SgRNA sequence targeting IGFL3 gene and application of sgRNA sequence in improvement of radiosensitivity of glioblastoma

Abstract

The invention relates to a sgRNA sequence for targeted knockout of IGFL3 gene and application of the sgRNA sequence in improvement of radiosensitivity of glioblastoma, and belongs to the technical field of biology. The sequence of the sgRNA is IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (clustered regularly interspaced short palindromic repeats) vector of which the IGFL3 gene is knocked out in a targeted manner is constructed by utilizing the sgRNA. The vector is transfected into a human glioblastoma cell U251, the IGFL3 gene can be efficiently knocked out from the cell through identification, and two strains of IGFL3 gene knocked-out U251 cell lines are obtained through screening. Through targeted knockout of the IGFL3 gene, the radiosensitivity of the human glioblastoma cell U251 can be effectively improved, a foundation is laid for researching the effect of the IGFL3 gene in the radiosensitivity of the glioblastoma, and a powerful tool is provided for developing the gene as a potential molecular target for improving the radiosensitivity of the glioblastoma.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an sgRNA sequence targeting the IGFL3 gene and an application thereof in improving the radiosensitivity of glioblastoma. Background Art

[0002] Glioblastoma is the most common and most malignant primary brain tumor in the central nervous system, classified as grade IV glioma according to the WHO classification. It is characterized by rapid growth, strong invasiveness, easy recurrence, and high tolerance to existing treatments.

[0003] Radiotherapy is an important part of the standard treatment of glioblastoma and is usually used in combination with surgical resection and chemotherapy. Its main purpose is to remove residual lesions or tumor tissue that cannot be completely removed after surgery, thereby prolonging the patient's survival time and improving prognosis. However, glioblastoma shows significant tolerance to radiotherapy (i.e., radioresistance). This characteristic severely limits the effectiveness of radiotherapy, not only becoming one of the main reasons for treatment failure, but also leading to a high recurrence rate of tumors, posing a great challenge to the long-term survival of patients. Therefore, it is of practical importance and urgency to find potential targets to enhance radiosensitivity and clarify the mechanism of radioresistance.

[0004] Insulin-like growth factor 3 (IGF like family member 3, IGFL3) belongs to the insulin-like growth factor family, which plays a key role in cellular energy metabolism, growth and development (especially in the fetal period). Studies have shown that IGFL3 may respond to TGF-β signals and its expression can be upregulated under its stimulation; the IGFL3 gene is significantly downregulated during human gingival healing; while in the skin of Pparg gene knockout mice, the IGFL3 gene is significantly upregulated; in addition, IGFL3 is upregulated in uterine leiomyoma, and is involved in the immune system, angiogenesis, invasion, metabolic changes, and extracellular matrix deposition, which may be related to the dysregulation of TGF-β3 and Wnt / β-catenin pathways. Up to now, there are few studies on the IGFL3 gene at home and abroad, and its mechanism of action in tumor occurrence and development is still unclear, and there are no related studies on the IGFL3 gene in tumor radiosensitivity. Summary of the invention

[0005] The purpose of the present invention is to provide a sgRNA sequence targeting the IGFL3 gene and its application in improving the radiosensitivity of glioblastoma. By efficiently targeting and knocking out the IGFL3 gene, the role of the gene in the radiosensitivity of glioblastoma is clarified, laying the foundation for clarifying whether the gene can become a potential target for improving radiosensitivity.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A sgRNA sequence for targeted knockout of the IGFL3 gene, wherein the sgRNA sequence is IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and the nucleotide sequence thereof is as follows: IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT; IGFL3-sgRNA-3:GCAGGTGGAGCCACAGCGGC.

[0007] A cell for targeted knockout of the IGFL3 gene, wherein the IGFL3 gene of human glioblastoma cell U251 is knocked out using the CRISPR / Cas9 system.

[0008] A method for improving the radiosensitivity of human glioblastoma cells U251, comprising the steps of knocking out the IGFL3 gene of human glioblastoma cells U251.

[0009] Furthermore, the above method utilizes the CRISPR / Cas9 system to knock out the IGFL3 gene.

[0010] Application of the above sgRNA sequence in improving the radiosensitivity of human glioblastoma cells U251.

[0011] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention designs two highly efficient knockout sgRNA sequences for the IGFL3 gene. The gene knockout efficiency test shows that the present invention can achieve highly efficient knockout of the IGFL3 gene in human glioblastoma cells U251, which lays a foundation for further studying the function of this gene.

