Primers for identifying tilapia, their detection kit, and applications.

By designing specific primers and kits, and combining them with PCR amplification technology, the problems of slow speed and low accuracy in tilapia variety identification have been solved, enabling rapid and efficient variety identification and supporting the protection of germplasm resources.

CN119639912BActive Publication Date: 2026-06-30FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Filing Date
2024-12-17
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing methods for identifying tilapia germplasm resources rely on experience, are slow and have low accuracy, making it difficult to achieve rapid, efficient and accurate variety identification.

Method used

Specific primers and kits were designed to identify tilapia genomic DNA using PCR amplification technology. Tilapia species, including Nile tilapia, Oreochromis aureus, and red tilapia, were distinguished based on the fragment length of the PCR product.

Benefits of technology

It enables rapid, efficient, and accurate identification of tilapia varieties, supports germplasm resource protection and variety identification, and reduces damage to samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639912B_ABST
    Figure CN119639912B_ABST
Patent Text Reader

Abstract

This invention provides primers, a detection kit, and applications for identifying tilapia, belonging to the field of molecular biology. The invention provides primers for identifying tilapia species, enabling rapid, efficient, and accurate identification of Nile tilapia (Oreochromis niloticus), Oreochromis aureus, and Oreochromis spp., providing a scientific basis for tilapia germplasm resource conservation and species identification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a primer for identifying tilapia, its detection kit, and its application. Background Technology

[0002] Tilapia ( Tilapias Taxonomically, it belongs to the phylum Chordata, subphylum Vertebrata, class Actinopterygii, subclass Actinopterygii, suborder Labridae, family Cichlidae, genus Tilapia. Oreochromis Tilapia (spp.) are widely distributed in tropical and subtropical low-latitude regions. Native to the African continent, they are euryhaline tropical fish that thrive in high temperatures, tolerate low oxygen and high salinity, and can live in both seawater and freshwater. They are omnivorous, with adults feeding on plankton and benthic organisms, exhibiting strong competitive feeding abilities and rapid growth. Globally, over 600 species of tilapia are known, and the Food and Agriculture Organization of the United Nations has recommended their introduction to over 100 countries and regions for aquaculture to improve protein supply. They have become one of the most important non-native species farmed in China, especially in the tropical and subtropical regions of southern China. Tilapia farmed in China include *Tilapia guilloché*, *Tilapia niloticus*, *Tilapia mozambique*, *Tilapia spp.*, *Tilapia occulta*, *Tilapia occulta*, and *Tilapia rubra*. Due to the large number of tilapia species, the identification of existing tilapia germplasm resources or populations still mainly relies on traditional evaluation methods. These methods are heavily dependent on the experience of the assessor, and are slow and prone to inaccuracies. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide a primer for identifying tilapia, specifically for Nile tilapia (… Oreochromis niloticus Oreochromis tilapia ( Oreochromis aureus ), red tilapia ( Oreochromis spp. At least one of the following has the characteristics of rapid, efficient and accurate identification, and can be used for the protection of tilapia germplasm resources and variety identification.

[0004] This invention provides a primer for identifying tilapia species, comprising a first primer and / or a second primer;

[0005] The first primer includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:9;

[0006] The second primer includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:20 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:21.

[0007] This invention provides a kit for identifying tilapia species, including the primers mentioned above.

[0008] Preferably, it includes PCR amplification reaction premix and / or positive standards.

[0009] Preferably, the positive standard comprises a recombinant plasmid containing a first DNA fragment and / or a recombinant plasmid containing a second DNA fragment;

[0010] The nucleotide sequence of the first DNA fragment is shown in SEQ ID NO:22;

[0011] The nucleotide sequence of the second DNA fragment is shown in SEQ ID NO:23.

[0012] This invention provides the application of the primers or the kit in identifying tilapia species, wherein the tilapia includes at least one of the following: Nile tilapia ( Oreochromis niloticus Oreochromis tilapia ( Oreochromis aureus ) and red tilapia ( Oreochromis spp. ).

