The invention relates to 2apos; -fluoro-2apos,-fluoro-2apos; -deoxynucleoside-5apos,-deoxynucleoside-5apos; enzymatic synthesis method and application of-triphosphoric acid

Abstract

The invention discloses a synthetic method of 2 '-fluoro-2'-deoxynucleosid-5 '-triphosphoric acid and application of the 2'-fluoro-2 '-deoxynucleosid-5'-triphosphoric acid. The synthesis method comprises the following steps: reacting in a system containing adenosine triphosphate, 2 '-fluoro-2'-deoxynucleoside, metal ions and deoxynucleoside kinase to obtain 2 '-fluoro-2'-deoxynucleoside-5 '-phosphoric acid; and reacting in a system containing polyphosphoric acid, 2 '-fluoro-2'-deoxynucleoside-5 '-phosphoric acid, metal ions and polyphosphate kinase to obtain 2'-fluoro-2 '-deoxynucleoside-5'-triphosphoric acid. The obtained 2 '-fluoro-2'-deoxynucleoside-5 '-triphosphoric acid can be used for preparing heterologous nucleic acid. The invention provides an economic and green new way for synthesis of 2 '-fluoro-2'-deoxynucleoside-5 '-triphosphate, solves the problems of complex steps, non-environment-friendly reagents and high cost in the existing chemical synthesis method, and provides a thought for preparation of nucleotide derivatives.

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry, and in particular to an enzymatic synthesis method of 2'-fluoro-2'-deoxynucleoside-5'-triphosphate and its application. Background Art

[0002] Natural nucleic acids, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are indispensable components of life as carriers for the storage and transmission of genetic information. In addition, single-stranded nucleic acids can fold to form stable tertiary structures with molecular binding ability and reaction catalytic activity. These functional nucleic acid molecules, such as aptamers and ribozymes, have become extremely valuable tools in various research fields such as chemical biology and molecular medicine. However, the four structural units limit the diversity of the intrinsic chemical structure of natural nucleic acids. Therefore, natural nucleic acid analogs containing various chemical modifications, namely XNA, have gradually attracted great attention from researchers. Since these modifications give nucleic acids different physical and chemical properties, the application range of nucleic acids in the fields of biology, medicine and nanomaterials has been expanded. Modification of bases can regulate the strength and specificity of base pairing and provide sites for coupling nucleic acids with other molecules. Modification of the phosphodiester backbone can enhance resistance to nucleases and pharmacokinetic properties. Modification of sugar groups will have a significant impact on various properties of nucleic acids, such as double-strand formation ability, nuclease resistance and toxicity to cells and animals. Through chemical synthesis methods, different substituents such as fluorine (2'-fluoro), chlorine (2'-chloro), azide (2'-azido), amino (2'-amino) and methoxy (2'-methoxy) can be introduced into the 2'-position of ribose. Among them, 2'-F modification is one of the most common modifications at the 2'-position of ribose. Currently, a variety of nucleic acids containing 2'-F modification have been approved by the FDA for the treatment of hypercholesterolemia (Leqvio), macular degeneration (Macugen), etc.

[0003] At present, the synthesis of XNA mainly relies on chemical solid phase synthesis, which involves repeated coupling, capping, oxidation and deprotection steps, and the synthesis and purification process requires the use of a large amount of organic solvents, resulting in low atomic efficiency, environmental unfriendliness, and difficulty in meeting the needs of large-scale applications. Enzymes, as green and efficient biocatalysts, have gradually been used in the production of various high-value compounds. In recent years, a variety of polymerases have been developed for the synthesis of XNA, and the process of enzymatic synthesis of XNA is inseparable from the use of modified nucleoside triphosphates. The traditional synthesis method of nucleoside triphosphates mainly relies on chemical synthesis, involving multiple steps of protection, deprotection and purification, with cumbersome steps and low stereoselectivity and yield. Therefore, it is necessary to develop a green and efficient biosynthetic pathway for the synthesis of modified nucleoside triphosphates. Summary of the invention

[0004] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an enzymatic synthesis method of 2'-fluoro-2'-deoxynucleoside triphosphates. The method overcomes several shortcomings of traditional chemical synthesis and realizes the enzymatic green synthesis of 2'-F-NTPs under green and mild reaction conditions; The second object of the present invention is to provide a method for synthesizing non-natural nucleic acids (XNA) by enzymatically synthesizing 2'-fluoro-2'-deoxynucleoside-5'-triphosphate.

[0005] The purpose of the present invention is achieved through the following technical solutions: A method for synthesizing 2'-fluoro-2'-deoxynucleoside-5'-triphosphate comprises the following steps: S1. Reaction in a system containing adenosine triphosphate (ATP), 2'-fluoro-2'-deoxynucleoside, divalent metal ions and deoxynucleoside kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-monophosphate; S2. Reaction in a system containing polyphosphoric acid, the 2'-fluoro-2'-deoxyribonucleoside-5'-monophosphate obtained in step S1, a divalent metal ion and polyphosphate kinase to obtain 2'-fluoro-2'-deoxyribonucleoside triphosphates (2'-F-NTPs).

