Dihydro-linalool furan-type sesquiterpenoids, extracts containing these compounds, and their applications

Abstract

This invention discloses a dihydroagarinuran-type sesquiterpene compound, an extract containing this compound, and its applications. The invention involves extraction of *Malus kunmingensis* fruit with petroleum ether and ethyl acetate, followed by separation using silica gel column chromatography, gel column chromatography, C-18 reversed-phase column chromatography, and high-performance liquid chromatography (HPLC) to obtain a series of dihydroagarinuran-type sesquiterpene compounds. In vitro tests have verified that the dihydroagarinuran-type sesquiterpene compounds provided by this invention have no significant toxicity. Furthermore, the extract and monomeric compounds containing these compounds exhibit good anti-inflammatory effects on the skin.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to a dihydroagarinuran-type sesquiterpene compound, an extract containing this compound, and its applications. Background Technology

[0002] *Tripterygium hypoglaucum* (Levl.) Hutch, belonging to the genus *Tripterygium* in the family Celastraceae, is a perennial vine-shrub with various physiological activities including anti-inflammatory, analgesic, antitumor, and immunomodulatory effects. It is widely used in the treatment of rheumatoid arthritis, eczema, and malignant tumors. The root of *Tripterygium hypoglaucum*, as a traditional Chinese medicine, has been clinically proven effective against various skin problems such as psoriasis and systemic lupus erythematosus. However, due to its high toxicity, its active ingredients and mechanisms of action are not fully understood, limiting its further development and utilization. Current research on the chemical composition and pharmacological effects of *Tripterygium hypoglaucum* mainly focuses on root extracts, which are then formulated into tablets for widespread clinical application in the treatment of rheumatoid arthritis and systemic lupus erythematosus. However, there are currently no reports on the chemical composition and physiological activities of the fruit of *Tripterygium hypoglaucum*. Summary of the Invention

[0003] The inventors screened different parts of *Malus kunmingensis* for toxicity and anti-inflammatory activity on the skin. Through comparison, they found that the toxicity of the fruit portion extracted with petroleum ether was reduced, and it exhibited good anti-inflammatory activity. Considering the sustainable use and safety of the medicinal resources, the inventors systematically separated the chemical components of the petroleum ether extract of the fruit, discovering that it contained abundant dihydrolinuranyl sesquiterpenes. These compounds have multiple chiral carbons, are multi-oxidized, and readily form esters with various acyl groups. Different substituents, binding sites, and configurations can all lead to differences in pharmacological activity. The dihydrolinuranyl sesquiterpenes involved in this invention are prepared by extracting *Malus kunmingensis* fruit and exhibit superior anti-inflammatory activity, solving the problem of the lack of known medicinal uses of *Malus kunmingensis* fruit for treating inflammation and the lack of a material basis for the fruit portion. To date, the chemical structure and activity of related compounds from this portion have not been reported in relevant patents or literature.

[0004] To achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0005] According to a first aspect of the present invention, the present invention provides a dihydroagarinuran-type sesquiterpene compound having the following structure:

[0006]

[0007] According to a second aspect of the present invention, the present invention provides an extract containing dihydrolinofuran-type sesquiterpenoid compounds as described above.

[0008] Furthermore, the method for preparing the extract includes:

[0009] Using dried fruits of *Malus kunmingensis* as raw material, the extract was refluxed with 95% methanol 2-3 times, and the extracts were combined.

[0010] The extract was concentrated under reduced pressure to obtain a total extract;

[0011] The total extract was suspended in water, extracted with petroleum ether, and the petroleum ether extract was collected and concentrated to obtain the extract.

[0012] According to a third aspect of the present invention, the present invention provides a pharmaceutical composition comprising the dihydrolinofuran-type sesquiterpene compound as described above and a pharmaceutically acceptable carrier or excipient thereof.

[0013] According to a fourth aspect of the present invention, the present invention provides a pharmaceutical composition comprising the extract as described above and a pharmaceutically acceptable carrier or excipient thereof.

[0014] According to a fifth aspect of the present invention, the present invention provides the use of the dihydrolinofuran-type sesquiterpenoid compound, the extract, the pharmaceutical composition, or the pharmaceutical composition as described above in the preparation of an anti-inflammatory drug.

[0015] Furthermore, the anti-inflammatory drug is used to treat skin inflammation.

[0016] Furthermore, the anti-inflammatory drug is used to treat skin complications.

[0017] The embodiments of the present invention have the following advantages:

[0018] This invention involves extracting the fruit of *Malus kunmingensis* with petroleum ether and ethyl acetate, followed by separation using silica gel column chromatography, gel column chromatography, C-18 reversed-phase column chromatography, and high-performance liquid chromatography (HPLC) to obtain a series of dihydroagarinuran-type sesquiterpenes. In vitro experiments verified that the dihydroagarinuran-type sesquiterpenes provided by this invention have no significant cytotoxicity. Furthermore, extracts containing these compounds and some monomeric compounds exhibit good anti-inflammatory effects on the skin. Attached Figure Description

[0019] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0020] Figure 1 X-ray single-crystal diffraction patterns of compounds 5, 6, 10, and 16 provided in this invention.

[0021] Figure 2 ECD spectra of compounds 1–4, 7–9, 11–15, 17–27 provided for this invention.

[0022] Figure 3 This invention provides the survival rate of human immortalized epidermal cells (HaCat) after 72 hours of treatment with petroleum ether fraction (FP) of *Malus kunmingensis* fruit and 27 compounds using the MTT assay. Figure A shows the cell survival rate of HaCat cells after treatment with different concentrations of petroleum ether fraction (FP) of *Malus kunmingensis* fruit; Figure B shows the cell survival rate of HaCat cells after treatment with the 27 compounds. The bar graph in the figure represents the mean (SEM) ± standard deviation of three independent experiments.