[0013] This invention provides a method for identifying tilapia species, comprising the following steps:

[0014] Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers to obtain PCR products;

[0015] Based on the fragment length of the PCR product, determine the tilapia species from which the sample was obtained:

[0016] When the first primer is used for identification, if a PCR product of 762 bp and a PCR product of 1088 bp are obtained, the sample to be tested is from Nile tilapia.

[0017] When the second primer is used for identification, only a PCR product of 762 bp in length is obtained. When the first primer is used for identification, if a PCR product of 332 bp in length is obtained, the sample to be tested is from red tilapia.

[0018] When identified using the second primer, only one PCR product of 762 bp was obtained, while when identified using the first primer, one PCR product of 332 bp and one PCR product of 302 bp were obtained. The sample to be tested was from Oreochromis aureus.

[0019] Preferably, the PCR amplification reaction volume is 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl 10 μM forward and reverse primers, and 1 μl 50 ng / μl DNA template.

[0020] Preferably, the PCR amplification reaction program is as follows: 95℃ for 5 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 50 s, 35 cycles; extension at 72℃ for 5 min.

[0021] This invention provides primers for amplifying and identifying tilapia varieties. These primers can detect at least one variety among Nile tilapia, Oreochromis aureus, and Red tilapia, and feature rapid, efficient, and accurate identification. They can be used for the protection of tilapia germplasm resources and variety identification. Attached Figure Description

[0022] Figure 1 This is a fingerprint map of the core SNP sites;

[0023] Figure 2 Fingerprint maps of 7 SNP sites;

[0024] Figure 3 The results of the preliminary identification of Nile tilapia (ON), Oreochromis aureus (OA), and Red tilapia (OS) using 7 pairs of SNP markers are shown in the figure.

[0025] Figure 4 The results of identifying Nile tilapia (ON), Oreochromis aureus (OA), and Red tilapia (OS) using SNP6 markers;

[0026] Figure 5 The results of identifying Nile tilapia (ON), Oreochromis aureus (OA), and Red tilapia (OS) using SNP7 markers are shown in the figure.

[0027] Figure 6 The results of identifying Oreochromis aureus (OA) and Oreochromis esculentus (OS) using the SNP1 marker are shown in the figure. Detailed Implementation

[0028] This invention provides a primer for identifying tilapia species, comprising a first primer and / or a second primer; the first primer comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:9; the second primer comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:20 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:21.

[0029] This invention does not impose any special restrictions on the source of the primers; any gene synthesis method well-known in the art can be used. In this embodiment of the invention, the primers were synthesized by Yixin Biotechnology (Shanghai) Co., Ltd.

[0030] This invention provides a kit for identifying tilapia species, including the primers mentioned above.

[0031] In this invention, the PCR amplification reaction premix and / or positive standards are preferably included. The PCR amplification reaction premix is ​​preferably Premix Ex Taq, purchased from Takara Biotechnology Co., Ltd. The positive standards preferably include a recombinant plasmid containing a first DNA fragment and / or a recombinant plasmid containing a second DNA fragment. The nucleotide sequence of the first DNA fragment is shown in SEQ ID NO:22 (AGGGATTCAAACACGGACAGCACTACTGGGAACTGGAGGTGTCCAAGCCTTGGGCCTACCTCGGGGTAAGGATATCATAATGCTGTGTACACTGTGGCTTTGTGACACATCGCTTTGTAGCAGGTCGCTAATGGGGACATTCTGGGTCTTGCCTAGTAAATCGTTACATGGACCTGCTCAATAGTAGATCTACTCTGATGTGTCTAATCAGTCGAGAATGTTTCAACAGATTTTCCTAAAGTGTTATACAGGGATTCATTGTTCCCACAGAGATGGCCACAGCATGCTAATGTTTCC[C / T]TTGTTCTGCGTATCCTCCTCTCCAG); the nucleotide sequence of the second DNA fragment is shown in SEQ ID NO:23 (GGTCAACACATCAGTCCACGCTTTCTTTATCCTGAT

[0032] , where R is G / A (as shown).