[0012] (2) The targeted knockout of IGFL3 gene by the present invention can effectively improve the radiosensitivity of human glioblastoma cells U251, providing a solid foundation for further development of IGFL3 gene as a potential target for improving radiosensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a graph showing changes in IGFL3 mRNA expression in human glioblastoma cells U251 after treatment with gradient dose X-rays.

[0014] Figure 2 This is a GEO analysis of the differential expression of IGFL3 mRNA in radioresistant (U251-RR) and wild-type (U251-WT) human glioblastoma cells U251.

[0015] Figure 3This is a graph showing changes in IGFL3 protein expression in human glioblastoma cells U251 after treatment with 5 Gy X-rays.

[0016] Figure 4 It is a schematic diagram of the sgRNA sequence targeting the third exon of the IGFL3 gene.

[0017] Figure 5 This is a schematic diagram of the structure of the pLVR-sgRNAs-CMV-Cas9 gene knockout vector; its main functional elements include: 5'-LTR and 3'-LTR (long terminal repeat sequences); U6 and CMV promoters (driving sgRNA and Cas9 expression, respectively); Esp3I restriction site and sgRNA insertion site; Cas9 gene (encoding CRISPR / Cas9 nuclease); SV40 nuclear localization signal; GFP gene (green fluorescent protein gene); IRES (internal ribosome entry site for co-expression); Neo gene (neomycin resistance gene); WPRE (hepatitis virus post-transcriptional regulatory element); Amp resistance gene (ampicillin resistance gene); and pUC Ori (replication origin).

[0018] Figure 6 This is the electrophoresis identification diagram of the PCR product of the colony transformed with the IGFL3 gene knockout vector.

[0019] Figure 7 This is a diagram showing the efficiency of gene knockout identified by Western blot after IGFL3 gene knockout in human glioblastoma cells U251.

[0020] Figure 8 This is a statistical graph showing the effect of IGFL3 gene knockout on the clone formation rate of human glioblastoma cells U251 after gradient X-ray irradiation.

[0021] Fig. 9 This figure shows the effect of IGFL3 gene knockout on apoptosis of human glioblastoma U251 cells after X-ray treatment. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. It should be clear that the embodiments are only part of the present invention, not all of it. Without involving creative work, other embodiments that can be obtained by those skilled in the art are within the scope of protection of the present invention. Therefore, the following detailed description based on the drawings is only an example and does not limit the scope of protection of the present invention.

[0023] Table 1 Main reagents involved in the present invention Example 1 Screening of differentially expressed gene IGFL3 (Gene ID: 388555) after X-ray treatment of human glioblastoma cells U251 1. Changes in IGFL3 mRNA expression in human glioblastoma U251 cells after gradient-dose X-ray treatment U251 cells were seeded in 6-well plates and irradiated with X-rays when the cells were in the logarithmic growth phase. The irradiation equipment was a Varian Clinac 600C linear accelerator from the United States, with a dose rate of 500 MU / min and irradiation doses of 0, 1, 3, 5, 7, and 9 Gy, respectively. Six hours after irradiation, total RNA of the cells was extracted by the Trizol method, and the extracted total RNA was reverse transcribed to generate cDNA. The specific operation was as follows: 2 μg of total RNA was added to a PCR tube, preheated at 70°C for 5 minutes, and then quickly cooled on ice. According to Table 2, the required components were added, the final reaction volume was adjusted to 20 μL, and the mixture was thoroughly mixed and centrifuged. The sample was then placed in a PCR instrument for amplification, and the program was set as follows: 25°C for 5 minutes, 42°C for 60 minutes, 72°C for 15 minutes, and finally placed at 4°C until the reaction was completed.

[0024] Table 2 Reverse transcription system The obtained cDNA was diluted 5 times and then subjected to real-time quantitative PCR detection. The primer sequences used to detect the target gene IGFL3 and the β-Actin internal reference were: IGFL3-F: 5′-TGCTGTCCCGAGTCTTTTGG-3′ (SEQ ID NO. 1); IGFL3-R: 5′-ATGGGAGATAAGTGACACTGAGA-3′ (SEQ ID NO. 2); β-Actin-F: 5′-AGAGCTACGAGCTGCCTGAC-3′ (SEQ ID NO.3); β-Actin-R: 5′-AGCACTGTGTTGGCGTACAG-3′ (SEQ ID NO. 4).

[0025] The real-time quantitative PCR reaction system is shown in Table 3. The amplification reaction program is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, +0.15°C / s, 95°C for 1 s.

