sulfolobus tokodaii The secondary structure sequence of the Sto7d protein double domain is obtained by rearranging the amino acid sequence and linking it to the amino terminus of the wild-type Bst DNA polymerase fragment.
[0009] The biological materials associated with the above-mentioned recombinant Bst DNA polymerase are any one or more of the following biological materials: I. Nucleic acid molecule; the nucleic acid molecule contains a DNA fragment encoding the HpSt-G23.
[0010] II. An expression vector; wherein the expression vector comprises the nucleic acid molecule described in I; III. Host cell; the host cell comprises the expression vector described in II.
[0011] Furthermore, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.2. It can be heterologously expressed in an E. coli expression system.
[0012] The method for preparing the recombinant Bst DNA polymerase with both high DNA polymerase and reverse transcriptase activity includes the following steps: S1. The expression vector was transformed into competent cells, followed by heat shock after an ice bath, and then cooled and revived on ice. LB liquid medium was added for isothermal shaking culture, and single clones were selected for screening. S2. Extract the expression vector of the screened positive clones, transform it into host cells, and inoculate the host cells into LB liquid medium for isothermal shaking culture to obtain seed culture medium containing HpSt-G23. S3. Take the seed culture solution and inoculate it into LB liquid medium for amplification culture to obtain a bacterial solution containing HpSt-G23. S4. Isopropyl β-D-Thiogalactoside (IPTG) was added to the bacterial culture to induce host cells to express HpSt-G23. The cells were then centrifuged to obtain a bacterial precipitate containing HpSt-G23. S5. Add lysis buffer to the bacterial precipitate, resuspend the bacterial cells containing HpSt-G23, break the bacterial cells by sonication, centrifuge, and obtain the supernatant of the broken bacterial cells containing HpSt-G23. S6. The supernatant of the lysed bacterial cells is incubated at a constant temperature and centrifuged to remove impurity proteins, thereby obtaining a protein supernatant containing HpSt-G23. S7. Perform nickel ion affinity chromatography on the protein supernatant, and perform gradient elution using elution buffer to form a chromatography eluent. Take the chromatography eluent for protein denaturation, and detect the chromatography eluent using SDS-PAGE electrophoresis. Collect the chromatography eluent containing HpSt-G23 to obtain HpSt-G23.
[0013] A LAMP / RT-LAMP reaction kit comprising at least one of nuclease-free water, LAMP reaction buffer, LAMP primers, dNTPs, a fluorescent dye, and the HpSt-G23 thereof.
[0014] Preferably, the LAMP reaction buffer has the following composition: 20±10 mmol / L Tris-HCl, 90±20 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 6±2 mmol / L MgSO4, and pH 9.0±0.6.
[0015] Preferably, the LAMP primer composition is as follows: 0.8–1.6 μmol / L FIP / BIP, 0.2–0.4 μmol / LLF / LB, and 0.2–0.4 μmol / L F3 / B3.
[0016] Preferably, the concentration of the dNTPs in the system is 0.8–1.4 mmol / L.
[0017] Preferably, the enzyme activity of HpSt-G23 in the system is 0.05 to 0.12 U / μL, and the optimal addition amount is 0.06 U / μL.
[0018] Preferably, the fluorescent dye is SYBR Green I, EvaGreen, SYTO-9 or SYTO-82, and more preferably SYTO-9.
[0019] The application of the above-mentioned LAMP / RT-LAMP reaction kit in nucleic acid detection.
[0020] Preferably, the conditions for nucleic acid testing are 60–65°C for 60 minutes.
[0021] Preferably, the nucleic acid test sample includes an RNA virus sample or a plasmid sample containing viral DNA.
[0022] Preferably, the sample source for the nucleic acid detection is not limited, and may contain at least one of the inhibitors such as urea, NaCl, SYBR, and whole blood. Specifically, the concentration of urea is less than 1.5 mol / L, the concentration of NaCl is less than 85 mmol / L, the concentration of SYBR Green I is less than 2×, and the concentration of whole blood is less than 6% (v / v).
[0023] A RecA-HpSt-G23 reaction kit comprises nuclease-free water, reaction buffer, primers, dNTPs, ATP, betaine, spermidine, and the aforementioned HpSt-G23 reacting with... Tth RecA.