[0033] This invention provides the application of the primers or the kit in identifying tilapia species, wherein the tilapia includes at least one of the following: Nile tilapia ( Oreochromis niloticus Oreochromis tilapia ( Oreochromis aureus ) and red tilapia ( Oreochromis spp. ).

[0034] In this invention, in the application described, it is preferable to use the second primer only to distinguish between Nile tilapia and Oreochromis aureus or red tilapia. PCR amplification is performed using the second primer, and Nile tilapia is identified based on the length of the PCR product fragment. Alternatively, based on the second primer, PCR amplification is performed using the first primer, and red tilapia and Oreochromis aureus can be distinguished based on the length of the PCR product fragment.

[0035] This invention provides a method for identifying tilapia species, comprising the following steps:

[0036] Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers to obtain PCR products;

[0037] Based on the fragment length of the PCR product, determine the tilapia species from which the sample was obtained:

[0038] When the second primer is used for identification, if a PCR product of 762 bp and a PCR product of 1088 bp are obtained, the sample to be tested is from Nile tilapia.

[0039] When the second primer is used for identification, only a PCR product of 762 bp in length is obtained. When the first primer is used for identification, if a PCR product of 332 bp in length is obtained, the sample to be tested is from red tilapia.

[0040] When identified using the second primer, only one PCR product of 762 bp was obtained, while when identified using the first primer, one PCR product of 332 bp and one PCR product of 302 bp were obtained. The sample to be tested was from Oreochromis aureus.

[0041] This invention uses the genomic DNA of the sample to be tested as a template and performs PCR amplification using the primers to obtain PCR products.

[0042] The present invention does not impose any particular limitation on the method for extracting genomic DNA from the test sample; any DNA extraction method well-known in the art can be used. In this embodiment, a genomic DNA extraction kit is used to extract the genomic DNA from the test sample. The type of the test sample preferably includes at least one of the following: tilapia visceral tissue, body fluid, tilapia flesh, and tilapia fins.

[0043] In this invention, the preferred reaction volume for PCR amplification is 20 μl, comprising 10 μl Premix Ex Taq, 8 μl lddH2O, 0.5 μl forward and reverse primers (10 μM), and 1 μl DNA template (50 ng / μl). The preferred PCR amplification reaction program is: 95℃ for 5 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 50 s, for 35 cycles; extension at 72℃ for 5 min.

[0044] In this invention, the fragment length of the PCR product is preferably obtained by electrophoresis or sequencing. The electrophoresis detection preferably includes 1% agarose gel electrophoresis.

[0045] In this embodiment of the invention, the second primer amplifies a specific band of 762 bp in both Oreochromis aureus and red tilapia. In Nile tilapia, in addition to the 762 bp specific band, a 1088 bp specific band is also present. The second primer can accurately distinguish Nile tilapia from Oreochromis aureus or red tilapia. After accurately distinguishing the differential band in Nile tilapia, the first primer amplifies a specific band of 332 bp in red tilapia. In Oreochromis aureus, in addition to the 332 bp specific band, a 302 bp specific band is also amplified. The first primer can then accurately distinguish Oreochromis aureus from red tilapia.

[0046] The following detailed description, in conjunction with embodiments, of a primer and its detection kit for identifying tilapia provided by the present invention and its application, should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] The construction and application of a tilapia DNA fingerprint based on SNP markers includes the following steps:

[0049] (1) Collect 15 tail fin samples from Nile tilapia, Oreochromis aureus and red tilapia respectively, extract DNA and resequencing them;

[0050] (2) Quality control of the test data was performed, and the SNP sites of the samples were obtained using the UnifiedGenotyper program;