[0023] Figure 4 This invention provides the expression of related inflammatory factors S100A8, DEFB4A, and CCL-2 in HaCaT cells induced by TNF-α and IL-17A at a concentration of 25 μM, using dexamethasone as a positive control. The figure shows the mean (SD) ± standard deviation of three independent experiments as a bar graph, where * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001. Detailed Implementation

[0024] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Isolation and Identification of Compounds 1-27

[0026] 7 kg of dried fruit of *Malus kunmingensis* was pulverized and extracted three times by reflux with 95% methanol. The extract was concentrated under reduced pressure to obtain 1 kg of extract. The extract was suspended in water and extracted three times successively with petroleum ether and ethyl acetate. The extract was concentrated under reduced pressure to obtain petroleum ether extract, ethyl acetate extract, and water extract.

[0027] The petroleum ether extract (215 g) was dissolved in acetone, adsorbed onto 1.5 times its volume of silica gel, and allowed to evaporate naturally at room temperature. Separation was performed by silica gel chromatography using a petroleum ether:acetone (10:1–0:1) to obtain seven fractions. Fr.C (10 g) was separated by MCI with H2O / MeOH (40%–90%) to obtain five fractions Fr C.1–Fr C.5. Fr C.3 was purified sequentially by Sephadex LH-20 gel (CH2Cl2 / MeOH, 1:1) and HPLC semi-preparative C-18 reversed-phase column chromatography to obtain compound 3 (100.0 mg). Fr.D (15 g) was separated by MCI with H2O / MeOH (40%–90%) to obtain five fractions Fr D.1–Fr D.5. Fr D.2 was sequentially purified by Sephadex LH-20 gel (CH2Cl2 / MeOH, 1:1), reversed-phase C18 silica gel column (MeOH / H2O, 50%–85%), and semi-preparative C-18 reversed-phase column chromatography (CH3CN / H2O, 70%) to obtain compounds 5 (31.6 mg), 7 (2.5 mg), 8 (2 mg), 13 (7 mg), 26 (2 mg), and 27 (5.0 mg). Fr D.3 was sequentially purified by reversed-phase C18 silica gel column (MeOH / H2O, 40%–85%), and semi-preparative C-18 reversed-phase column chromatography (CH3CN / H2O, 75%) to obtain compound 12 (5.4 mg). Fr D.4 was sequentially purified by reversed-phase C18 silica gel column chromatography with MeOH / H2O (40%–85%), Sephadex LH-20 gel chromatography (CH2Cl2 / MeOH, 1:1), and semi-preparative C-18 reversed-phase column chromatography (CH3CN / H2O, 65%–75%) to obtain compounds 9 (21.7 mg), 14 (3.7 mg), 15 (3.5 mg), and 18 (3.0 mg). Fr E (10 g) was separated by MCI with H2O / MeOH (40%–100%) to obtain five fractions FrE.1–Fr E.5. Fr E.2 was separated and purified sequentially by Sephadex LH-20 gel (CH2Cl2 / MeOH, 1:1) and HPLC semi-preparative C-18 reversed-phase column chromatography (CH3CN / H2O, 65%–70%) to obtain compounds 6 (7.2 mg) and 10 (50.7 mg).Fr E.3 was purified sequentially using reversed-phase C18 silica gel column chromatography with MeOH / H2O (40%–100%), Sephadex LH-20 gel chromatography with CH2Cl2 / MeOH (1:1), and HPLC semi-preparative C-18 reversed-phase column chromatography with CH3CN / H2O (63%–70%) to obtain compounds 11 (3.4 mg), 20 (22.3 mg), and 21 (13.0 mg). Fr E.4 was purified sequentially using reversed-phase C18 silica gel column chromatography with MeOH / H2O (40%–100%), Sephadex LH-20 gel chromatography with CH2Cl2 / MeOH (1:1), and HPLC semi-preparative C-18 reversed-phase column chromatography with CH3CN / H2O (65%–68%) to obtain compounds 22 (10.0 mg) and 25 (2.6 mg). Fr.F (12g) was separated by MCI with H2O / MeOH (40%–100%) to obtain six fragments: Fr F.1–Fr F.5. Fr F.2 was then separated and purified sequentially by reversed-phase C18 silica gel column chromatography with MeOH / H2O (40%–100%), Sephadex LH-20 gel chromatography (CH2Cl2 / MeOH, 1:1), and semi-preparative HPLC with C-18 reversed-phase column chromatography (CH3CN / H2O, 60%–65%) to obtain compounds 17 (4.8mg) and 23 (2.6mg). Fr F.4 was sequentially separated and purified by reversed-phase C18 silica gel column chromatography with MeOH / H2O (40%–100%), Sephadex LH-20 gel chromatography with CH2Cl2 / MeOH (1:1), and semi-preparative C-18 reversed-phase column chromatography with HPLC (CH3CN / H2O, 63%–68%) to obtain compounds 1 (3.8 mg), 2 (4.7 mg), 16 (9.0 mg), and 24 (10.1 mg).

[0028] The physicochemical properties of the 27 isolated monomeric compounds were analyzed, and their structures were determined and identified using various spectroscopic techniques, including NMR, MS, IR, UV, ECD, and X-ray single-crystal diffraction. The spectroscopic and physicochemical constants of the 27 new compounds of this invention are as follows:

[0029] Hypogricin XIII (Compound 1): White amorphous powder, HRESIMS m / z 625.2622 [M+Na] + (calcd for C 36 H 42 O 11 Na, 625.2619), UV(MeOH)λ max(logε)212(3.67),232(4.02)nm.ECD(MeOH)λmax(Δε)206(-0.15),243(-0.58)nm.IR(KBr)ν max 2968,2930,1744,1623,1602,1452,1369,1253,1239,1227,1180,1148,1098,1025cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[2.21(3H,s)],AcO-6[2.11(3H,s)],AcO-8[1.57(3H,s)],nButO-2[2.25(2H,m),1.15(2 H,m),0.93(3H,t,J=7.4Hz)], BzO-9[8.02(2H,d,J=6.9Hz),7.57(1H,t,J=7.4Hz),7.43(2H,m)]; 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.6(s),20.5(q)],AcO-6[170.0(s),21.3(q)],AcO-8[169.5(s),21.5(q)],BzO-9[165.0(s),133.8(d),130.3x 2(d),128.9(s),128.5x 2(d)],nButO-2[172.8(s),36.8(t),18.6(t),13.8(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1S,2R,4R,5S,6R,7R,8S,9S,10S)-1,6,8-triacetoxy-9-benzoyloxy-2-n-butanoyloxydihydro-β-agarofuran, and it was named Hypogricin XIII.