[0024] Preferably, the reaction buffer solution has the following composition: 20±10 mmol / L Tris-HCl, 70±15 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 5±2 mmol / L MgSO4, and pH 8.8±0.4.
[0025] Preferably, the primer composition is as follows: 1.2–1.6 μmol / L FIP / BIP.
[0026] Preferably, the enzyme activity of HpSt-G23 in the system is 0.05 to 0.12 U / μL, more preferably 0.06 U / μL.
[0027] Preferably, the concentration of TthRecA in the system is 2–8 ng / μL.
[0028] Preferably, the concentration of the dNTPs in the system is 0.6–1.2 mmol / L.
[0029] Preferably, the concentration of ATP in the system is 0.1–1.2 mmol / L.
[0030] Preferably, the concentration of Betaine in the system is 0.6–1.0 mol / L.
[0031] Preferably, the concentration of spermidine in the system is 0.4–0.8 mmol / L.
[0032] Application of the RecA-HpSt-G23 reaction kit in nucleic acid detection.
[0033] Preferably, the conditions for nucleic acid testing are 60–65°C for 60 minutes.
[0034] Preferably, the nucleic acid test sample includes an RNA virus sample or a plasmid sample containing viral DNA.
[0035] The present invention has the following advantages and effects compared with the prior art: This invention relates to HpSt-G23, obtained by fusing a protein polypeptide based on the Hp47-Sto7d domain amino acid sequence rearrangement to the amino terminus of a large fragment of Bst DNA polymerase. HpSt-G23 exhibits high stability, maintaining over 70% of its enzyme activity between pH 5 and 9, and retaining over 90% activity after treatment at 60°C for 2 hours. The modified HpSt-G23 shows high tolerance to common inhibitors, tolerating at least 85 mM NaCl and 1.5 M urea. Furthermore, HpSt-G23 possesses high polymerase and reverse transcriptase activity, and its detection limits in LAMP and RT-LAMP methods are significantly lower than those of the wild-type large fragment of Bst DNA polymerase.
[0036] The HpSt-G23 described in this invention is convenient to use. The RecA-HpSt-G23 reaction system constructed in conjunction with Tth RecA can be used for both DNA and RNA template detection. The number of primers is reduced to two. When detecting RNA, no additional reverse transcriptase is required, saving experimental and time costs. It also significantly improves the detection sensitivity of RNA templates and has good application prospects in the field of rapid nucleic acid detection. Attached Figure Description
[0037] Figure 1 This is a schematic diagram of the Bst DNA polymerase mutant of the present invention.
[0038] Figure 2This is an SDS-PAGE electrophoresis analysis diagram of the Bst DNA polymerase mutant in this invention.
[0039] Figure 3 This is a graph showing the comparison of the amplification ability of the Bst DNA polymerase mutant to DNA template in this invention.
[0040] Figure 4 This is a graph showing the reverse transcriptase activity test results of the Bst DNA polymerase mutant in this invention.
[0041] Figure 5 This is a diagram showing the comparison results of the salt tolerance of the Bst DNA polymerase mutant in this invention.
[0042] Figure 6 This figure shows the comparison results of the thermostability of large fragments of HpSt-G23 and Bst DNA polymerase in this invention.
[0043] Figure 7 This figure shows the comparison of pH stability between HpSt-G23 and Bst DNA polymerase fragments in this invention.
[0044] Figure 8 This figure shows the results of the tolerance test of HpSt-G23 and Bst DNA polymerase large fragments to different inhibitor concentrations in this invention.
[0045] Figure 9 The Bst DNA polymerase mutant HpSt-G23 in this invention and Tth Figure showing the comparison of amplification capabilities between the RecA-HpSt-G23 system constructed with RecA and the LAMP system.
