A plasmid system for high-yield rAAV and its application

By using a shRNA expression cassette targeting a transgenic plasmid for gene silencing in the rAAV production system, the negative impact of the transgenic plasmid expression product on HEK293 cells was resolved, the yield and production efficiency of rAAV were improved, and the cost was reduced.

CN119662733BActive Publication Date: 2025-10-28GUANGZHOU PACKGENE BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411801091.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-09
Publication Date
2025-10-28
Estimated Expiration
2044-12-09

AI Technical Summary

Technical Problem

In existing rAAV production systems, the promoters on transgenic plasmids are active in HEK293 cells, which leads to a negative impact of the target gene expression product on the cells and reduces the packaging capacity of rAAV.

Method used

By using a plasmid system containing an shRNA expression cassette, gene silencing is achieved by targeting the gene on the transgenic plasmid, thereby increasing the yield of rAAV.

Benefits of technology

It significantly increased rAAV yield, reduced production costs, and improved the drug-likeness and production efficiency of rAAV.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662733B_ABST
    Figure CN119662733B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology and discloses a high-yield rAAV plasmid system and its applications. The high-yield rAAV plasmid system of this invention includes a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid, a helper plasmid, and an shRNA expression cassette; the shRNA expression cassette includes a sequence capable of targeting the target gene in the transgenic plasmid. In the rAAV production process, the plasmid system of this invention inhibits the transcriptional expression of the target gene by expressing shRNA to target the coding region or target sequence of the target gene on the transgenic plasmid. The carefully designed target sequence, unlike coding regions of human and mammalian genes, can be broadly used in various transgenic plasmids, thereby increasing rAAV yield and significantly improving the rAAV production efficiency of mammalian cells, achieving the technical effects of improved rAAV druggability and reduced production costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a plasmid system for high-yield rAAV and its applications. Background Technology

[0002] Recombinant adeno-associated virus (rAAV) vectors have many advantages, such as stable expression of exogenous genes for a long time, non-integration into the host genome, infection of dividing / non-dividing cells, broad host cell range, high specificity, and low immunogenicity, making them a safe and effective gene therapy tool and thus considered one of the most promising gene therapy vectors.

[0003] rAAV production systems mainly include plasmid transfection production systems based on HEK293 cells, production systems based on insect cells and baculoviruses, and methods based on packaging cells or induced packaging cells. The HEK293 cell-based plasmid transfection production system is currently the mainstream technology for clinical / research-grade rAAV production. This system primarily involves co-transfecting HEK293 cells with a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid encoding the AAV replication protein (Rep) and capsid protein (Cap), and a helper plasmid encoding cofactors required for rAAV replication. The main steps include: plasmid preparation, amplification of production cells, plasmid transfection of production cells, cell lysis to harvest crude virus solution, and virus purification.

[0004] However, during rAAV production, the promoters on the transgenic plasmids are active in HEK293 cells, driving the transcriptional expression of the target gene. These gene expression products, especially those with negative cellular effects, reduce the ability to package rAAV. Therefore, developing methods to silence the target gene during rAAV production, thereby increasing rAAV yield, is of great significance for promoting large-scale rAAV production and rAAV-mediated gene therapy. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a plasmid system and its application for high-yield rAAV.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a plasmid system for high-yield rAAV, comprising a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid, an auxiliary plasmid, and an shRNA expression cassette;

[0008] The shRNA expression cassette includes a sequence capable of targeting the target gene in the transgenic plasmid.

[0009] In the rAAV production process, the plasmid system of this invention silences the target gene on the transgenic plasmid by expressing shRNA, thereby increasing the yield of rAAV. This significantly improves the rAAV production efficiency of mammalian cells, achieving the technical effects of improving the drug-likeness of rAAV and reducing production costs.

[0010] In a preferred embodiment of the high-yield rAAV plasmid system of the present invention, a target sequence is inserted at the 5' or 3' end outside the coding region of the target gene on the transgenic plasmid; the nucleotide of the target sequence is: 5'-GGCGAGAATGAGCCTGCCTGTAAA-3'.