[0006] Further, the 2'-fluoro-2'-deoxynucleoside-5'-triphosphate includes at least one of 2'-fluoro-2'-deoxyadenosine-5'-triphosphate (2'-F-ATP), 2'-fluoro-2'-deoxyuridine-5'-triphosphate (2'-F-UTP), 2'-fluoro-2'-deoxycytidine-5'-triphosphate (2'-fluoro-2'-deoxycytidine-5'-triphosphate, 2'-F-CTP) and 2'-fluoro-2'-deoxyguanosine-5'-triphosphate (2'-F-GTP).

[0007] Furthermore, the concentration of ATP in the system in step S1 is 1-20 mM; furthermore, 12 mM.

[0008] Furthermore, the 2'-fluoro-2'-deoxynucleoside in step S1 includes at least one of 2'-fluoro-2'-deoxyadenosine (2'-FA), 2'-fluoro-2'-deoxyuridine (2'-FU), 2'-fluoro-2'-deoxycytidine (2'-FC) and 2'-fluoro-2'-deoxyguanosine (2'-FG).

[0009] Furthermore, the concentration of the 2'-fluoro-2'-deoxynucleoside in the system in step S1 is 5 to 20 mM; furthermore, 10 mM.

[0010] Furthermore, the divalent metal ion in step S1 is a magnesium ion, which is provided by a magnesium salt, and further provided by magnesium chloride.

[0011] Furthermore, the concentration of the divalent metal ions in step S1 in the system is 1 to 100 mM; further, 50 mM.

[0012] Furthermore, the deoxynucleoside kinases described in step S1 include but are not limited to those derived from Drosophila melanogaster ( Drosophila melanogaster ) of deoxynucleoside kinase ( Dm dNK) and a mutant deoxynucleoside kinase whose enzyme activity is not downregulated; further, the deoxynucleoside kinase Dm dNK is a C-terminal truncated form of wild-type deoxynucleoside kinase of Drosophila melanogaster, and its amino acid sequence is shown in SEQ ID No. 4; further, the deoxynucleoside kinase Dm The nucleotide sequence of the gene encoding dNK is shown in SEQ ID No.1.

[0013] Further, the deoxynucleoside kinase described in step S1 Dm The concentration of dNK in the system was 3-9 μM; further, it was 6 μM.

[0014] Furthermore, the system described in step S1 also includes 20-50 mM Tris-HCl at pH 5.0-10.0 and 1-150 mM KCl; further includes 50 mM Tris-HCl at pH 8.0 and 100 mM KCl.

[0015] Furthermore, the system described in step S1 also includes water; further, the water includes ddH2O.

[0016] Furthermore, the reaction in step S1 is carried out at a temperature of 30 to 37° C. for 1 to 10 h; further, at a temperature of 37° C. for 3 h.

[0017] Furthermore, the polyphosphoric acid in step S2 is sodium hexametaphosphate (polyP6).

[0018] Furthermore, the concentration of the polyphosphoric acid in step S2 in the system is 1-10 mM; further, 4 mM.

[0019] Further, the 2'-fluoro-2'-deoxynucleoside-5'-monophosphate in step S2 includes at least one of 2'-fluoro-2'-deoxyadenosine-5'-monophosphate (2'-F-AMP), 2'-fluoro-2'-deoxyuridine-5'-monophosphate (2'-F-UMP), 2'-fluoro-2'-deoxycytidine-5'-monophosphate (2'-F-CMP) and 2'-fluoro-2'-deoxyguanosine-5'-monophosphate (2'-F-GMP).

[0020] Furthermore, the concentration of the 2'-fluoro-2'-deoxynucleoside monophosphate in the system in step S2 is 1-10 mM; furthermore, 2 mM.

[0021] Furthermore, the divalent metal ion in step S2 is a magnesium ion, which is provided by a magnesium salt, and further provided by magnesium chloride.

[0022] Furthermore, the concentration of magnesium ions in the system in step S2 is 20-100 mM; further, 20 mM.

[0023] Furthermore, the polyphosphate kinase described in step S2 includes but is not limited to the polyphosphate kinase derived from Thermus rubrum ( Meiothermus ruber ) of polyphosphate kinase ( Mr PPK) and a mutant polyphosphate kinase whose enzyme activity is not downregulated; further, the polyphosphate kinase in step S2 includes a polyphosphate kinase derived from Thermus subspinosa Mr PPK and polyphosphate kinase mutants MrPPK (D127N) at least one; the polyphosphate kinase Mr The amino acid sequence of PPK is shown in SEQ ID No.5. Mr The amino acid sequence of PPK (D127N) is shown in SEQ ID No. 6; further, the polyphosphate kinase Mr The nucleotide sequence of the gene encoding PPK is shown in SEQ ID No. 2. The polyphosphate kinase mutant Mr The nucleotide sequence of the gene encoding PPK (D127N) is shown in SEQ ID No.3.

[0024] Furthermore, the concentration of the polyphosphate kinase in step S2 in the system is 1-5 μM; further, 1 μM.

[0025] Furthermore, the system described in step S2 also includes 10-100 mM Tris-HCl at pH 5.0-10.0; and further includes 20 mM Tris-HCl at pH 8.0.

[0026] Furthermore, the system described in step S2 also includes water; further, the water includes ddH2O.