[0046] Figure 10 The Bst DNA polymerase mutant HpSt-G23 in this invention and Tth Figure showing the comparison of amplification capabilities between the RecA-HpSt-G23 system constructed with RecA and the RT-LAMP system. Detailed Implementation
[0047] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0048] Example 1: Preparation of amino acid sequence rearrangement domain mutants based on the Hp47-Sto7d domain Based on the headpiece domain of chicken velvet protein (PDB:1YU5, NCBI ID: 396423) and its origin from thermophilic archaea... Sulfolobus tokodaii Based on the three-dimensional crystal structure of Hp47-Sto7d formed by fusing the Sto7d domain (PDB: 1BF4 NCBI ID: BA000023.2), sequence rearrangement was performed, and the new domain was fused to the amino terminus of the large fragment of Bst DNA polymerase. The linker was "TCTGGCGGTGGTAGCGGTGGCGGCGGTTCTGGCGGTGGTGGCAGC", resulting in a Bst DNA polymerase mutant. See [link to relevant documentation]. Figure 1 . Figure 1 The amino acid sequences corresponding to each number in the sample are as follows: H1: PRGVDPSRKENHLS; H2: DEDFKAVF; H3: GMTRSAFANL; H4: PLWKQQNLKKEKGLF; S1: VTVKFKYK; S2: GEEKEVDI; S3: SKIKKVWRV; S4: GKMISFTYDDNG; S5: KTGRGAVSEK; S6: DAPKELLQMLEKSGKK. Subsequently, the performance of the BstDNA polymerase mutant was tested.
[0049] The specific implementation method is as follows: (1) Design the nucleotide sequence encoding the rearranged domain, and artificially synthesize the DNA molecule encoding the relevant domain using overlap extension PCR and conventional PCR methods. Using a 2×Hipro DNA Assembly Mix kit (Guangzhou Yingzan Biotechnology Co., Ltd., K001A), ligate the DNA molecule of the relevant domain with the pET-28a plasmid containing a large fragment of linear Bst DNA polymerase (this plasmid has been disclosed in the literature "Xiang, R., Liu, G., Hou, Y., Xie, L., Wang, Q., Hu, S., 2024. Double domain fusion improves the reverse transcriptase activity and inhibitor tolerance of Bst DNA polymerase. International Journal of Biological Macromolecules 274, 133243.") via homologous recombination. The linker is "TCTGGCGGTGGTAGCGGTGGCGGCGGTTCTGGCGGTGGTGGCAGC". Alternatively, a biotechnology company can be commissioned to directly synthesize the DNA molecule encoding the Bst DNA polymerase mutant. The ligation product or synthesized sequence was then transformed into competent BL21(DE3) cells to form recombinant engineered cells, which were then cultured in LB (Luria-Bertani) liquid medium under isothermal shaking until OD. 600 =0.6~0.8, add IPTG to a final concentration of 0.1 mmol / L, induce at 18℃ with shaking for 12 h, centrifuge (4℃, 6,000 ×g, 30 min) to collect the induced bacterial cells and weigh them, record the wet weight of the bacterial cells, add lysis buffer (50 mmol / L Tris-HCl, pH 7.5) according to the ratio to resuspend the bacterial cells, sonicate at constant power (4℃, 5.5 s ON, 5.5 s OFF, 165 W), centrifuge at low temperature (4℃, 36,000 ×g, 30 min), take the supernatant and incubate at 60℃ for 30 min to remove impurity proteins, centrifuge at low temperature (4℃, 36,000 ×g, 30 min), take the supernatant and filter through a 0.22 μm microporous membrane and then purify through a nickel ion affinity column to obtain high purity BstDNA polymerase mutant, and the protein purity is detected by 12% SDS-PAGE protein electrophoresis, see Figure 2The nucleotide sequence encoding the Bst DNA polymerase mutant HpSt-G23 is shown in SEQ ID NO.1, wherein bases 1-354 encode the rearranged domain, bases 355-400 are the linker, and bases 401-2157 encode the large fragment of the Bst DNA polymerase. For other Bst DNA polymerase mutants, the nucleotide sequences can be obtained by rearranging bases 1-354 according to SEQ ID NO.1.
[0050] (2) Performance test of Bst DNA polymerase mutant.
[0051] The Bst DNA polymerase mutant was subjected to LAMP and RT-LAMP reactions using astrovirus plasmid (which has been disclosed in the literature "Xiang, R., Liu, G., Hou, Y., Xie, L., Wang, Q., Hu, S., 2024. Double domain fusion improves the reverse transcriptase activity and inhibitor tolerance of Bst DNA polymerase. International Journal of Biological Macromolecules 274, 133243.") DNA and SARS CoV-2 RNA as templates, and its salt tolerance was tested.