[0011] In a preferred embodiment of the high-rAAV plasmid system of the present invention, the shRNA expression cassette includes a promoter that drives the shRNA, a hairpin structure of shRNA that targets the coding region of the target gene or the target sequence on the transgenic plasmid, and a terminator.

[0012] In a preferred embodiment of the high-rAAV plasmid system of the present invention, the shRNA expression cassette is located on any one of the transgenic plasmid, packaging plasmid, and helper plasmid.

[0013] In a preferred embodiment of the high-yield rAAV plasmid system of the present invention, the transgenic plasmid is pGOI plasmid; the packaging plasmid is pRep-Cap; and the helper plasmid is pHelper.

[0014] The pGOI plasmid includes sequences from different serotypes, ITR sequences, and their optimized sequences; the pRep-Cap plasmid includes nucleic acid sequences from different serotypes, sequences expressing Rep protein, sequences expressing Cap protein, and their optimized nucleic acid sequences; the pHelper plasmid encodes the cofactors required for rAAV replication, including nucleic acid sequences from different helper virus plasmids, sequences expressing adenovirus element proteins, and their optimized sequences.

[0015] Secondly, the present invention provides a cell that produces high levels of rAAV, comprising the plasmid system described above.

[0016] As a preferred embodiment of the high-rAAV-producing cells described in this invention, the cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

[0017] Thirdly, the present invention applies the plasmid system and the cells described herein to rAAV production.

[0018] Fourthly, the present invention provides a method for improving the production of recombinant adeno-associated virus by transfecting packaging cells with the plasmid system described above; or by culturing the cells described above.

[0019] In a preferred embodiment of the method described in this invention, the packaging cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] In the rAAV production process, the plasmid system of this invention silences the target gene on the transgenic plasmid by expressing shRNA, thereby increasing the yield of rAAV. This significantly improves the rAAV production efficiency of mammalian cells, achieving the technical effects of improving the drug-likeness of rAAV and reducing production costs. Attached Figure Description

[0022] Figure 1 To demonstrate the rAAV packaging effect of inhibiting target gene expression by targeting the gene coding region on pGOI;

[0023] Figure 1 Figure a: Schematic diagram of pGOI, pHelper-shScram, and pHelper-shGFP constructed in this invention; Figure b: Fluorescence intensity of rAAV packaging using pGOI and pRep-Cap co-transfected with pHelper, pHelper-shScram, and pHelper-shGFP, respectively; Figure c: Relative genomic titer of rAAV packaging using pGOI and pRep-Cap (AAV9) co-transfected with pHelper, pHelper-shScram, and pHelper-shGFP, respectively; Figure d: Relative genomic titer of rAAV packaging using pGOI and pRep-Cap (AAV2) co-transfected with pHelper, pHelper-shScram, and pHelper-shGFP, respectively.

[0024] Figure 2 To demonstrate the rAAV packaging effect of inhibiting target gene expression by targeting the 5' end target sequence on pGOI;

[0025] Figure 2In the figures, Figure a: Schematic diagram of pGOI-5'TS, pHelper-shScram, and pHelper-shTS constructed in this invention; Figure b: Fluorescence intensity of rAAV packaging using pGOI-5'TS and pRep-Cap co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively; Figure c: Relative genomic titer of rAAV packaging using pGOI-5'TS and pRep-Cap (AAV9) co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively; Figure d: Relative genomic titer of rAAV packaging using pGOI-5'TS and pRep-Cap (AAV2) co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively.

[0026] Figure 3 To demonstrate the rAAV packaging effect of inhibiting target gene expression by targeting the 3' end target sequence on pGOI;

[0027] Figure 3 In the figures, Figure a: Schematic diagram of pGOI-3'TS, pHelper-shScram, and pHelper-shTS constructed in this invention; Figure b: Fluorescence intensity of rAAV packaging using pGOI-3'TS and pRep-Cap co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively; Figure c: Relative genomic titer of rAAV packaging using pGOI-3'TS and pRep-Cap (AAV9) co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively; Figure d: Relative genomic titer of rAAV packaging using pGOI-3'TS and pRep-Cap (AAV2) co-transfected with pHelper, pHelper-shScram, and pHelper-shTS, respectively. Detailed Implementation