[0027] Furthermore, the reaction in step S2 is carried out at a temperature of 30 to 80° C. for 1 to 12 h; further at a temperature of 37° C. for 4 to 12 h.

[0028] Application of the 2'-fluoro-2'-deoxynucleoside-5'-triphosphate obtained by the preparation method in the preparation of 2'-fluoro-modified heterologous nucleic acid.

[0029] Furthermore, the application comprises the following steps: S3. Obtaining a non-natural nucleic acid by a primer extension reaction in a system comprising a template, a primer, 2'-fluoro-2'-deoxynucleoside-5'-triphosphate obtained by the above preparation method and a Pfu DNA polymerase mutant.

[0030] Furthermore, the 2'-fluoro-2'-deoxynucleoside-5'-triphosphate is prepared by the above method.

[0031] Further, the Pfu DNA polymerase mutant is a Pfu DNA polymerase mutant P1 exo - ; has been disclosed in “2024101647614-Pfu DNA polymerase mutant with XNA recognition and synthesis activity and its application”.

[0032] Compared with the prior art, the present invention has the following advantages and effects: The present invention proposes an enzymatic synthesis method for synthesizing 2'-F-NTPs using deoxynucleoside kinase and polyphosphate kinase and mutants thereof, which overcomes several shortcomings of traditional chemical synthesis. The method realizes the enzymatic green synthesis of 2'-F-NTPs under mild reaction conditions, provides a new technical approach for the synthesis of modified nucleoside triphosphates, and also provides a more convenient and economical source of raw materials for the synthesis of XNA. Among them, the synthesis of 2'-fluoro-2'-deoxyadenosine-5'-triphosphate and 2'-fluoro-2'-deoxycytidine-5'-triphosphate uses wild-type Thermus rubrum polyphosphate kinase ( Mr PPK); 2'-fluoro-2'-deoxyuridine-5'-triphosphate and 2'-fluoro-2'-deoxyguanosine-5'-triphosphate were synthesized using wild-type Thermus rubrum polyphosphate kinase ( Mr PPK) mutant strain Mr PPK (D127N). BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is used Dm dNK and Mr Technology roadmap for PPK synthesis of 2'-F-NTPs and its partial applications.

[0034] Figure 2 It is used Dm HPLC analysis results of the products of four 2'-F-NMPs synthesized by dNK. Dm Figure 4 shows the HPLC analysis results of the product of 2'-F-AMP generated by 2'-FA phosphorylation catalyzed by dNK; B is Dm HPLC analysis results of the product of dNK-catalyzed 2'-FU phosphorylation to generate 2'-F-UMP; C is Dm HPLC analysis results of the product of 2'-F-CMP generated by dNK-catalyzed 2'-FC phosphorylation; D is Dm HPLC analysis results of the product of dNK-catalyzed 2'-FG phosphorylation to generate 2'-F-GMP.

[0035] Figure 3 It is used Mr PPK or Mr HPLC analysis results of the products synthesized by PPK (D127N) for four 2'-F-NTPs. Mr The HPLC analysis result of the product of PPK catalyzing the phosphorylation of 2'-F-AMP to generate 2'-F-ATP; B is Mr HPLC analysis results of the product of 2'-F-UTP generated by phosphorylation of 2'-F-UMP catalyzed by PPK (D127N); C is MrThe HPLC analysis result of the product of PPK catalyzing the phosphorylation of 2'-F-CMP to generate 2'-F-CTP; D is Mr HPLC analysis results of the product of PPK (D127N) catalyzing the phosphorylation of 2'-F-GMP to produce 2'-F-GTP.

[0036] Figure 4 The results of gel electrophoresis analysis of the products synthesized by the enzyme catalysis method of this patent using 2'-F-NTPs as substrates for synthesizing XNA; wherein A is the results of gel electrophoresis analysis of the reaction products using T-A6 and T-U6 as templates, B is the results of gel electrophoresis analysis of the reaction products using T-C6 and T-G6 as templates, and C is the results of gel electrophoresis analysis of the reaction products using T-X10 as templates; in Figures A, B, and C, FAM-P8-R is a primer control, lanes 1 and 5 are primer controls, lanes 2 and 6 are full-length DNA products synthesized using commercial dNTPs as substrates; lanes 3 and 7 are full-length XNA products synthesized using commercial 2'-F-NTPs; lanes 4 and 8 are full-length XNA products synthesized using 2'-F-NTPs as substrates synthesized by enzymatic method and separated and purified by HPLC. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0038] The biological materials used in the examples: Escherichia coli DH5α, Escherichia coli BL21 (DE3) pLysS can be purchased through conventional commercial channels; plasmid pET-28a (+)- Dm dNK and pET-28a(+)- Mr PPK2-WT was synthesized by Genewise Biotechnology Co., Ltd., pET28a(+)- Dm The sequence of dNK is shown in SEQ ID NO. 7; pET-28a(+)- Mr The sequence of PPK2-WT is shown in SEQ ID NO. 8. The expression strain of the Pfu DNA polymerase mutant is BL21(DE3) pLysS / pET-28a(+)-P1exo-; Pfu DNA polymerase mutant (P1 exo - ) is the DNA polymerase expressed by BL21(DE3) pLysS / pET-28a(+)-P1 exo-. Dm dNK is derived from Drosophila melanogaster, the sequence of its coding gene is shown in SEQ ID No.1, and its amino acid sequence is shown in SEQ ID No.4.Mr PPK2 is derived from Thermus subsp. aeruginosa, and the sequence of its coding gene is shown in SEQ ID No. 2, and its amino acid sequence is shown in SEQ ID No. 5.