[0052] Bst DNA polymerase amplification capacity assay: The LAMP / RT-LAMP reaction system is shown in Table 1. Table 1 Reaction System
[0053] 5× Reaction buffer: 100 mmol / L Tris-HCl, 450 mmol / L KCl, 100 mmol / L (NH4)2SO4, 30 mmol / L MgSO4, pH 9.0; Primer mix: 20 μmol / L FIP / BIP, 5 μmol / L LF / LB, 5 μmol / LF3 / B3.
[0054] Each reaction was repeated three times. The prepared reaction system was placed in a real-time quantitative PCR instrument, and the reaction program was set to 63℃ for 60 min, with "FAM" fluorescence signals collected once per minute. The primer sequences used for detecting astrovirus plasmid DNA are as follows: Ast-FIP: 5'-CTGCTCTGTCCCGCCCTCTAATGGCCGCAACAGGAGTA-3'; Ast-BIP: 5'-AGGACTAGAAGACAGCCCGGATGACAATGTTACGGACACGT-3'; Ast-LF: 5'-TTGTGAGCGGGCCCTTG-3'; Ast-LB: 5'-CGCGGCAAACATCAATCTTCTCA-3'; Ast-F3: 5'-GCAGGTAACTGTTGAGGTCA-3'; Ast-B3: 5'-GGTTTTGGTCCTGTGACACC-3'.
[0055] The primer sequences used for detecting SARS-CoV-2 RNA are as follows: RN-FIP: 5'-TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC-3'; RN-BIP: 5'-CGCATTGGCATGGAAGTCAATTTGATGGCACCTGTGTAG-3'; RN-F3: 5'-AACACAAGCTTTCGGCAG-3'; RN-B3: 5'-GAAATTTGGATCTTTGTCATCC-3'; RN-LF: 5'-ACCTTCGGGAACGTGGTT-3'; RN-LB: 5'-TTCCTTGTCTGATTAGTTC-3'.
[0056] Amplification results as follows Figure 3 and Figure 4 As shown, the fusion of exogenous domains can significantly improve the amplification efficiency of Bst DNA polymerase. Among them, polymerase HpSt-G23 not only accelerates the amplification efficiency of plasmid DNA, but also significantly improves its reverse transcriptase activity.
[0057] Salt tolerance of Bst DNA polymerase was tested in a LAMP system using an astrovirus plasmid as a template. Results are as follows: Figure 5 As shown, rearrangement of the amino acid sequence of the domain has a significant effect on the salt tolerance of Bst DNA polymerase, and can significantly improve the tolerance of Bst DNA polymerase to high salt.
[0058] Further, TthRecA at a final concentration of 5 ng / μL and 0.6 mM ATP were added to the system in Table 1, and the primer mix was replaced with 20 μmol / L FIP / BIP to prepare the RecA-LAMP system. Running the system at 63℃ for 60 min in a real-time quantitative PCR instrument revealed that HpSt-G23 could rapidly amplify astrovirus DNA without exhibiting non-specific amplification. However, according to previous studies, HpStBL, an enzyme preparation obtained by fusing the Hp47 and Sto7d dual domains to the amino terminus of a large fragment of Bst polymerase, while improving the reverse transcriptase activity and inhibitor resistance of Bst DNA polymerase to some extent, showed low amplification efficiency and non-specific amplification when combined with TthRecA in the RecA-LAMP system for amplifying nucleic acid samples.
[0059] In summary, the HpSt-G23 mutant constructed in this embodiment not only improves the amplification efficiency of Bst DNA polymerase and enhances salt tolerance, but also exhibits good performance in RecA-LAMP, making it a superior mutant.
[0060] Example 2: Expression and purification of HpSt-G23 (1) pET-28a-HpSt-G23 plasmid was transformed into competent BL21(DE3) cells to form recombinant engineered cells, which were then cultured in LB liquid medium under isothermal shaking until OD. 600 =0.6~0.8, add IPTG to a final concentration of 0.1 mmol / L, induce at 18℃ with shaking for 12 h, collect the induced cells by low-temperature centrifugation and weigh, record the wet weight of the cells, add lysis buffer according to the ratio to resuspend the cells, centrifuge (4℃, 6,000 ×g, 30 min) to collect the induced cells and weigh, record the wet weight of the cells, add lysis buffer according to the ratio to resuspend the cells, sonicate the cells with constant power (4℃, 5.5 s ON, 5.5 s OFF, 165 W), centrifuge at low temperature (4℃, 36000 ×g, 30 min), take the supernatant and incubate at 60℃ for 30 min to remove impurity proteins, centrifuge at low temperature (4℃, 36,000 ×g, 30 min), take the supernatant and filter through a 0.22 μm microporous membrane and then purify through a nickel ion affinity column. The purification steps are as follows: (2) Using a peristaltic pump chromatography system, the supernatant was loaded into the His Trap pre-equilibrated with buffer at a flow rate of 1 mL / min. TM HP (purchased from GE Healthcare); (3) The column was washed with binding buffer (50 mmol / L Tris-HCl, 50 mmol / L NaCl, 5% v / v glycerol, pH 8.0) at a flow rate of 1 mL / min, and then eluted with elution buffer (50 mmol / L Tris-HCl, 50 mmol / L NaCl, 500 mmol / L imidazole, 5% v / v glycerol, pH 8.0) and the eluted fraction was collected.