[0030] Hypogricin VIII (Compound 2): White amorphous powder, HRESIMS m / z 639.2783 [M+Na] + (calcd for C 33 H 44 O 11 Na, 639.2776), UV(MeOH)λmax (logε)211(3.13),232(3.61)nm.ECD(MeOH)λmax(Δε)207(-0.41),212(0.68),241(-1.09)nm.IR(KBr)ν max 2970,2931,1745,1603,1630,1453,1383,1369,1239,1226,1181,1147,1098,1025cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[2.19(3H,s)],AcO-6[2.10(3H,s)],AcO-8[1.58(3H,s)],BzO-9[8.02(2H,d,J=6.9Hz),7.56(1H,m)7.44( 2H,t,J=7.8Hz)], MeButO-2[0.89(3H,t,J=7.4Hz),1.12(3H,t,J=7.0Hz),1.45(1H,m),1.63(1H,m),2.33(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.5(s),20.5(q)],AcO-6[170.0(s),21.3(q)],AcO-8[169.5(s),21.5(q)],BzO-9[165.0(s),133.8(s),130.3x 2(d),128.9(s),128.5x 2(d)], MeButO-2[175.9(s),41.8(d),26.7(t),16.9(q),11,7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1S,2R,4R,5S,6R,7R,8S,9S,10S)-1,6,8-triacetoxy-9-benzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin VIII.

[0031] Hypogricin XIV (Compound 3): White amorphous powder, HRESIMS m / z 539.2661 [M+Na] + (calcd for C 28 H36 O9Na,539.2252), UV(MeOH)λ max (logε)211(3.68),231(4.24)nm.ECD(MeOH)λ max (Δε)227(0.23),243(-1.97)nm.IR(KBr)ν max 2956,2929,1744,1714,1452,1387,1367,1279,1243,1097,1021cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[2.10(3H,s)],AcO-2[1.60(3H,s)],AcO-6[2.02(3H,s)],BzO-9[8.04(2H,m),7.55(1H,m),7.43(2H,t,J=7.8Hz)]. 13 C NMR (CDCl3, 125MHz)δ C AcO-1[169.7(s),21.1(q)],AcO-2[169.2(s),20.1(q)],AcO-6[169.6(s),21.0(q)],BzO-9[165.1(s),133.0(d),129.8 x 2(d),129.2(s),128.0 x 2(d)]. Based on 1D NMR and 2D NMR data, combined with ECD calculations, its absolute configuration was determined to be (1S,2R,4R,5S,6R,7S,9S,10R)-1,2,6-triacetoxy-9-benzoyloxydihydro-β-agarofuran, and it was named Hypogricin XⅣ.

[0032] Hypogricin XV (Compound 4): White amorphous powder, HRESIMS m / z 581.2727 [M+Na] + (calcd for C 31 H 42 O9Na,581.2721), UV(MeOH)λ max (logε)211(3.43),231(3.94)nm.ECD(MeOH)λ max(Δε)206(-0.76),241(-1.25)nm.IR(KBr)ν max 2969,2930,1740,1602,1453,1367,1272,1231,1182,1147,1098,1180,1051,1026,882,713cm - 1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.60(3H,s)],AcO-6[2.13(3H,s)],BzO-9[8.03(2H,m),7.56(1H,td,J=7.3,1.3Hz),7.44(2H,t,J =7.8Hz)], MeButO-2[0.89(3H,t,J=7.4Hz),1.12(3H,t,J=7.0Hz),1.45(1H,m),1.64(1H,m),2.32(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.3(s),21.5(q)],AcO-6[169.7(s),20.6(q)],BzO-9[165.2(s),133.5(d),130.3x 2(d),129.3(s),128.5x 2(d)], MeButO-2[175.9(s),41.9(d),26.8(t),16.9(q),11.7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1S,2R,4R,5S,6R,7S,9S,10R)-1,6-diacetyloxy-9-benzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin XV.

[0033] Hypogricin XⅠ (compound 5): colorless needle-like crystals, HRESIMS m / z 763.3096 [M+Na] + (calcd forC 43 H 48 O 11 Na, 763.3089), UV(MeOH)λ max(logε)211(3.92),227(4.33)nm.ECD(MeOH)λ max (Δε)220(-0.94),233(17.52)nm.IR(KBr)ν max 2970,2931,1727,1602,1452,1315,1282,1233,1178,1114,1094,1027,708cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :BzO-1[7.58(2H,m),7.02(2H,t,J=7.8Hz),7.24(1H,m)],BzO-2[7.12(1H ,tt,J=7.6,1.4Hz),7.47(2H,m),6.85(2H,t,J=7.7Hz)],BzO-9[8.00(2H,m) ),7.47(2H,m),7.7.58(2H,m)],AcO-6[2.12(s,3H)],MeButO-8[0.75(3H,t ,J=7.4Hz),1.13(3H,t,J=7.0Hz),1.41(1H,m),1.61(1H,m),2.38(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C:BzO-1[165.0(s),129.4(d),129.4x 2(d),128.7(s),127.7x 2(d)], BzO-2[165.4(s),133.1(d),129.3(s),128.7×2(d),127.8×2(d)],BzO-9[166.0(s),133.1(d),130.5(s),129.7x 2(d),129.4x 2(d)], AcO-6[169.99(s),21.5(q)], MeButO-8[175.2(s),41.7(d),26.7(t),16.6(q),11.7(q)]. Based on the relevant data from 1DNMR and 2DNMR, and combined with the results of X-ray single-crystal diffraction experiments [Flack parameter:=0.02(5)], its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9S,10S)-6-acetyloxy-1,2,9-tribenzoyloxy-8-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named HypogricinⅩⅠ.