[0039] Example 1. Mr Construction of PPK (D127N) recombinant expression strain 1 、 pET-28a(+)- Mr Construction of PPK2-D127N plasmid Mr PPK mutant strain Mr PPK (D127N) adopts PrimeSTAR ® HS DNA polymerase, Mr PPK2-WT gene was used as template for conventional overlap extension PCR for site-directed mutagenesis. Mr PPK (D127N) gene, Specifically, the primer sequences used for overlap extension PCR site-directed mutagenesis are as follows: D127N-F: 5'-AACCGCAGCCATTATGAAAACGTGCTGGTGGTGCCGTG-3'; D127N-R: 5'-CACGCGCACCACCAGCACGTTTTTCATAATGGCTGCGGTT-3'; T7-F: 5'-CCCGGAAATTAATACGACTCACTATA -3'; T7-ter: 5'- AAGACCCGTTTAGAGGCCCCAAG -3'.

[0040] The specific steps of overlap extension PCR site-directed mutagenesis are as follows: (1) Using pET-28a(+)- Mr PPK2-WT was used as a template to amplify the upstream and downstream fragments of the mutation site. The PCR reaction system for amplifying the upstream fragment included the following components: 50 ng pET-28a(+)- Mr PPK2-WT, 0.2 µM T7-F, 0.2 µM D127N-R, 0.2 mM dATP, 0.2mM dGTP, 0.2 mM dTTP, 0.2 mMdCTP, 1× PrimeSTAR GC Buffer, 0.025 U / µLPrimeSTAR ® HSDNA polymerase; ddH2O to make up to 50 µL; The PCR reaction system for amplifying the downstream fragment includes the following components: 50 ng pET-28a(+)- Mr PPK2-WT, 0.2 µM T7-ter, 0.2 µM D127N-F, 0.2 mMdATP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM dCTP, 1× PrimeSTAR GC Buffer, 0.025 U / µLPrimeSTAR ® HS DNA polymerase; ddH2O to make up to 50 µL; The PCR reaction procedure for amplifying the upstream fragment is as follows: 98°C for 2 min; 98°C for 10 s, 68°C for 30 s, 30 cycles; 68°C for 5 min; The PCR reaction procedure for amplifying the downstream fragment is as follows: 98°C for 2 min; 98°C for 10 s, 68°C for 35 s, 30 cycles; 68°C for 5 min; After the PCR reaction, the agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.) was used to cut the gel and recover the DNA fragments for the next overlap extension PCR.

[0041] (2) Overlap extension PCR 1) The initial reaction system of overlap extension PCR includes the following components: 1× PrimeStar GC Buffer (Mg 2+ plus), 50 ng upstream fragment, 58 ng downstream fragment, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM dCTP and 0.025 U / μL PrimeSTAR HS DNA Polymeras; make up to 50 µL with ddH2O.

[0042] The reaction program was as follows: 98°C for 2 min; 98°C for 10 s, 68°C for 35 s, 10 cycles; 68°C for 5 min.

[0043] 2) Add T7-F and T7-ter primers to the reaction system, and then react according to the following program: 98℃ for 10 s, 68℃ for 1 min 20 s, 25 cycles; 68℃ for 5 min.

[0044] 3) After the PCR reaction is completed, use an agarose gel DNA recovery kit to cut the gel and recover the target fragment.

[0045] (3) MrPPK (D127N) gene inserted into plasmid pET-28a(+) Use restriction enzyme N I and Hin The enzyme digestion reaction system includes the following components: 3 µg DNA fragment / plasmid pET-28a(+)- Mr PPK2-WT, 20 U N I, 20 U Hin dIII and 5 µL 10× Cutsmart buffer; make up to 50 µL with ddH2O.

[0046] After the enzyme digestion reaction system was incubated at 37°C for 3 h, the gene fragments were directly recovered using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.); the vector fragments were recovered by gel excision using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.); Use T4 DNA ligase to ligate the DNA fragments of the gene and vector after digestion. The enzyme ligation reaction system includes the following components: 200 ng of the gene fragment after digestion, 200 ng of the vector fragment after digestion, 200U T4 DNA ligase and 1× T4 DNA ligase buffer; ddH2O is added to make up to 20 µL.

[0047] The enzyme-linked reaction system was incubated at 16°C overnight, and the enzyme-linked product was purified using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.).

[0048] 2. Transform cells and extract plasmids The above enzyme-linked product pET28a(+)- Mr PPK2-D127N was transformed into E. coli DH5α competent cells by electroporation to obtain DH5α / pET-28a(+)-MrPPK2-D127N. Positive clones were identified by colony PCR, and positive clones were selected for sequencing. The strains with correct sequencing were cultured and the corresponding plasmids were extracted from them.