[0028] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0029] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0030] Example 1: rAAV packaging effect of inhibiting target gene expression by targeting the gene coding region on pGOI

[0031] (1) Plasmid construction and preparation

[0032] Using molecular biology techniques such as gene synthesis, PCR, Gibson assembly, and sequencing analysis, a self-cleaving peptide P2A (Kim JH et al. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One. 2011, 6(4): e18556. doi:10.1371 / journal.pone.0018556.) and the CASP4 gene (GenBank accession: NM_001225) were inserted into the 3' end of the eGFP gene on the pAAV-GFP plasmid (Addgene: 32395) to obtain the following results: Figure 1 pGOI plasmid shown in figure a.

[0033] The EF1a promoter (Qin JY et al. Systematic comparison of constitutive promoters and the doxycycline-inducible promoter. PLoS One. 2010, 5(5): e10611. doi: 10.1371 / journal.pone.0010611.) and the shRNA control shScarm hairpin structure (5'-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgGCCTA) were compared with those of the shRNA control shScarm hairpin structure (5'-tgtttgaatgaggcttcagtactttacagaatcgGCCTA). AGGTTAAGTCGCCCTCGtagtgaagccacagatgtaCGAGGGCGACTTAACCTTAGGTtgcctactgcctcggacttcaaggggctagaattcgagcaattatct tgtttaaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttt-3'), WPRE-SV40pA fragment (Choi JH et.al.Optimization of AAV expressioncassettes to improve packaging capacity and transgene expression inneurons.Mol Brain.2014,7:17.doi:10.1186 / 1756-6606-7-17.Carswell S,AlwineJC.Efficiency of utilization of the simian virus 40late polyadenylation site:effects of upstream sequences.Mol Cell Biol.1989,9(10):4248-58.doi:10.1128 / mcb.9.10.4248-4258.1989.) was inserted into the pHelper plasmid (GeneBank: AF369965) to obtain the following Figure 1 The pHelper-shScram plasmid shown in figure a.

[0034] The EF1a promoter, the shGFP hairpin structure targeting the GFP coding region (5'-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgTGCACAAGCTGGAGTACAACTAtagtgaagccacagatgtaTAGTTGTACTCCAGCTTGTGCCtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaa ttaaatcacttt-3'), and the WPRE-SV40pA fragment were inserted into the pHelper plasmid to obtain the following results: Figure 1 The pHelper-shGFP plasmid shown in figure a is shown in figure a.

[0035] High concentrations and high purity of pGOI, pRep-Cap(AAV9), pRep-Cap(AAV2), pHelper, pHelper-shSram, and pHelper-shGFP plasmids were extracted.

[0036] (2) rAAV packaging

[0037] One day before transfection, 293T cells were resuspended in DMEM medium and counted at a concentration of 6 × 10⁻⁶. 6 One cell per dish is evenly seeded into a 10-cm cell culture dish and cultured at 37°C with 5% CO2 until the cell confluence is approximately 80%.

[0038] Set up the following plasmids: Control group: pGOI, pRep-Cap (AAV9 or AAV2), pHelper; shScram group: pGOI, pRep-Cap (AAV9 or AAV2), pHelper-shScram; shGFP group: pGOI, pRep-Cap (AAV9 or AAV2), pHelper-shGFP.

[0039] On the day of transfection, replace the medium with fresh DMEM. Mix each of pGOI, pRep-Cap, and pHelper in a ratio of 2.0 μg:2.5 μg:2.5 μg:2.3 μg, with three replicates per group. Mix 0.5 mL of DMEM with the plasmid DNA, and then mix 0.5 mL of DMEM with 8.4 μL of PEIpro. Add the PEIpro mixture to the DNA mixture and mix well. Incubate at room temperature for 15 min. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for further culture.

[0040] On the third day post-transfection, eGFP fluorescence was observed under a fluorescence microscope. Fluorescence imaging results showed that the fluorescence intensity of the shGFP group was significantly lower than that of the Control and shScram groups. Figure 1 b).