[0034] Hypogricin XVI (Compound 6): Colorless needle-like crystals, HRESIMS m / z 685.2990 [M+Na] + (calcdfor C 38 H 46 O 10 Na, 685.2983), UV(MeOH)λ max (logε)212(4.09),223(4.17),283(4.12)nm.ECD(MeOH)λ max (Δε)199(0.78),206(3.69),214(1.61),231(7.05),256(-1.48)nm.IR(KBr)ν max 3445,2969,2930,1725,1637,1451,1335,1275,1233,1178,1094,1027,977,712cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H:AcO-6[2.11(3H,s),CinO-1[7.29(1H,d,J=15.9Hz),7.21(1H,m),7.16(2H,m),6.97(2H,d,J=7.5Hz),5.85(1H,d,J=15.9Hz)],BzO-9[ 8.0(2H,m),7.19(2H,m),7.29(m,1H)], MeButO-8[0.77(3H,t,J=7.4Hz),1.13(3H,t,J=7.0Hz),1.42(1H,m),1.63(1H,m),2.39(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-6[169.9(s),21.5(q)],CinO-1[165.9(s),145.4(d),134.0(s),132.8(d),128.3x 2(d),128.1x 2(d),117.4(d)],BzO-9[165.1(s),130.3(d),129.8(s),129.7x 2(d),128.5x 2(d)], MeButO-8[175.4(s),41.8(d),26.7(t),16.7(q),11.7(q)]. Based on the relevant data from 1DNMR and 2DNMR, and combined with the results of X-ray single-crystal diffraction experiments [Flack parameter:=0.13(5)], its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9S,10S)-6-acetyloxy-9-benzoyloxy-8-(2-methyl)-butyryloxy-1-cinnamoyloxy-2-hydroxydihydro-β-agarofuran, and it was named HypogricinⅩⅥ.

[0035] Hypogricin XVII (Compound 7): White amorphous powder, HRESIMS m / z 745.2830 [M+Na] + (calcd for C 39 H 46 O 13 Na, 745.2831), [α] 25 D +48.67(c 0.15,MeOH),UV(MeOH)λ max (logε)212(3.88),230(4.26)nm.ECD(MeOH)λ max(Δε)199(19.16),222(0.78),237(13.62)nm.IR(KBr)ν max 2968,2929,1738,1601,1451,1369,1315,1274,1250,1234,1176,1095,714cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.46(3H,s)],AcO-6[2.11(3H,s)],AcO-15[2.23(3H,s)],BzO-2[8.08(2H,m),7.57(1H,t,J=7.4Hz)),7.48(2H,t,J= 7.7Hz)], BzO-9[7.93(2H,m),7.53(1H,m),7.39(2H,t,J=7.8Hz)], nButO-8[2.30(2H,m),1.53(2H,m),0.76(3H,t,J=7.4Hz)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.8(s),20.6(q)],AcO-6[169.8(s),21.4(q)],AcO-15[171.0(s),21.3(q)],BzO-2[165.9(s),133.5(d),129.8x 2(d),129.8(s),128.6x 2(d)],BzO-9[164.7(s),133.4(d),129.6x 2(d),129.2(s),128.6x 2(d)],nButO-8[172.7(s),36.2(t),18.3(t),13.5(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9S,10S)-1,6,15-triacetyloxy-2,9-dibenzoyloxy-8-n-butyryldihydro-β-agarofuran, and it was named Hypogricin XVII.

[0036] Hypogricin XII (Compound 8): White amorphous powder, HRESIMS m / z 745.2830 [M+Na] + (calcd for C39 H 46 O 13 Na, 745.2831), UV(MeOH)λ max (logε)211(3.96),230(4.32)nm.ECD(MeOH)λ max (Δε)199(20.95),221(0.91),237(14.67)nm.IR(KBr)ν max 2967,2929,1743,1722,1601,1451,1370,1278,1230,1094,717cm -1 . 1 H NMR and 13 The CNMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are also provided. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.45(3H,s)],AcO-6[2.13(3H,s)],AcO-15[2.18(3H,s)],BzO-2[8.08(2H,m),7.58(1H,t,J=7.4Hz)),7.48(2H,t,J=7.7Hz)],B zO-9[7.94(2H,m),7.50(1H,m),7.39(2H,t,J=7.8Hz)],iButO-8[2.58(1H,d,J=7.0Hz)],1.00(3H,d,J=7.0Hz),1.14(3H,d,J=7.0Hz)]. 13 C NMR (CDCl3, 125MHz)δ C:AcO-1[169.8(s),20.4(q)],AcO-6[169.7(s),21.3(q)],AcO-15[170.8(s),21.1(q)],BzO-2[165.9(s),133.4(d),129.8x 2(d),129.8(s),128.6x 2(d)],BzO-9[164.7(s),133.3(d),129.6x 2(d),129.2(s),128.6x 2(d)],iButO-8[176.2(s),34.0(t),18.9(q),18.8(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9S,10S)-1,6,15-triacetyloxy-2,9-dibenzoyloxy-8-i-butyryldihydro-β-agarofuran, and it was named Hypogricin XII.

[0037] Hypogricin XII (Compound 9): White amorphous powder, HRESIMS m / z 779.2678 [M+Na] + (calcd for C 42 H 44 O 13 Na, 779.2674), UV(MeOH)λ max (logε)211(4.14),231(4.60)nm.ECD(MeOH)λ max (Δε)209(5.85),223(11.17),241(-11.12)nm.IR(KBr)ν max 3064,2973,2931,1744,1723,1602,1451,1369,1269,1229,1098,1025,712cm - 1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H:AcO-1[1.51(3H,s)],AcO-6[2.14(3H,s)],AcO-15[1.90(3H,s)],BzO-2[8.09(2H,m),7.55(1H,m),7.47(2H, m)], BzO-8[8.00(2H,m),7.55(1H,m),7.41(2H,t,J=7.8Hz)], BzO-9[7.85(2H,m),7.47(1H,m),7.33(2H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.8(s),20.6(q)],AcO-6[169.8(s),21.4(q)],AcO-15[171.0(s),21.3(q)],BzO-2[166.0(s),133.5(d),129.9x 2(d),129.8(s),128.5x 2(d)],BzO-8[166.3(s),133.4(d),130.0x 2(d),128.9(s),128.4x 2(d)],BzO-9[164.6(s),133.8(d),130.4x 2(d),130.0(s),128.5x 2(d)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculation results, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9S,10S)-1,6,15-triacetyloxy-2,8,9-tribenzoyloxydihydro-β-agarofuran, and it was named Hypogricin XII.