[0049] 3. Construction of recombinant expression strain pET28a(+)- Dm dNK, pET28a(+)- Mr PPK2-WT and pET-28a(+)-MrPPK2-D127N were transformed into Escherichia coli BL21(DE3) pLysS to obtain the recombinant expression strain BL21(DE3) pLysS / pET-28a(+)- DmdNK, BL21(DE3) pLysS / pET-28a(+)- Mr PPK2-WT, BL21(DE3) pLysS / pET-28a(+)- Mr PPK (D127N).

[0050] Example 2. Dm dNK, Mr PPK, Mr PPK (D127N), P1 exo - Expression and purification of Pick BL21(DE3) pLysS / pET-28a(+)- Dm dNK, BL21(DE3) pLysS / pET-28a(+)- Mr PPK2-WT, BL21(DE3) pLysS / pET-28a(+)- Mr Single colonies of PPK (D127N) and BL21(DE3) pLysS / pET-28a(+)-P1 exo- were inoculated into 10 mL of 2× YT medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured overnight at 37°C and 220 rpm. 10 mL of overnight culture was transferred to 1 L of 2× YT medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and cultured at 37°C until the absorbance value OD 600 The concentration of 0.5 mM IPTG (isopropylthiogalactoside) was 0.6-0.8, and the cells were induced at 18°C ​​for 16-20 h. The cells were collected by centrifugation and resuspended in buffer A (50 mMTris-HCl pH 8.0, 150 mM NaCl, 5 mM imidazole, 0.1 mM EDTA, 0.1% TritonX-100) (P1 exo - The cells were broken by high-pressure homogenizer. After centrifugation at 4°C and 10,000 rpm for 45 min, the supernatant was filtered through a 0.45 μm filter to remove cell debris, and the filtered supernatant was placed on a nickel column for affinity chromatography purification. The target protein was eluted using 1× elution buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10-500 mM imidazole, 0.1 mM EDTA, 0.1% TritonX-100) containing different concentrations of imidazole.

[0051] After the obtained eluate was verified by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), the eluate containing the target protein was collected. The target protein was dialyzed and concentrated using a 10 kDa Amicon-Ultra centrifugal ultrafiltration tube and 1× dialysis buffer (100 mM Tris-HCl, 0.1 mM EDTA, 2 mM DTT, 0.2% Tween 20, pH 7.0). Finally, an equal volume of 80% glycerol was added to the purified protein to dilute it and store it at -20°C; it was used for subsequent example experiments.

[0052] Example 3. Dm Synthesis of 2'-F-AMP Catalyzed by dNK and Analysis and Purification of Its Products 2'-FA Dm dNK catalyzes the reaction to generate monophosphate, and the reaction product is analyzed and purified by HPLC. The reaction system contains 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-FA, 50 mM MgCl2 and 6 μM Dm dNK. The reaction solution was incubated at 37°C for 3 h and then at 95°C for 15 min to inactivate the enzyme. Four volumes of water were added to dilute the reaction solution, and the protein was removed by centrifugation at 6000 rpm through a 10 kDa ultrafiltration column, and then 50 μL of the filtrate was taken for HPLC analysis. The mobile phase A of HPLC was 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and the mobile phase B was 75% acetonitrile solution. The injection volume of HPLC detection was 50 μL, the temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength of the HPLC UV detector was 254 nm. Different gradient elution programs were used to analyze each product, and the components of 2'-F-AMP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0053] Dm The HPLC analysis results of dNK catalyzing 2'-FA to 2'-F-AMP are as follows Figure 2 As shown in A.

[0054] Example 4. Dm Synthesis of 2'-F-UMP Catalyzed by dNK and Analysis and Purification of Its Products 2'-FU DmdNK catalyzes the reaction to generate monophosphate, and the reaction product is analyzed and purified by HPLC. The reaction system contains 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-FU, 50 mM MgCl2 and 6 μM Dm dNK. The reaction solution was incubated at 37°C for 3 h and then at 95°C for 15 min to inactivate the enzyme. Four volumes of water were added to dilute the reaction solution, and the protein was removed by centrifugation at 6000 rpm through a 10 kDa ultrafiltration column, and then 50 μL of the filtrate was taken for HPLC analysis. Mobile phase preparation: Mobile phase A was 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and mobile phase B was 75% acetonitrile solution. The measurement temperature was 30°C, the flow rate was 1 mL / min, and the HPLC UV detector had a detection wavelength of 254 nm. Different gradient elution programs were used to analyze the various products, and the components of 2'-F-UMP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0055] Dm The HPLC analysis results of dNK catalyzing 2'-FU to 2'-F-UMP are as follows Figure 2 As shown in B.

[0056] Example 5. Dm Synthesis of 2'-F-CMP Catalyzed by dNK and Analysis and Purification of Its Products 2'-FC by Dm dNK catalyzes the reaction to generate monophosphate, and the reaction product is analyzed and purified by HPLC. The reaction system contains 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-FC, 50 mM MgCl2 and 6 μM Dm dNK. Incubate at 37℃ for 3 h, then at 95℃ for 15 min to inactivate the enzyme. Add 4 times the volume of water to dilute the reaction solution, centrifuge at 6000rpm through a 10kDa ultrafiltration column to remove proteins, and then take 50 μL of the filtrate for HPLC analysis. Mobile phase preparation: mobile phase A is 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and mobile phase B is 75% acetonitrile solution. The measurement temperature is 30℃, the flow rate is 1 mL / min, and the UV detector detection wavelength is 254 nm. Different gradient elution programs are used to analyze each product, and the components of 2'-F-CMP are collected and freeze-dried and stored at -20℃. The crude yield and product concentration are calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0057] Dm The HPLC analysis results of dNK catalyzing 2'-FC to 2'-F-CMP are as follows Figure 2 As shown in C.