[0026] Table 3 Real-time quantitative PCR reaction components PCR quantitative results are as follows Figure 1 As shown in the figure, different doses of X-ray irradiation caused different degrees of upregulation of IGFL3 mRNA expression in human glioblastoma U251 cells, among which the upregulation in the 5 Gy dose group was the most significant (** P <0.01).

[0027] Further analysis was performed by GEO (GSE206917), and the results are shown in Figure 2 Compared with wild-type human glioblastoma cells U251 (U251-WT), the IGFL3 mRNA expression level in radioresistant human glioblastoma cells U251 (U251-RR) was significantly higher than that in the former (**** P <0.0001).

[0028] 2. Changes in IGFL3 protein expression in human glioblastoma U251 cells after 5 Gy X-ray treatment Depend on Figure 1 The results showed that IGFL3 mRNA reached a peak after 5 Gy X-ray treatment, so 5 Gy dose was selected to irradiate U251 cells. After 48 hours, total protein was extracted using RIPA lysis buffer, and IGFL3 protein level was quantitatively analyzed by Western blot. The steps of Western blot are as follows: 1) After quantifying protein using the BCA method, take an equal amount of sample and load it onto the SDS-PAGE gel. At the beginning of electrophoresis, adjust the voltage to 100V and run for about 20 minutes. After the sample is compressed to the same horizontal line of the separation gel, adjust the voltage to 150V and continue electrophoresis until the bromophenol blue indicator runs to the bottom of the gel.

[0029] 2) Transfer the protein to a 0.22 μm pore size NC membrane using the S-TRANS Rapid Transfer Kit. Block the membrane with 5% skim milk powder (dissolved in Tris-HCl buffer (TBST)) for 1 hour at room temperature. Wash the membrane three times with TBST for 5 minutes each time.

[0030] 3) Dilute the primary antibody Anti-IGFL3 with 1% BSA and incubate overnight at 4°C. Wash the membrane three times with TBST the next day, 5 minutes each time.

[0031] 4) Dilute the secondary antibody with 1% BSA and incubate at room temperature for 1 hour. Then wash with TBST 3 times, 10 minutes each time. Finally, add ECL chemiluminescent reagent and image using chemiluminescent imaging system.

[0032] like Figure 3As shown in Figure 2, compared with the control group (Cont), 5 Gy X-ray treatment also significantly increased the expression level of IGFL3 protein in U251 cells, and the difference was statistically significant (** P <0.01).

[0033] In conclusion, X-ray irradiation can upregulate the expression of IGFL3 mRNA and protein, and it is speculated that IGFL3 is closely related to the radiosensitivity of human glioblastoma U251 cells.

[0034] Example 2 IGFL3 gene knockout in human glioblastoma cells U251 1. Design sgRNA Four sgRNAs targeting the third exon of the IGFL3 gene (Gene ID: 388555) were designed, and their sequences are as follows: IGFL3-sgRNA-1:GCCAGCCGACACCCAGGTGT (SEQ ID NO.5); IGFL3-sgRNA-2:GGTCTCCTTTAAGGATAAGA (SEQ ID NO. 6); IGFL3-sgRNA-3:GCAGGTGGAGCCACAGCGGC (SEQ ID NO.7); IGFL3-sgRNA-4: GAAGTTTCTTGTGAAGTTGA (SEQ ID NO. 8).

[0035] The schematic diagram of the above sgRNA sequence targeting the third exon of IGFL3 gene is shown in Figure 4 .

[0036] Add "ATCCg" to the 5' end of the sgRNA to obtain the forward oligonucleotide sequence; according to the principle of base complementary pairing, the complementary chain of the sgRNA is obtained, AAAC is added to the 5' end of the complementary chain to obtain the reverse oligonucleotide sequence, and "c" is added to the 3' end.