[0038] Hypogricin XVIII (Compound 10): Colorless needle-like crystals, HRESIMS m / z 697.2840 [M+Na] + (calcdfor C 35 H 46 O 13 Na, 697.2831), UV(MeOH)λ max (logε)211(3.45),232(3.94)nm.ECD(MeOH)λ max (Δε)208(-0.22),230(-1.48)nm.IR(KBr)ν max 2971,2934,1743,1453,1369,1270,1237,1148,1086,1026,713cm -1 . 1H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.43(3H,s)],AcO-6[2.08(3H,s),AcO-8[2.16(3H,s)],AcO-15[2.26(3H,s)],BzO-9[7.99(2H,dt,J=8.5,1.6Hz),7.56 (1H,m),7.42(2H,t,J=7.9Hz)],MeButO-2[0.86(3H,t,J=7.4Hz),1.12(3H,t,J=7.0Hz),1.48(1H,m),1.63(1H,m),2.37(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.2(s),20.4(q)],AcO-6[169.8(s),21.3(q)],AcO-8[169.7(s), 21.4(q)],AcO-15[170.6(s),21.4(q)],BzO-9[164.7(s),133.8(d),130.3x 2(d),128.5x 2(d),128.5(s)], MeButO-2[175.8(s),41.8(d),26.6(t),16.8(q),11.6(q)]. Based on the relevant data from 1DNMR and 2DNMR, and combined with the results of X-ray single-crystal diffraction experiments [Flack parameter:=0.04(5)], its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9R,10S)-1,6,8,15-tetracetyloxy-9-benzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named HypogricinⅩⅧ.

[0039] Hypogricin XIX (Compound 11): White amorphous powder, HRESIMS m / z 639.2782 [M+Na] + (calcd for C 33 H 44 O 11 Na, 639.2776), UV(MeOH)λ max (logε)210(3.64),232(4.06)nm.ECD(MeOH)λmax (Δε)201(-5.01),221(1.8),239(-9.62)nm.IR(KBr)ν max 2968,2930,1739,1453,1368,1273,1265,1239,1181,1144,1093,1024,914,883,713cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (600MHz, CDCl3)δ H :AcO-1[1.50,(3H,s)],AcO-8[2.14,(3H,s)],AcO-15[2.13,(3H,s)],BzO-9[8.03(2H,m),7.44(2H,td,J=7.8,2.6 Hz),7.57(1H,m)], MeButO-2[2.36(1H,m),1.64(1H,m),1.45(1H,m),1.14(3H,d,J=7.0Hz),0.89(3H,t,J=7.4Hz)]. 13 C NMR (CDCl3, 150MHz) δ C :AcO-1[169.5(s),20.5(q)],AcO-8[169.6(s),21.5(q)],AcO-15[170.8(s),21.4(q)],BzO-9[164.9(s),133.7(d),130.3x 2(d),129.0(s),128.5x 2(d)], MeButO-2[176.0(s),41.8(d),26.6(t),16.9(q),11.7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,7R,8R,9R,10S)-1,8,15-triacetyloxy-9-benzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin XIX.

[0040] Hypogricin XX (Compound 12): White amorphous powder, HRESIMS m / z 759.2993 [M+Na] + (calcd for C 40 H 48 O 13Na, 759.2987), UV(MeOH)λ max (logε)210(3.67),232(4.17)nm.ECD(MeOH)λ max (Δε)208(-0.22),230(-1.48)nm.IR(KBr)ν max 2967,2929,1743,1602,1452,1369,1313,1264,1229,1179,1148,1096,1042,1024,713cm -1 . 1 HNMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (800MHz, CDCl3)δ H :AcO-1[1.47(3H,s)],AcO-6[2.12(3H,s)],AcO-15[2.05(3H,s)],BzO-8[8.18(2H ,d,J=9.4Hz),7.46(2H,dt,J=15.4,7.6Hz),7.59(1H,t,J=7.4Hz)],BzO-9[8.05(2 H,d,J=8.3Hz),7.46(2H,dt,J=15.4,7.6Hz),7.59(1H,t,J=7.4Hz)],MeButO-2[2. 40(1H,m),1.68(1H,m),1.50(1H,m),1.15(3H,d,J=7.0Hz),0.89(3H,t,J=7.4Hz)]. 13 C NMR (CDCl3, 200MHz) δ C:AcO-1[169.3(s),20.5(q)],AcO-6[169.9(s),21.3(q)],AcO-15[170.9(s),21.5(q)],BzO-8[165.7(s),133.5(d),130.2x 2(d),130.0(s),128.5x 2(d)],BzO-9[164.5(s),133.8(d),130.4x 2(d),128.9(s),128.6x 2(d)], MeButO-2[175.9(s),41.9(d),26.6(t),16.8(q).11.7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9R,10S)-1,6,15-triacetyloxy-8,9-dibenzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin XX.