[0051] (3) To ensure the reliability of SNP sites, preliminary filtering was performed according to the SNP hard filtering standard to obtain SNP sites that could completely separate all samples. The filtering conditions were as follows: Fisher test of strand bias (FS) ≤ 60; HaplotypeScore ≤ 13.0; Mapping Quality (MQ) ≥ 40; Quality Depth (QD) ≥ 2; ReeadPosRankSum ≥ -8.0; MQRankSum > -12.5;

[0052] (4) The SNP sites were further screened using Plink software to identify core SNP sites. The screening criteria were as follows: only sites on NC_031965.2-NC_031987.2 (except NC_031968.2) were retained; sites with minimum gene frequency (MAF) > 0.2 were selected; sites with heterozygosity (het) < 0.05 were selected; sites with geno deletion rate (geno) < 0.2 were selected; SNP sites with intergenic regions were removed based on the SNP annotation information; genotype filling was performed using Beagle (v5.1) software; sites with minimum gene frequency (MAF) > 0.3 were selected; sites with heterozygosity (het) < 0.01 were selected; and sites with linkage disequilibrium (LD) r were selected. 2 For sites with a value <0.2, the information of the following 105 core SNP sites is obtained, as detailed in Table 1.

[0053] Table 1 Core SNP locus information

[0054]

[0055]

[0056]

[0057]

[0058] (5) Using the matplotlib graphics library in Python 3, plot the fingerprints of the selected SNP sites, such as... Figure 1 .

[0059] (6) Genetic distances between samples were calculated using Plink software. Highly polymorphic SNPs were selected and refined from the core SNP loci for identification of tilapia varieties in production. The selection criteria were as follows: only loci on NC_031965.2-NC_031987.2 (except NC_031968.2) were retained; loci with minimum gene frequency (MAF) > 0.2 were selected; loci with heterozygosity (het) < 0.05 were selected; loci with geno deletion rate (geno) < 0.1 were selected; SNPs in intergenic regions were removed based on SNP annotation information; genotyping was performed using Beagle (v5.1) software; loci with minimum gene frequency (MAF) > 0.3 were selected; loci with heterozygosity (het) < 0.01 were selected; and loci with linkage disequilibrium (LD) r were selected. 2 For sites with a value <0.2, the following 7 SNP site information were obtained, as shown in Tables 2 and 3.

[0060] Table 2 Information on 7 SNP sites

[0061]

[0062] Table 3 Information on 7 SNP molecular markers

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] (7) Using the matplotlib graphics library of phtyon3, plot the fingerprint spectrum of the selected SNPs (see Figure 2 ).

[0069] Example 2

[0070] The specific steps for verifying specific SNP markers are as follows:

[0071] (1) Design of 7 pairs of SNP marker-specific primers.

[0072] 400bp gene sequences upstream and downstream of the SNP markers were extracted. Primers were designed for the extracted sequences using Primer 6.0 software. The DNA fragments of the 7 SNP markers and the positions of the SNP sites on the DNA fragments and the primer sequences are shown in Table 4.

[0073] Table 4. Amplification primer sequences for 7 SNP molecular markers

[0074]

[0075] (2) Sample collection verification. Thirty live samples each of Nile tilapia, Oreochromis aureus, and red tilapia were collected. Approximately 0.5g of tail fin was cut from each sample and rapidly frozen in liquid nitrogen, then promptly transferred to a -80℃ freezer for storage. Genomic DNA was extracted from the tail fin samples using a genomic DNA extraction kit. The quality of DNA extraction was assessed by 1% agarose gel electrophoresis, and DNA was quantified using a UV spectrophotometer.