[0058] Example 6. Dm Synthesis of 2'-F-GMP Catalyzed by dNK and Analysis and Purification of Its Products 2'-FG Dm dNK catalyzes the reaction to generate monophosphate, and the reaction product is analyzed and purified by HPLC. The reaction system contains 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-FG, 50 mM MgCl2 and 6 μM Dm dNK. Incubate at 37℃ for 3 h, then at 95℃ for 15 min to inactivate the enzyme. Add 4 times the volume of water to dilute the reaction solution, centrifuge at 6000 rpm through a 10kDa ultrafiltration column to remove proteins, and then take 50 μL of the filtrate for HPLC analysis. Mobile phase preparation: mobile phase A is 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and mobile phase B is 75% acetonitrile solution. The measurement temperature is 30℃, the flow rate is 1 mL / min, and the UV detector detection wavelength is 254 nm. Different gradient elution programs are used to analyze each product, and the components of 2'-F-GMP are collected and freeze-dried and stored at -20℃. The crude yield and product concentration are calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0059] Dm The HPLC analysis results of dNK catalyzing 2'-FG to 2'-F-GMP are as follows Figure 2 As shown in D.

[0060] Example 7. Mr PPK and Mr Detection of PPK (D127N) activity against four monophosphate substrates 2'-F-NMPs Mr PPK and Mr PPK (D127N) catalyzes the reaction to generate triphosphate, and the reaction products are analyzed by HPLC. The reaction system contains 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-NMP, 20 mM MgCl2, 1 μM Mr PPK or 1 μM MrPPK (D127N). After incubating the reaction solution for 3 h, 4 volumes of water were added to dilute it, and then centrifuged at 6000 rpm through a 10 kDa ultrafiltration column to remove the protein. Finally, the reaction product was analyzed by HPLC. The mobile phase A of HPLC was 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and the mobile phase B was 75% acetonitrile solution. The injection volume of HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, the detection wavelength of the UV detector was 254 nm, and different gradient elution programs were used to analyze each product. The experimental results show that Mr Activity ratio of PPK (D127N) to 2'-F-UMP and 2'-F-GMP Mr PPK was higher, and the yield of the reaction products increased by 0.8 and 3.5 times respectively. The activity against 2'-F-AMP and 2'-F-CMP was Mr PPK is better, the reaction product yield is better than Mr PPK (D127N) was 20% and 31% higher.

[0061] Example 8. Mr Synthesis of 2'-F-ATP Catalyzed by PPK and Analysis and Purification of Its Product 2'-F-AMP Mr PPK catalyzes the reaction to generate triphosphate, and the reaction products are analyzed by HPLC. The reaction system contains 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-AMP, 20 mM MgCl2, 1 μM Mr PPK. After the reaction solution was incubated at 37°C for 10 h, 4 volumes of water were added for dilution, and then the solution was centrifuged at 6000 rpm through a 10 kDa ultrafiltration column to remove proteins. Finally, the reaction products were analyzed by HPLC. The mobile phase A of HPLC was 10 mM tetrabutylammonium hydrogen sulfate (pH 6.0) solution, and the mobile phase B was 75% acetonitrile solution. The injection volume of HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength of the UV detector was 254 nm. Different gradient elution programs were used to analyze each product, and the components of 2'-F-ATP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0062] Mr The HPLC analysis results of PPK catalyzing 2'-F-AMP to generate 2'-F-ATP are as follows Figure 3 As shown in A.

[0063] Example 9. MrSynthesis of 2'-F-UTP Catalyzed by PPK (D127N) and Analysis and Purification of Its Product 2'-F-UMP Mr PPK (D127N) catalyzes the reaction to generate triphosphate, and the reaction products are analyzed by HPLC. The reaction system contains 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-UMP, 20 mM MgCl2, 1 μM Mr PPK (D127N). After incubating the reaction solution at 37°C for 8 h, 4 volumes of water were added for dilution, and then the solution was centrifuged at 6000 rpm through a 10 kDa ultrafiltration column to remove proteins. Finally, the reaction products were analyzed by HPLC. The injection volume of HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength of the UV detector was 254 nm. Different gradient elution programs were used to analyze the various products. The components of 2'-F-UTP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0064] Mr The HPLC analysis results of PPK (D127N) catalyzing 2'-F-UMP to generate 2'-F-UTP are as follows Figure 3 As shown in B.

[0065] Example 10. Mr Synthesis of 2'-F-CTP Catalyzed by PPK and Its Product Analysis and Purification 2'-F-CMP Mr The PPK catalyzed reaction produced triphosphate, and the reaction products were analyzed by HPLC. The reaction system contained 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-CMP, 20 mM MgCl2, 1 μM Mr PPK. After incubating the reaction solution at 37°C for 4 h, 4 volumes of water were added for dilution, and then the solution was centrifuged at 6000 rpm through a 10kDa ultrafiltration column to remove the protein. Finally, the reaction product was analyzed by HPLC. The injection volume of HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength of the UV detector was 254 nm. Different gradient elution programs were used to analyze the various products, and the components of 2'-F-CTP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0066] MrThe HPLC analysis results of PPK catalyzing 2'-F-CMP to 2'-F-CTP are as follows Figure 3 As shown in C.