[0041] (3) Genomic titer determination

[0042] Add 100 μL of cell lysis buffer to the transfected culture dish, incubate at room temperature for 30 min, and then collect 50 μL of the supernatant to determine the genomic titer. Digest the harvested supernatant with DNase I and determine the genomic titer using qRT-PCR. Construct a standard curve using serially diluted plasmid standards. Calculate the genomic titer of the rAAV sample based on the standard curve.

[0043] Genomic titer assays showed that, compared to the Control group, the genomic titers of the AAV9 and AAV2 shGFP groups were increased by 5.91-fold (…). Figure 1 c) and 2.22 times ( Figure 1 d).

[0044] Example 2: rAAV packaging effect of inhibiting target gene expression by targeting the 5' end target sequence on pGOI.

[0045] (1) Plasmid construction and preparation

[0046] Bioinformatics methods were used to generate all nucleotide sequences encoding the PACKGENE amino acid sequence. After arranging all sequences, potential shRNA target sequences were designed using the GPP Web Portal online program. The target sequence with the highest score (5'-GGCGAGAATGAGCCTGCCTGTAAA-3') was then selected for testing. Comparison showed that the target sequence differed from the coding regions of human and mammalian genes; therefore, the designed shRNA would not target or affect human or animal genes.

[0047] Using molecular biology techniques such as gene synthesis, PCR, Gibson assembly, and sequencing analysis, a 24 bp target sequence (TS, 5'-GGCGAGAATGAGCCTGCCTGTAAA-3') was inserted into the 5' end of the eGFP gene on the pGOI plasmid, resulting in the following... Figure 2 The pGOI-5'TS plasmid is shown in figure a.

[0048] The EF1a promoter, the shTS hairpin structure targeting the TS sequence (5'-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgTGAGAATGAGCCTGCCTGTAAAtagtgaagccacagatgtaTTTACAGGCAGGCTCATTCTCGtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttt-3'), and the WPRE-SV40pA fragment were inserted into the pHelper plasmid to obtain the following results: Figure 2 The pHelper-shTS plasmid shown in figure a is shown in figure a.

[0049] High concentrations and high purity of pGOI-5'TS, pRep-Cap(AAV9), pRep-Cap(AAV2), pHelper, pHelper-shSram, and pHelper-shTS plasmids were extracted.

[0050] (2) rAAV packaging

[0051] One day before transfection, 293T cells were resuspended in DMEM medium and counted at a concentration of 6 × 10⁻⁶. 6 One cell per dish is evenly seeded into a 10-cm cell culture dish and cultured at 37°C with 5% CO2 until the cell confluence is approximately 80%.

[0052] Set up the following plasmids: Control group: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper; shScram group: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shScram; shTS group: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shTS.

[0053] On the day of transfection, replace the medium with fresh DMEM. Mix each of pGOI, pRep-Cap, and pHelper in a ratio of 2.0 μg:2.5 μg:2.5 μg:2.3 μg, with three replicates per group. Mix 0.5 mL of DMEM with the plasmid DNA, and then mix 0.5 mL of DMEM with 8.4 μL of PEIpro. Add the PEIpro mixture to the DNA mixture and mix well. Incubate at room temperature for 15 min. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for further culture.

[0054] On the third day post-transfection, eGFP fluorescence was observed under a fluorescence microscope. Fluorescence imaging results showed a slight decrease in fluorescence intensity in the shTS group compared to the Control and shScram groups. Figure 2 b).

[0055] (3) Genomic titer determination

[0056] Add 100 μL of cell lysis buffer to the transfected culture dish, incubate at room temperature for 30 min, and then collect 50 μL of the supernatant to determine the genomic titer. Digest the harvested supernatant with DNase I and determine the genomic titer using qRT-PCR. Construct a standard curve using serially diluted plasmid standards. Calculate the genomic titer of the rAAV sample based on the standard curve.

[0057] Genomic titer assay results showed that, compared to the Control group, the genomic titers of the AAV9 and AAV2 shTS groups were increased by 5.29 times (…). Figure 2 c) and 3.08 times ( Figure 2 d).

[0058] Example 3: rAAV packaging effect of inhibiting target gene expression by targeting the 3' end target sequence on pGOI.