[0041] Hypogricin XXI (Compound 13): White amorphous powder, HRESIMS m / z 731.2668 [M+Na] + (calcd for C 38 H 44 O 13 Na, 731.2674), UV(MeOH)λ max (logε)211(3.95),232(4.42)nm.ECD(MeOH)λ max (Δε)201(-10.41),221(4.81),239(-22.14)nm.IR(KBr)ν max 2974,2931,1743,1725,1452,1369,1266,1226,1097,713cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H:AcO-1[1.47(3H,s)],AcO-6[2.12(3H,s),AcO-15[2.03(3H,s)],BzO-8[8.18(2H,d,J=8.0Hz),7.59(1H,dt,J=7.2,1.7Hz),7.45(2 H,d,J=10Hz)], BzO-9[8.05(2H,d,J=6.9Hz),7.58(1H,dt,J=7.2,1.7Hz),7.45(2H,t,J=10Hz)], ProO-2[2.36(1H,m),1.13(3H,s)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.4(s),20.5(q)],AcO-6[169.8(s),21.4(q)],AcO-15[170.9(s),21.3(q)],BzO-8[165.7(s),133.5(d),130.2x 2(d),128.9(s),128.6x2(d)], BzO-9[164.5(s),133.8(d),130.4x 2(d),130.0(s),128.6x 2(d)], ProO-2[173.6(s),28.2(t),9.2(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9R,10S)-1,6,15-tritracetyloxy-8,9-dibenzoyloxy-2-propionyloxydihydro-β-agarofuran, and it was named Hypogricin XXI.

[0042] Hypogricin XXIII (Compound 14): White amorphous powder, HRESIMS m / z 687.2784 [M+Na] + (calcd for C 36 H 42 O 11 Na, 687.2776). [α] 25 D -31.43(c 0.07,MeOH),UV(MeOH)λ max (logε)212(3.93),232(4.39)nm.ECD(MeOH)λ max (Δε)202(-2.32),222(4.61),239(-16.29)nm.IR(KBr)ν max2966,2929,1737,1602,1452,1367,1265,1225,1179,1095,1025,1016,712cm - 1 . 1 H NMR and 13 The C NMR data are shown in Tables 1 and 3, respectively; the chemical shift values ​​of other substituents are shown in Tables 1 and 3, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.56(3H,s)],AcO-6[2.09(3H,s)],BzO-8[8.16(2H,m),7.57(1H,dt,J=13.5,7.4Hz),7.50(2H,t,J=7.6Hz)],BzO-9[ 8.05(2H,m),7.57(1H,dt,J=13.5,7.4Hz),7.45(2H,t,J=7.8Hz)],nButO-2[2.25(2H,m),1.15(2H,m),0.93(3H,t,J=7.4Hz)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.7(s),20.5(q)],AcO-6[170.0(s),21.5(q)],BzO-8[164.8(s),133.7(d),130.2x 2(d),128.7x 2(d),129.9(s)],BzO-9[164.9(s),133.7(d),130.4x2(d),128.6x 2(d),129.0(s)],nButO-2[172.8(s),36.8(t),18.6(t),13.8(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9R,10S)-1,6-diacetyloxy-8,9-dibenzoyloxy-2-n-butyryldihydro-β-agarofuran, and it was named Hypogricin XXIII.

[0043] Hypogricin XX IV (Compound 15): White amorphous powder, HRESIMS m / z 721.2629 [M+Na] + (calcd for C 40 H 42 O 11 Na, 721.2619), UV(MeOH)λmax (logε)212(4.16),232(4.58)nm.ECD(MeOH)λ max (Δε)209(5.32),224(9.61),242(-8.15)nm.IR(KBr)ν max 2957,2927,2854,1745,1722,1451,1269,1225,1095,1025,712cm -1 . 1 H NMR and 13 The CNMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are also provided. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.56(3H,s)],AcO-6[2.10(3H,s)],BzO-2[7.98(2H,m),7.59(1H,m),7.44(2H,m)],B zO-8[8.06(2H,m),7.59(1H,m),7.44(2H,m)],BzO-9[8.16(2H,m),7.59(1H,m),7.44(2H,m)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[170.1(s),20.6(q)],AcO-6[170.0(s),21.45(q)],BzO-2[166.2(s),133.5(d),129.7x 2(d),128.5x 2(d),129.0],BzO-8[164.9(s),133.8(d),130.4x 2(d),130.0(s),128.7x 2(d)],BzO-9[165.0(s),133.2(d),130.0x 2(d),129.9(s),128.7x2(d)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculation results, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8R,9R,10S)-1,6-diacetoxy-2,8,9-tribenzoyloxydihydro-β-agarofuran, and it was named Hypogricin XX IV.

[0044] Hypogricin I (compound 16): colorless needle-like crystals, HRESIMS m / z 553.2415 [M+Na] + (calcd forC 29 H 38O9Na,553.2408), UV(MeOH)λ max (logε)212(3.45),231(3.95)nm.ECD(MeOH)λ max (Δε)208(-0.34),228(0.51),245(-0.78)nm.IR(KBr)ν max 3047,2974,2937,1746,1736,1710,1450,1387,1366,1276,1232,1184,1097,1016,714cm - 1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.57(3H,s)],AcO-6[2.11(3H,s)],BzO-9[8.00(2H,m),7.59(1H,m),7 .45(2H,t,J=7.8Hz)], ProO-2[2.33(2H,q,J=7.6Hz),1.12(2H,q,J=7.6Hz)]]. 13 C NMR (CDCl3, 125MHz)δ C AcO-1[171.6(s),20.6(q)],AcO-6[171.7(s),21.3(q)],BzO-9[166.7(s),134.4(d),131.1x 2(d),130.9(s),129.4x 2(d)],ProO-2[175.3(s),28.8(t),9.6(q)]. Based on the relevant data from 1DNMR and 2DNMR, combined with the results of X-ray single-crystal diffraction experiments [Flack parameter:=0.12(10)], its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,9S,10R)-1,6-diacetyloxy-9-benzoyloxy-2-propionyloxydihydro-β-agarofuran, and it was named HypogricinⅠ.