[0067] Example 11. Mr Synthesis of 2'-F-GTP Catalyzed by PPK (D127N) and Analysis and Purification of Its Product 2'-F-GMP Mr PPK (D127N) catalyzes the reaction to generate triphosphate, and the reaction products are analyzed by HPLC. The reaction system contains 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-GMP, 20 mM MgCl2, 1 μM Mr PPK (D127N). After the reaction solution was incubated at 37°C for 12 h, 4 volumes of water were added for dilution, and then the solution was centrifuged at 6000 rpm through a 10 kDa ultrafiltration column to remove the protein. Finally, the reaction products were analyzed by HPLC. The injection volume of HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength of the UV detector was 254 nm. Different gradient elution programs were used to analyze the various products. The components of 2'-F-GTP were collected and freeze-dried and stored at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in HPLC.

[0068] Mr The HPLC analysis results of PPK (D127N) catalyzing 2'-F-GMP to generate 2'-F-GTP are as follows Figure 3 As shown in D.

[0069] Example 12 Synthesis of XNA by primer extension reaction using the four 2'-F-NTPs prepared by the above enzymatic method The template and primer were mixed in a ratio of 2:1, denatured at 95°C for 10 min, slowly cooled to room temperature, incubated on ice for 5 min, and then the remaining reagents were added and mixed, and placed in a PCR instrument to complete the synthesis of XNA at a specific reaction temperature and time. The sequences of the DNA templates T-A6, T-U6, T-C6, T-G6, and T-X10 are as follows: T-A6: 5'-TTTTTTGCTAGCCTGGAGAGCA-3'; T-U6: 5'-AAAAAAGCTAGCCTGGAGAGCA-3'; T-C6: 5'-GGGGGGGCTAGCCTGGAGAGCA-3'; T-G6: 5'-CCCCCCGCTAGCCTGGAGAGCA-3'; T-X10: 5'-TGCATGATCTGCTAGCCTGGAGAGCA-3'.

[0070] The sequence of primer FAM-P8-R is as follows: FAM-P8-R 5'-FAM-TGCTCTCCAGGCTAGC-3'.

[0071] Pfu DNA polymerase mutant P1 exo - The reaction system for synthesizing 6 bp DNA or full-length XNA products using DNA as a template includes the following components: 100 nM DNA template, 50 nM primer FAM-P8-R, 1× Pfu buffer, 0.5 mM dATP or 0.5 mM dGTP or 0.5 mM dTTP or 0.5 mM dCTP, 1 μM P1 exo - ; Make up to 50 µL with ddH2O. Or: 100 nM DNA template, 50 nM primer FAM-P8-R, 1× Pfu buffer, commercial 0.5 mM 2'-F-ATP or 0.5 mM 2'-F-GTP or 0.5 mM 2'-F-UTP or 0.5 mM 2'-F-CTP, 1 μM P1 exo - ; Add ddH2O to make up to 50µL. Or: 100 nM DNA template, 50 nM primer FAM-P8-R, 1× Pfu buffer, 0.5 mM 2'-F-ATP or 0.5 mM 2'-F-GTP or 0.5 mM 2'-F-UTP or 0.5 mM 2'-F-CTP synthesized by enzyme catalysis and purified by HPLC, 1 μM P1 exo - ; Make up to 50 µL with ddH2O.

[0072] P1 exo - The reaction system for synthesizing 10 bp mixed base sequence DNA or XNA full-length product using DNA as template is as follows: 40 nM DNA template, 20 nM primer FAM-P8-R, 1× Pfu buffer, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dTTP, 0.5 mM dCTP, 1 μM P1 exo - ; Make up to 50 µL with ddH2O. Or: 40 nM DNA template, 20 nM primer FAM-P8-R, 1× Pfu buffer, commercial 0.5 mM 2'-F-ATP, 0.5 mM 2'-F-GTP, 0.5 mM 2'-F-UTP, 0.5 mM 2'-F-CTP, 1 μM P1 exo - ; Make up to 50 µL with ddH2O.

[0073] 40 nM DNA template, 20 nM primer FAM-P8-R, 1× Pfu buffer, 0.5 mM 2'-F-ATP, 0.5 mM 2'-F-GTP, 0.5 mM 2'-F-UTP, 0.5 mM 2'-F-CTP, 1 μM P1 exo synthesized by enzyme catalysis and separated by HPLC purification - ; Make up to 50 µL with ddH2O.

[0074] The reaction was incubated at 72°C for 2 h. After the reaction, 2×TBE-Urea loading buffer (twice the volume of the reaction system) was added to the product, denatured at 95°C for 10 min, and finally the reaction product was analyzed by urea polyacrylamide gel electrophoresis.

[0075] The electrophoresis results of each reaction product are as follows Figure 4 shown.