[0059] (1) Plasmid construction and preparation

[0060] Using molecular biology techniques such as gene synthesis, PCR, Gibson assembly, and sequencing analysis, a 24 bp target sequence (TS) was inserted into the 3' end of the eGFP gene on the pGOI plasmid to obtain... Figure 3 The pGOI-3'TS plasmid is shown in figure a.

[0061] High concentrations and high purity of pGOI-3'TS, pRep-Cap(AAV9), pRep-Cap(AAV2), pHelper, pHelper-shSram, and pHelper-shTS plasmids were extracted.

[0062] (2) rAAV packaging

[0063] One day before transfection, 293T cells were resuspended in DMEM medium and counted at a concentration of 6 × 10⁻⁶. 6 One cell per dish is evenly seeded into a 10-cm cell culture dish and cultured at 37°C with 5% CO2 until the cell confluence is approximately 80%.

[0064] Set up the following plasmids: Control group: pGOI-3'TS, pRep-Cap (AAV9 or AAV2), pHelper; shScram group: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shScram; shTS group: pGOI-3'TS, pRep-Cap (AAV9 or AAV2), pHelper-shTS.

[0065] On the day of transfection, replace the medium with fresh DMEM. Mix each of pGOI, pRep-Cap, and pHelper in a ratio of 2.0 μg:2.5 μg:2.5 μg:2.3 μg, with three replicates per group. Mix 0.5 mL of DMEM with the plasmid DNA, and then mix 0.5 mL of DMEM with 8.4 μL of PEIpro. Add the PEIpro mixture to the DNA mixture and mix well. Incubate at room temperature for 15 min. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for further culture.

[0066] On the third day post-transfection, eGFP fluorescence was observed under a fluorescence microscope. Fluorescence imaging results showed that the fluorescence intensity of the shTS group was significantly lower than that of the Control and shScram groups. Figure 3 b).

[0067] (3) Genomic titer determination

[0068] Add 100 μL of cell lysis buffer to the transfected culture dish, incubate at room temperature for 30 min, and then collect 50 μL of the supernatant to determine the genomic titer. Digest the harvested supernatant with DNase I and determine the genomic titer using qRT-PCR. Construct a standard curve using serially diluted plasmid standards. Calculate the genomic titer of the rAAV sample based on the standard curve.

[0069] Genomic titer assay results showed that, compared to the Control group, the genomic titers of the AAV9 and AAV2 shTS groups were increased by 8.68 times (…). Figure 3 c) and 6.23 times ( Figure 3 d).

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A plasmid system for high-yield rAAV, characterized in that, This includes transgenic plasmids containing two terminal inverted repeat sequences, packaging plasmids, helper plasmids, and shRNA expression cassettes; The shRNA expression cassette includes a sequence that targets the 5' or 3' end of the target gene outside the coding region of the transgenic plasmid; The transgenic plasmid contains a target sequence inserted at the 5' or 3' end outside the coding region of the target gene; the nucleotide sequence of the target sequence is: 5'GGCGAGAATGAGCCTGCCTGTAAA -3'; The shRNA expression cassette includes a promoter that drives the shRNA, a hairpin structure that targets the target sequence on the transgenic plasmid, and a terminator. The nucleotide sequence of the shRNA hairpin structure is: 5'- tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgTGAGAATGAGCCTGCCTGTAAAtagtgaagcc acagatgtaTTTACAGGCAGGCTCATTCTCGtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttt -3'; The shRNA expression cassette is located on a helper plasmid.

2. The plasmid system for high-yield rAAV production according to claim 1, characterized in that, The transgenic plasmid is pGOI plasmid; the packaging plasmid is pRep-Cap; and the helper plasmid is pHelper.

3. A cell that produces high levels of rAAV, characterized in that, The plasmid system comprising any one of claims 1-2.

4. The cell with high rAAV production according to claim 3, characterized in that, The cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

5. The use of the plasmid system according to any one of claims 1-2, or the cell according to claim 3 or 4, in rAAV production.

6. A method for improving the production of recombinant adeno-associated virus, characterized in that, Transfect packaging cells using the plasmid system described in any one of claims 1-2; or culture the cells described in claim 3 or 4.

7. The method according to claim 6, characterized in that, The packaging cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

Citation Information

Patent Citations

  • Viral vector production

    US20200199622A1