[0076] (3) Screening and verification of SNP markers. Genomic DNA from Nile tilapia (ON), Oreochromis aureus (OA), and Oreochromis esculentus (OS) samples was amplified by PCR using seven pairs of SNP marker primers. The amplification volume was 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 0.5 μl forward and reverse primers (10 μM), and 1 μl DNA template (50 ng). The amplification conditions were: 95℃ for 5 min; 95℃ for 30 s, 52℃ for 30 s, and 72℃ for 50 s, for 35 cycles; extension at 72℃ for 5 min. PCR products were detected by 1% agarose gel electrophoresis. Based on whether significant differential bands appeared in the PCR amplification products among the three tilapia species, the SNP markers of the three tilapia species were preliminarily identified. The results are as follows:

[0077] like Figure 3 As shown in Figure A, marker SNP1 exhibits two specific bands at positions 332 bp and 488 bp in all three species of tilapia (Orychophragmus violaceus, Amur tilapia, and Nile tilapia), while Orychophragmus violaceus also shows a specific band at position 302 bp. Marker SNP1 can preliminarily identify the three tilapia species. Marker SNP2 shows a specific band at position 488 bp in all three tilapia species, but fails to effectively distinguish them. Marker SNP3 shows a specific band at position 332 bp in all three tilapia species, but also fails to effectively distinguish them.

[0078] exist Figure 3 In the B-cell assay, marker SNP5 and marker SNP4 both showed a specific band at the 288 bp position in all three tilapia species, failing to effectively distinguish them. Marker SNP6 showed a specific band of the same size at approximately the 400 bp position in all three species: Oreochromis aureus, Amur tilapia, and Nile tilapia. Marker SNP6 can be used for preliminary identification of Oreochromis aureus / Amur tilapia and Nile tilapia.

[0079] exist Figure 3In the C-cell assay, marker SNP7 exhibited only one specific band at the 762 bp position in both Oreochromis aureus and Red tilapia. In Nile tilapia, in addition to the 762 bp specific band, another specific band was observed at the 1088 bp position. Marker SNP7 can be used to preliminarily identify Oreochromis aureus / Red tilapia and Nile tilapia. Therefore, markers SNP1, SNP6, and SNP7 were selected for further validation in a larger number of Oreochromis aureus, Red tilapia, and Nile tilapia samples to ensure the accuracy of the three marker pairs.

[0080] like Figure 4 As shown, marker SNP6 exhibits a specific band at the 405bp position in all three tilapia species, failing to accurately distinguish between Oreochromis aureus, Red tilapia, and Nile tilapia. Further validation was performed on markers SNP1 and SNP7.

[0081] like Figure 5 As shown, the marker SNP7 produced a specific band at position 762bp in both Oreochromis aureus and Red tilapia. Figure 5 In Nile tilapia, in addition to a specific band at 762 bp, there is also a specific band at 1088 bp (A and B). Figure 5 (C), marking SNP7 can accurately distinguish Nile tilapia from Oreochromis aureus / red tilapia (C). Figure 5 (D).

[0082] After accurately distinguishing the differential bands in Nile tilapia, such as Figure 6 As shown, the marker SNP1 exhibits a specific band at the 332bp position in red tilapia. Figure 6 In addition to a specific band at 332 bp, another specific band exists at 302 bp in the Oreochromis aureus (A). Figure 6 (B), marking SNP1 can accurately distinguish between Oreochromis aureus and Red tilapia ( Figure 6 (C)

[0083] In summary, the combination of SNP7 and SNP1 markers can accurately and quickly distinguish Nile tilapia, Oreochromis aureus, and Red tilapia. Furthermore, by using only a small number of tail fins as experimental samples, the damage to the fish is minimal.

[0084] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a primer or a kit comprising said primer for identifying a species of tilapia, said tilapia being at least one of: Oreochromis niloticus (O. niloticus) Oreochromis niloticus , Oreochromis aureus (O. aureus) Oreochromis aureus and Oreochromis sp. (O. sp.) Oreochromis spp. .​​​​​​ The primers include a first primer and a second primer; The first primer is a forward primer with a nucleotide sequence as shown in SEQ ID NO:8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:9; The second primer is a forward primer with a nucleotide sequence as shown in SEQ ID NO:20 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

21.

2. The application according to claim 1, characterized in that, The kit includes a PCR amplification reaction premix and / or a positive standard.