[0061] (4) Collect the eluent containing the target protein and dialyze it to obtain high concentration and high purity HpSt-G23. Store it in storage buffer (50 mM Tris-HCl, 50 mmol / L KCl, 1 mmol / L EDTA, 50% glycerol, 1 mmol / L DTT, pH 8.0) and store it in a -20 ℃ freezer for a long time.
[0062] Example 3: Thermal stability analysis of HpSt-G23 HpSt-G23 and wild-type Bst DNA polymerase large fragments with the same enzyme activity concentration (0.05 U / μL) were incubated for 2 h at different temperatures (20, 30, 40, 50, 60, 70, 80℃). The enzyme activities of both enzymes after 2 h of incubation at different temperatures were then measured according to polymerase activity assays. Three replicates were set up for each condition, with unincubated enzyme activity defined as 100%, and the residual enzyme activity after heat incubation was calculated. Results are as follows: Figure 6 As shown, after incubation at 60℃ for 2 h, the enzyme activity of HpSt-G23 remained above 90%.
[0063] Example 4: pH stability analysis of HpSt-G23 Large fragments of HpSt-G23 and wild-type Bst DNA polymerase at the same enzyme activity concentration (0.1 U / μL) were mixed with equal volumes of buffer solution at different pH values (3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0) and incubated at 4 °C for 24 h. The enzyme activities of both enzymes were then measured according to polymerase activity assays, with three replicates for each condition. Unincubated enzyme activity was defined as 100%, and the remaining enzyme activity was calculated. Results are shown below. Figure 7 As shown, after incubation in a buffer solution at pH 5-9 for 24 h, the enzyme activity of HpSt-G23 remained above 70%.
[0064] Example 5: Amplification capacity analysis of HpSt-G23 in LAMP reaction Using different concentrations of astrovirus plasmid DNA as templates, the amplification capacity of HpSt-G23, HpStBL, and wild-type Bst DNA polymerase large fragment Bst LF in LAMP was tested. The time required for the fluorescence value to reach the fluorescence threshold automatically determined by the relevant software of the real-time PCR instrument (time threshold T) was used as the benchmark. t The shorter the time, the faster the amplification rate and the higher the efficiency.
[0065] Prepare 5×LAMP buffer: 100 mmol / L Tris-HCl, 375 mmol / L KCl, 100 mmol / L (NH4)2SO4, 25 mmol / L MgSO4, pH 9.0; the amplification system is prepared as shown in Table 1, and the reaction program is set to 63 ℃ / 60s for a total of 60 cycles, with “FAM” fluorescence signal collected once per minute.
[0066] The results are shown in Table 2. HpSt-G23 has higher DNA amplification efficiency and sensitivity than HpStBL and Bst LF, which means that HpSt-G23 is more suitable for DNA detection by LAMP method.
[0067] Table 2. T of HpSt-G23 in the LAMP reaction t value
[0068] Example 6: Amplification capacity analysis of HpSt-G23 in RT-LAMP reaction Using different concentrations of SARS-CoV-2 RNA as templates, the amplification performance of HpSt-G23, HpStBL, wild-type BstDNA polymerase large fragment BstLF, Bst 3.0, and Bst 4.0 in the RT-LAMP system was verified. See Example 5 for specific implementation details.