[0045] Hypogricin II (compound 17): white amorphous powder, HRESIMS m / z 594.2694 [M+H]+ (calcd for C 33 H 40 NO9,,594.2698), UV(MeOH)λ max (logε)210(4.12),226(4.35)nm.ECD(MeOH)λ max (Δε)211(-0.94),228(1.75),245(-0.51),273(0.73)nm.IR(KBr)ν max 2958,2927,2854,1722,1590,1452,1422,1387,1365,1278,1234,1178,1105,1018,714cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.56(3H,s)],BzO-9[8.07(2H,m),7.57(1H,td,J=7.3,1.3Hz),7.40(2H,m)],NicO-6[9.26(1H,dd,J=2.2,0.8Hz),8.84(1H,dd, J=4.9,1.8Hz),8.32(1H,dt,J=8.0,2.0Hz),7.43(1H,overlapped)], ProO-2[2.30(2H,dd,J=7.5,1.1Hz),1.12(3H,td,J=7.6,1.1Hz)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.7(s),20.6(q)],BzO-9[165.7(s),133.5(d),130.2x 2(d),128.4x 2(d),129.5(s)],NicO-6[164.6(s),154.1(d),151.0(d),136.7(d),126.0(s),123.8(d)],ProO-2[173.6(s),28.2(t),9.3(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,9S,10R)-1-acetyloxy-9-benzoyloxy-2-propionyloxy-6-nicotinyloxydihydro-β-agarofuran, and it was named Hypogricin II.

[0046] Hypogricin III (compound 18): white amorphous powder, HRESIMS m / z 559.2309 [M+Na] + (calcd for C 31 H 36 O6Na,559.23O2), UV(MeOH)λ max (logε)210(4.11),230(4.51)nm.ECD(MeOH)λ max (Δε)197(-0.94),214(0.69),235(17.75)nm.IR(KBr)ν max 3448,2953,2929,1744,1719,1602,1451,1386,1365,1315,1281,1235,1109,1070,1026,1005,713cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.56,(3H,s)],BzO-2[8.05(2H,m),7.54(1H,m),7.45(2H,td,J=7. 8,1.9Hz)], BzO-9[7.98(2H,m),7.54(1H,m),7.45(2H,td,J=7.8,1.9Hz)]. 13 C NMR (CDCl3, 125MHz)δ C AcO-1 [169.7(s), 20.5(q)], BzO-2 [166.1(s), 133.4(d), 130.6(s), 130.3 x 2(d), 128.6 x 2(d)], BzO-9 [165.6(s), 133.0(d), 129.7 x 2(d), 129.7(s), 128.4 x 2(d)]. Based on 1D and 2D MR data and ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,9S,10R)-1-acetyloxy-2,9-dibenzoyloxy-6-hydroxydihydro-β-agarofuran, and it was named Hypogricin III.

[0047] Hypogricin IV (compound 19): white amorphous powder, HRESIMS m / z 639.2785 [M+Na] + (calcd for C 33 H 44 O 11 Na, 639.2774), UV(MeOH)λ max (logε)215(4.01),230(3.21)nm.ECD(MeOH)λ max (Δε)213(-7.64),242(0.46)nm.IR(KBr)ν max 2943,2873,2856,1621,1464,1386,1360,1081,1049,851,661cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.53,(3H,s)],AcO-6[2.23,(3H,s)],AcO-15[2.11,(3H,s)],BzO-9[8.02(2H,m),7.56(1H,td,J=7.3,1.3Hz), 7.44(t,J=7.8Hz,2H)], MeButO-2[0.89(3H,t,J=7.4Hz),1.17(3H,t,J=7.0Hz),1.53(1H,m),1.66(1H,m),2.39(1H,m)]. 13 C NMR (CDCl3, 125MHz)δ C:AcO-1[169.2(s),20.4(q)],AcO-6[170.2(s),21.5(q)],AcO-15[170.7(s),21.4(q)],BzO-9[165.5(s),133.6(d),130.3x 2(d),129.3(s),128.5x 2(d)],MeButO-2[175.9(s),41.9(d),26.7(t),16.8(q).11.7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,9S,10R)-1,6,15-triacetyloxy-9-benzoyloxy-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin IV.

[0048] Hypogricin V (Compound 20): White amorphous powder, HRESIMS m / z 685.2622 [M+Na] + (calcd for C 37 H 42 O 11 Na, 685.2619), UV(MeOH)λ max (logε)223(4.32),248(3.89),279(4.32)nm.ECD(MeOH)λ max (Δε)201(10.92),227(0.92),235(-0.06),274(9.08)nm.IR(KBr)ν max 2930,1744,1714,1634,1451,1368,1313,1273,1238,1167,1141,1092,1014,770,713cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H:AcO-1[1.55,(3H,s)],AcO-6[2.10,(3H,s)],AcO-15[2.28,(3H,s)],BzO-9[8.05(2H,dd,J=8.3,1.4Hz),7.45(2 H,t,J=7.8Hz),7.56(1H,m)],CinO-2[7.75(1H,d,J=16.2Hz),7.65(2H,m),7.39(3H,m),6.43(1H,d,J=16.2Hz)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.5(s),20.5(q)],AcO-6[170.2(s),21.5(q)],AcO-15[170.8(s),21.4(q)],BzO-9[165.5(s),133.6(d),130.3x 2(d),129.3(s),128.5x 2(d)),CinO-2[166.1(s),145.5(d),134.5(d),130.6(s),129.1x 2(d),128.5x 2(d),118.0(d)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,9S,10R)-1,6,15-triacetyloxy-9-benzoyloxy-2-cinnamoyloxydihydro-β-agarofuran, and it was named HypogricinⅤ.

[0049] Hypogricin VI (Compound 21): White amorphous powder, HRESIMS m / z 627.2569 [M+Na] + (calcd for C 35 H 40 O9Na,627.2565), UV(MeOH)λ max (logε)210(4.26),218(4.36),248(3.95),248(4.39)nm.ECD(MeOH)λ max (Δε)227(1.71),276(12.28)nm.IR(KBr)ν max 2693,2932,1742,1713,1636,1451,1367,1279,1239,1226,1173,1136,1109,1012,769,714cm -1 .1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-1[1.59,(3H,s)],AcO-15[2.20,(3H,s)],BzO-9[8.05(2H,dd,J=8.3,1.4Hz),7.45(2H,t,J=7.8 Hz),7.56(1H,m)],CinO-2[7.74(1H,d,J=16.2Hz),7.65(2H,m),7.39(3H,m),6.43(1H,d,J=16.2Hz)]. 13 C NMR (CDCl3, 125MHz)δ C :AcO-1[169.5(s),20.5(q)],AcO-6[170.2(s),21.5(q)],AcO-15[170.8(s),21.4(q)],BzO-9[165.7(s),133.5(d),130.5x 2(d),129.0(s),128.4x 2(d)],CinO-2[166.2(s),145.3(d),134.5(d),130.2x 2(d),129.6(s),128.4x 2(d),118.2(d)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,7R,9S,10R)-1,15-diacetyloxy-9-benzoyloxy-2-cinnamoyloxydihydro-β-agarofuran, and it was named Hypogricin VI.