[0076] Figure 4 Lanes 1 and 5 in A are primer controls; Lane 2 is P1 exo - The full-length DNA product synthesized using T-A6 as template and commercial dATP as substrate; Lane 3 is P1 exo - The full-length XNA product synthesized using T-A6 as template and commercial 2'-F-ATP as substrate; Lane 4 is P1 exo - The full-length XNA product synthesized by enzymatic method using T-A6 as template and 2'-F-ATP purified by HPLC as substrate. Lane 6 is P1 exo - The full-length DNA product synthesized using T-U6 as template and commercial dTTP as substrate; Lane 7 is P1 exo - The full-length XNA product synthesized using T-U6 as template and commercial 2'-F-UTP as substrate; Lane 8 is P1 exo - The full-length XNA product was synthesized using T-U6 as a template and 2'-F-UTP as a substrate, which was separated and purified by HPLC.

[0077] Figure 4 Lanes 1 and 5 in B are primer controls; Lane 2 is P1 exo -The full-length DNA product synthesized using T-C6 as template and commercial dCTP as substrate; Lane 3 is P1 exo - The full-length XNA product synthesized using T-C6 as template and commercial 2'-F-CTP as substrate; Lane 4 is P1 exo - The full-length XNA product synthesized by enzymatic method using T-C6 as template and 2'-F-CTP separated and purified by HPLC as substrate. Lane 6 is P1 exo - The full-length DNA product was synthesized using T-G6 as a template and commercial dGTP as a raw material; Lane 7 is P1 exo - The full-length XNA product synthesized using T-G6 as a template and commercial 2'-F-GTP as a substrate; Lane 8 is P1exo - The full-length XNA product was synthesized using T-G6 as a template and 2'-F-GTP as a substrate, which was separated and purified by HPLC.

[0078] Figure 4 Lane 1 in C is the primer control; Lane 2 is P1 exo - The full-length DNA product synthesized using T-X10 as a template and commercial dNTPs as substrates; Lane 3 is P1 exo - The full-length XNA product synthesized using T-X10 as a template and commercial 2'-F-NTPs as substrates; Lane 4 is P1 exo - The full-length XNA product was synthesized using T-X10 as a template and 2'-F-NTPs synthesized by enzymatic method and purified by HPLC as a substrate.

[0079] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principle of the present invention should be equivalent replacement methods and are included in the protection scope of the patent of the present invention.

Claims

1. A method for synthesizing 2'-fluoro-2'-deoxynucleoside-5'-triphosphate, characterized in that: The following steps are involved: S1. reacting in a system containing adenosine triphosphate, 2'-fluoro-2'-deoxynucleoside, divalent metal ions and deoxynucleoside kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-monophosphate; S2. The 2'-fluoro-2'-deoxynucleoside-5'-monophosphate obtained in the separation and purification step S1 is reacted in a system containing polyphosphate, divalent metal ions and polyphosphate kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-triphosphate.

2. The synthesis method according to claim 1, characterized in that The concentration of adenosine triphosphate in the system described in step S1 is 1 to 20 mM; The concentration of 2'-fluoro-2'-deoxynucleoside in the system described in step S1 is 5 to 20 mM; The divalent metal ion in step S1 is a magnesium ion, and the concentration of the magnesium ion in the system is 1 to 100 mM; Deoxynucleoside kinase as described in step S1 Dm The concentration of dNK in the system is 3-9 μM.

3. The synthesis method according to claim 1, characterized in that The system described in step S1 also includes 20-50 mM Tris-HCl at pH 5.0-10.0 and 1-150 mM KCl.

4. The synthesis method according to claim 1, characterized in that The reaction in step S1 is carried out at a temperature of 30 to 37° C. for 1 to 10 hours.

5. The synthesis method according to claim 1, characterized in that The deoxynucleoside kinase described in step S1 includes the deoxynucleoside kinase derived from Drosophila melanogaster ( Drosophila melanogaster ) deoxynucleoside kinase Dm At least one of dNK and a mutant deoxynucleoside kinase whose enzyme activity is not downregulated.

6. The synthesis method according to claim 1, characterized in that The polyphosphoric acid described in step S2 is sodium hexametaphosphate; The concentration of the polyphosphoric acid in the system in step S2 is 1 to 10 mM; The concentration of 2'-fluoro-2'-deoxynucleoside monophosphate in the system in step S2 is 1 to 10 mM; The divalent metal ion in step S2 is a magnesium ion, and the concentration of the magnesium ion in the system is 20 to 100 mM; The concentration of the polyphosphate kinase in the system described in step S2 is 1 to 5 μM.

7. The synthesis method according to claim 1, characterized in that The system described in step S2 also includes 10-100 mM Tris-HCl at pH 5.0-10.

0.

8. The synthesis method according to claim 1, characterized in that The reaction in step S2 is carried out at a temperature of 30 to 80° C. for 1 to 15 hours.

9. The synthesis method according to claim 1, characterized in that The polyphosphate kinase described in step S2 includes the polyphosphate kinase derived from Thermus rubrum ( Meiothermus ruber Polyphosphate kinase Mr At least one of PPK and a mutant polyphosphate kinase whose enzyme activity is not downregulated.

10. Use of the synthesis method according to any one of claims 1 to 9 in the preparation of 2'-fluorine-modified heterologous nucleic acids.

Images