[0069] The results are shown in Table 3. When directly amplifying SARS-CoV-2 RNA templates, HpSt-G23 exhibited higher amplification efficiency and sensitivity than BstLF, Bst 3.0, and Bst 4.0. HpSt-G23 and HpStBL shared the same limit of detection (LOD) of 0.50 pg / μL. Although HpSt-G23's RNA amplification efficiency was slightly lower than HpStBL at the lowest template concentration, its efficiency was higher at all other template concentrations. This indicates that HpSt-G23 can detect RNA templates in RT-LAMP reactions and possesses higher reverse transcriptase activity.
[0070] Table 3. TLAMP of HpSt-G23 in the RT-LAMP reactiont value
[0071] Example 7: Tolerance test of HpSt-G23 to different inhibitor concentrations Using 10 5 Using astrovirus plasmid DNA of copy / μL as a template, different concentrations of NaCl, urea, SYBR Green I, and whole blood were added to the LAMP reaction to investigate the tolerance of the Bst DNA polymerase mutant HpSt-G23 and the large fragment of Bst DNA polymerase to common inhibitors.
[0072] The results are as follows Figure 8 As shown, HpSt-G23 exhibited better inhibitor tolerance in systems containing sodium chloride, urea, SYBR Green I, and whole blood, with the fastest amplification rate in systems containing 1.5 M urea or 85 mM sodium chloride. In contrast, the large fragment of wild-type Bst DNA polymerase showed severely inhibited enzyme activity and a significantly decreased amplification rate in systems containing inhibitors.
[0073] Example 8: Comparison of amplification capabilities between the RecA-HpSt-G23 system and the LAMP system Using different concentrations of astrovirus plasmid DNA as templates, the amplification efficiency of the RecA-HpSt-G23 system and the conventional LAMP system were compared. The RecA-HpSt-G23 system is shown in Table 4. Prepare a 5× reaction buffer: 100 mmol / L Tris-HCl, 350 mmol / L KCl, 100 mmol / L (NH4)2SO4, 25 mmol / L MgSO4, pH 8.8.
[0074] The RecA-HpSt-G23 amplification system uses only two inner primers from the LAMP primers, namely FIP and BIP. The amplification program is consistent with the LAMP amplification program, reacting at 63℃ for 60 min. The results are as follows: Figure 9 As shown, the detection limit of the RecA-HpSt-G23 system is the same as that of LAMP, both capable of amplifying 10-1 cells within 45 min. 0 The target count of copies / μL indicates that this system has good potential for DNA detection.
[0075] Table 4 Reaction System
[0076] Example 9: Comparison of amplification capabilities between the RecA-HpSt-G23 system and the RT-LAMP system Using SARS-CoV-2 RNA as a sample and Bst DNA polymerase product as a control, the amplification sensitivity of the RecA-HpSt-G23 system and the conventional RT-LAMP system for RNA templates were compared. RNA templates of 10 pg, 5 pg, 1 pg, 0.5 pg, 0.1 pg, 0.05 pg, and 0.01 pg were amplified, respectively. The RecA-HpSt-G23 amplification program was the same as the LAMP amplification program, and the reaction was carried out at 63℃ for 60 min.
[0077] The results are as follows Figure 10 As shown, the RecA-HpSt-G23 system can amplify RNA templates as low as 0.01 pg within 40 min, and its amplification sensitivity is significantly higher than that of the RT-LAMP reaction system, indicating that this system also has good prospects for RNA detection.
[0078] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A recombinant Bst DNA polymerase possessing both high DNA polymerase activity and reverse transcriptase activity, characterized in that: It was named HpSt-G23, and its amino acid sequence is shown in SEQ ID NO.
1.
2. The recombinant Bst DNA polymerase-related biomaterial as described in claim 1, characterized in that: It can be any one or more of the following biological materials: I. Nucleic acid molecule; the nucleic acid molecule is a DNA fragment encoding the HpSt-G23; II. An expression vector; wherein the expression vector comprises the nucleic acid molecule described in I; III. Host cell; the host cell comprises the expression vector described in II.
3. The recombinant Bst DNA polymerase-related biomaterial according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.
2.