[0037] Table 4 Forward and reverse oligonucleotide sequences 2. Construction of gene knockout vector 1) Dilute the designed paired oligonucleotide single-stranded dry powder in Table 4 to 10 μM with nuclease-free water, take 20 μL of each and mix well, heat at 90°C for 10 minutes to denature them, and then cool naturally at room temperature to complete annealing. After annealing, a small double-stranded DNA fragment containing the Esp3I restriction site is formed, and its end has a sticky restriction site; 2) CRISPR / Cas9 gene knockout vector (pLVR-sgRNAs-CMV-Cas9, such as Figure 5 The enzyme digestion reaction was performed using Esp3I restriction endonuclease (shown in Figure 1). The digestion system included: 1 μL Esp3I enzyme, 2 μL 10× buffer, 1 μL plasmid DNA, 1 μL DTT (10 mM), and nuclease-free water was added to make the total reaction volume 20 μL. After mixing, incubate at 37°C overnight. After digestion, a linearized CRISPR / Cas9 vector large fragment (pLVR-sgRNAs-CMV-Cas9) with corresponding sticky ends was obtained. 3) The linearized CRISPR / Cas9 vector large fragment with corresponding sticky ends was connected to the small double-stranded DNA fragment in step 1). The connection reaction was carried out at 16°C overnight. The specific reaction system is shown in Table 5.

[0038] Table 5 Reaction system 4) Transformation of vector into DH5α Escherichia coli After thawing 50 μL of E. coli competent cells on ice, add the above overnight ligation product, mix gently and place on ice for 30 minutes. Subsequently, heat shock the reaction mixture at 42°C for 90 seconds, quickly transfer it back to ice and continue to place on ice for 2 minutes. Next, add 400 μL of LB liquid culture medium and place it in a 37°C constant temperature shaker at 180 rpm for 1 hour. After cultivation, take the bacterial solution and evenly spread it on the surface of LB solid culture medium containing 100 μg / mL Amp. After the culture medium absorbs the bacterial solution, turn the culture dish upside down and incubate it at 37°C overnight.

[0039] 5) PCR identification of positive colonies The single clone colony was picked up with a pipette tip and placed in 1 mL of LB medium containing 100 μg / mL Amp. After culturing in a shaker at 180 rpm and 37°C for about 6 h, PCR identification was performed. The upstream primers were the positive sequences of the above sgRNA sequences, namely sgRNA-1-F (ATCCG GCAGGTGGAGCCACAGCGGC), sgRNA-2-F (ATCCG GCCAGCCGACACCCAGGTG), sgRNA-3-F (ATCCGGGTCTCCTTTAAGGATAAGA), and sgRNA-4-F (ATCCG GAAGTTTCTTGTGAAGTTGA). The downstream primers used the plasmid universal sequence (5'-CATCGCGAAGCAGCGCAAAAC -3') (SEQ ID NO.9). The PCR amplification system is shown in Table 6.

[0040] Table 6 PCR amplification system The PCR amplification procedure was as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 45 seconds, for 35 cycles; finally, after extension at 72°C for 7 minutes, the temperature was lowered to 12°C and maintained for 20 minutes. 5 μL of the amplified product was analyzed by electrophoresis using a 2% agarose gel, and the electrophoresis conditions were set to 150V for 20 minutes. Electrophoresis results (see Figure 6 ) showed that the positive clone showed a clear amplification band at the 167 bp position. Bacteria were picked from the positive clones in the initial screening and further sequenced to confirm the accuracy of the sequence.

[0041] 6) Positive clone amplification and plasmid vector extraction According to the identification results, the positive bacteria were inoculated into LB liquid medium containing 100 μg / mL Amp at a dilution ratio of 1:100, and cultured overnight at 180 rpm in a 37°C constant temperature shaker. Take 10-15 mL of the above-mentioned overnight culture solution, separate and purify the plasmid DNA according to the operating procedures of the endotoxin-free plasmid midi extraction kit, and measure the concentration and purity.

[0042] 3. IGFL3 gene knockout in human glioblastoma U251 cells 1) Cell transfection U251 cells were seeded in 6-well plates one day in advance, and the cell density increased to about 70% the next day. 1.5 μg of empty vector or 4 different CRISPR / Cas9 gene knockout vectors (pLVR-sgRNA-1-CMV-Cas9, pLVR-sgRNA-2-CMV-Cas9, pLVR-sgRNA-3-CMV-Cas9, and pLVR-sgRNA-4-CMV-Cas9) were added to 150 μL serum-free DMEM for dilution and mixing to prepare nucleic acid dilution solution. Subsequently, 9 μL TGfect transfection reagent was added to the nucleic acid dilution solution, mixed thoroughly, and allowed to stand for 5 minutes to form a transfection complex. The prepared transfection complex was added to 2 mL of cell culture medium containing complete culture medium per well, gently mixed, and incubated in a 37°C, 5% CO2 incubator. After 24 hours of culture, the culture medium was replaced; after 48 hours, Neomycin was added at a final concentration of 800 μg / mL for screening. After about 1 week, when most of the cells have died, the culture medium is replaced with a medium containing 100 μg / mL Neomycin, and the cells are cultured until they return to normal. The recovered cells are digested with trypsin, resuspended and counted, and then inoculated into a 96-well plate using a single cell dilution method. After about 7 days, the wells containing monoclonal cells are screened and marked. After the monoclonal cells grow to the bottom of the well, they are digested and transferred to a 24-well plate for expansion and culture; when the cells in the 24-well plate reach confluence, they are digested again and transferred to a 6-well plate for further expansion.