4. A method for preparing recombinant Bst DNA polymerase, characterized in that: Includes the following steps: S1. Transform the expression vector described in claim 2 or 3 into competent cells, subject them to heat shock after an ice bath, cool and revive them on ice, add LB liquid medium for isothermal shaking culture, and select single clones for screening. S2. Extract the expression vector of the screened positive clones, transform it into host cells, and inoculate the host cells into LB liquid medium for isothermal shaking culture to obtain seed culture medium containing HpSt-G23. S3. Take the seed culture solution and inoculate it into LB liquid medium for amplification culture to obtain a bacterial solution containing HpSt-G23. S4. Add isopropyl thiogalactoside to the bacterial culture to induce host cells to express HpSt-G23, centrifuge, and obtain bacterial precipitate containing HpSt-G23. S5. Add lysis buffer to the bacterial precipitate, resuspend the bacterial cells containing HpSt-G23, break the bacterial cells by sonication, centrifuge, and obtain the supernatant of the broken bacterial cells containing HpSt-G23. S6. The supernatant of the lysed bacterial cells is incubated at a constant temperature and centrifuged to remove impurity proteins, thereby obtaining a protein supernatant containing HpSt-G23. S7. Perform nickel ion affinity chromatography on the protein supernatant, and perform gradient elution using elution buffer to form a chromatography eluent. Take the chromatography eluent for protein denaturation, and detect the chromatography eluent using SDS-PAGE electrophoresis. Collect the chromatography eluent containing HpSt-G23 to obtain HpSt-G23.
5. A LAMP / RT-LAMP reaction kit, characterized in that: It contains nuclease-free water, LAMP reaction buffer, LAMP primers, dNTPs, fluorescent dye, and HpSt-G23 as described in claim 1.
6. The LAMP / RT-LAMP reaction kit according to claim 5, characterized in that: The LAMP reaction buffer has the following composition: 20±10 mmol / L Tris-HCl, 90±20 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 6±2 mmol / L MgSO4, pH 9.0±0.6; The LAMP primers are composed of the following: 0.8–1.6 μmol / L FIP / BIP, 0.2–0.4 μmol / L LF / LB, and 0.2–0.4 μmol / L F3 / B3. The concentration of the dNTPs in the system was 0.8–1.4 mmol / L; The enzyme activity of HpSt-G23 in the system is 0.05–0.12 U / μL; The fluorescent dye is SYBR Green I, EvaGreen, SYTO-9, or SYTO-82.
7. The application of the LAMP / RT-LAMP reaction kit as described in claim 5 or 6 in nucleic acid detection for non-diagnostic purposes, characterized in that: The conditions for the nucleic acid test are 60–65℃ for 60 minutes; The samples used for nucleic acid testing include RNA virus samples or plasmid samples containing viral DNA; The nucleic acid test sample contains at least one of urea, NaCl, SYBR Green I, and whole blood; wherein the concentration of urea is less than 1.5 mol / L, the concentration of NaCl is less than 85 mmol / L, the concentration of SYBR Green I is less than 2×, and the concentration of whole blood is less than 6% v / v.
8. A RecA-HpSt-G23 reaction kit, characterized in that: It contains nuclease-free water, reaction buffer, primers, dNTPs, ATP, betaine, spermidine, TthRecA, and HpSt-G23 as described in claim 1.
9. The RecA-HpSt-G23 reaction kit according to claim 8, characterized in that: The reaction buffer solution has the following composition: 20±10 mmol / L Tris-HCl, 70±15 mmol / L KCl, 20±10 mmol / L (NH4)2SO4, 5±2 mmol / L MgSO4, pH 8.8±0.4; The primer composition is as follows: 1.2–1.6 μmol / L FIP / BIP; The enzyme activity of HpSt-G23 in the system is 0.05–0.12 U / μL; The concentration of TthRecA in the system is 2–8 ng / μL; The concentration of the dNTPs in the system was 0.6–1.2 mmol / L; The concentration of ATP in the system is 0.1–1.2 mmol / L; The concentration of betaine in the system is 0.6–1.0 mol / L; The concentration of spermidine in the system is 0.4–0.8 mmol / L.
10. The use of the LAMP / RT-LAMP reaction kit according to any one of claims 5-6 or the RecA-HpSt-G23 reaction kit according to any one of claims 8-9 in nucleic acid detection for non-diagnostic purposes, characterized in that: The conditions for the nucleic acid test are 60–65℃ for 60 minutes; The samples used for nucleic acid testing include RNA virus samples or plasmid samples containing viral DNA.
Citation Information
Patent Citations
Bst DNA polymerase mutant, fusion protein and application thereof
CN116463312A
Bst DNA enzyme mutant based on point mutation and application thereof
CN117866917A