[0043] 2) Western blot to identify the knockout efficiency of IGFL3 gene When the U251 cells in the 6-well plate grew to confluence, the cells were trypsinized and centrifuged. After the cell pellet was collected, 1 / 3 was used for protein extraction. The extracted protein sample was analyzed by Western blot for the knockout efficiency of the IGFL3 gene (see Figure 7 ). Among them, the wild-type U251 cells transfected with the empty vector were named WT, and the U251 cell clones transfected with four different IGFL3 gene knockout vectors were named sg1, sg2, sg3, and sg4. The results showed that the expression of IGFL3 protein was not detected in the cells of sg1 and sg3, indicating that the IGFL3-sgRNA-1 sequence and IGFL3-sgRNA-3 sequence can effectively knock out the IGFL3 gene. These two groups of cells were used for subsequent gene function studies.

[0044] Example 3 Effect of IGFL3 gene knockout on the radiosensitivity of human glioblastoma U251 cells 1. Effect of IGFL3 gene knockout on the clone formation of human glioblastoma U251 cells under X-ray irradiation The clone formation experiment is often used to evaluate the radiosensitivity of tumor cells. Wild-type U251 cells (WT) and IGFL3 gene knockout U251 cells (sg1, sg3) in the logarithmic growth phase were inoculated into 12-well plates, with 250 cells per well, and 1 mL of complete culture medium was added. After the cells adhered, they were irradiated with different doses of X-rays of 0, 1, 3, and 5 Gy. After about 14 days, the clone formation rate was evaluated by crystal violet staining. The results are shown in Figure 2. Figure 8 As shown in the figure, different doses of X-ray treatment gradually reduced the clone formation rate of cells in each group in a dose-dependent manner. Under 5 Gy irradiation, the clone formation rate of cells in the IGFL3 gene knockout group (sg1 and sg3) was significantly lower than that in the wild-type group, and the difference was statistically significant (* P <0.05,** P <0.01).

[0045] 2. Effect of IGFL3 gene knockout on apoptosis of human glioblastoma U251 cells under X-ray irradiation U251 cells in the logarithmic growth phase were seeded into 6-well plates and irradiated with 5 Gy X-rays when the cells reached 70-80% density. After 48 hours, the cells were trypsinized and washed, and then analyzed by flow cytometry using Annexin V / 7-AAD staining. Fig. 9 As shown, after 5 Gy irradiation, the apoptosis rate of cells in the IGFL3 gene knockout group (sg1, sg3) was significantly higher than that in the wild-type WT group.

[0046] In summary, the present invention provides two highly efficient IGFL3 gene targeting sgRNA sequences, which provide a solid foundation for constructing an IGFL3 gene knockout model. By targeting and knocking out the IGFL3 gene of human glioblastoma cells U251, and subjecting the cells to X-ray irradiation, the results show that after the gene is knocked out, the cell's cloning ability is significantly reduced and the cell apoptosis rate is significantly increased, indicating that IGFL3 gene knockout can enhance the radiosensitivity of U251 cells. This invention provides strong support for in-depth research on the role of the IGFL3 gene in the radiosensitivity of glioblastoma and its development as a potential target for improving radiosensitivity.

[0047] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A sgRNA sequence for targeted knockout of the IGFL3 gene, characterized in that: The sgRNA sequence is IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and its nucleotide sequence is as follows: IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT; IGFL3-sgRNA-3:GCAGGTGGAGCCACAGCGGC.

2. A cell for targeted knockout of IGFL3 gene, characterized in that: The IGFL3 gene was knocked out in human glioblastoma U251 cells using the CRISPR / Cas9 system.

3. A method for improving the radiosensitivity of human glioblastoma cells U251, characterized in that: The IGFL3 gene was knocked out in human glioblastoma U251 cells.

4. The method according to claim 3, characterized in that: The IGFL3 gene was knocked out using the CRISPR / Cas9 system.

5. Use of the sgRNA sequence as claimed in claim 1 in improving the radiosensitivity of human glioblastoma cells U251.

Images