[0050] Hypogricin VII (compound 22): white amorphous powder, HRESIMS m / z 601.2417 [M+Na] + (calcd for C 33 H 38 O9Na,601.2408), UV(MeOH)λ max (logε)212(3.86),231(4.35)nm.ECD(MeOH)λ max (Δε)199(30.17),213(1.84),235(12.50)nm.IR(KBr)ν max2978,2952,2929,2899,1743,1710,1601,1452,1385,1369,1316,1273,1226,1147,1104,1073,1047,1026,1009,889,810,718cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (800MHz, CDCl3)δ H :AcO-1[1.57(3H,s)],AcO-15[2.18(3H,s)],BzO-2[8.12(2H,m),7.49(2H,m),7.56(1H,m)],BzO-9[8.07(2H,m),7.44(2H,m),7.56(1H,m)]. 13 C NMR (CDCl3, 200MHz) δ C AcO-1[169.7(s),20.6(q)],AcO-15[170.3(s),21.6(q)],BzO-2[166.2(s),133.3(d),130.0x 2(d),129.6(s),128.7x 2(d)],BzO-9[165.7(s),133.5(d),130.3x 2(d),128.9(s),128.4x 2(d)]. Based on 1DNMR and 2DNMR data and ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,7R,9S,10R)-1,15-diacetyloxy-2,9-dibenzoyloxydihydro-β-agarofuran, and it was named Hypogricin VII.

[0051] Hypogricin XXVII (Compound 23): White amorphous powder, HRESIMS m / z 617.2360 [M+Na] + (calcd for C 33 H 38 O 10 Na, 617.2357), [α] 25 D +32.28(c 0.14,MeOH),UV(MeOH)λmax(logε)212(4.04),231(4.43)nm.ECD(MeOH)λ max (Δε)216(0.55),238(2.21)nm.IR(KBr)νmax 3448,2958,2929,1747,1717,1601,1452,1386,1366,1277,1177,1144,1099,1070,1026,976,714cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (600MHz, CDCl3)δ H :AcO-1[1.54,(3H,s)],AcO-2[2.17,(3H,s)],BzO-6[8.22(2H,d,J=6.9Hz),7.58(1H,m), 7.48(2H,d,J=6.9Hz)], BzO-9[8.05(2H,d,J=6.9Hz),7.58(1H,m),7.46(2H,d,J=7.8Hz)], 13 C NMR (CDCl3, 150MHz) δ C :AcO-1[169.7(s),21.3(q)],AcO-15[169.9(s),21.7(q)],BzO-6[165.6(s),133.6(d),130.3x 2(d),129.9(s),128.8x 2(d)], BzO-9[166.2(s),133.6(d),130.2x 2(d),129.6(s),128.5x 2(d)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4S,5S,6R,7R,9S,10R)-1,2-diacetyloxy-6,9-dibenzoyloxy-4β-hydroxydihydro-β-agarofuran, and it was named Hypogricin XXVII.

[0052] Hypogricin X (Compound 24): White amorphous powder, HRESIMS m / z 585.2454 [M+Na] + (calcd for C 33 H 38 O8Na,585.2459), UV(MeOH)λ max (logε)223(3.56),280(3.43)nm.ECD(MeOH)λ max(Δε)204(-4.42),229(11.92),280(-2.73)nm.IR(KBr)ν max 3440,2928,2869,1722,1636,1450,1370,1317,1279,1252,1163,1097,1066,1028,987,867,711cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (600MHz, CDCl3)δ H :AcO-6[2.12,(3H,s)],BzO-8[7.96(2H,d,J=8.4Hz),7.49(1H,m),7.36(2H,d,J=3.6Hz )],CinO-9[7.72(1H,d,J=16.4Hz),7.55(2H,m),7.38(3H,m),6.46(1H,d,J=16.4Hz)], 13 C NMR (CDCl3, 150MHz) δ C AcO-6 [170.1(s), 21.5(q)], BzO-8 [166.1(s), 133.3(d), 130.6 x 2(d), 130.2(s), 128.6 x 2(d)], CinO-9 [165.9(s), 145.9(d), 134.5(s), 129.8 x 2(d), 129.0(d), 128.5 x 2(d), 117.8(d)]. Based on 1D and 2D MR data and ECD calculations, its absolute configuration was determined to be (1R,4R,5S,6R,7R,8S,9S,10S)-6-acetoxy-8-benzoyloxy-9-cinnamoyloxy-1-hydroxydihydro-β-agarofuran, and it was named HypogricinⅩ.

[0053] Hypogricin XXVIII (Compound 25): White amorphous powder, HRESIMS m / z 623.2860 [M+Na] + (calcd for C 35 H 42 O 10 Na, 623.2851), UV(MeOH)λ max (logε)211(4.03),228(4.39)nm.ECD(MeOH)λmax (Δε)238(0.55),222(-10.27)nm.IR(KBr)ν max 2965,2928,2877,2854,1727,1602,1451,1369,1315,1283,1264,1231,1179,1114,1095,1069,1027,970,859,803,712cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (500MHz, CDCl3)δ H :AcO-6[2.12,(3H,s)],BzO-8[8.07(2H,m),7.47(2H,m),7.58(1H,m)],BzO-9[7.87(2H,m),7.2 9(2H,m),7.47(1H,m)],nButO-1[2.26(2H,m),1.63(1H,m),1.25(1H,m),0.93(3H,t,J=7.4Hz). 13 C NMR (CDCl3, 125MHz)δ C :AcO-6[1701(s),21.5(q)],BzO-8[165.9(s),133.3(s),133.1(d),129.9x 2(d),130.0(s),128.5x 2(d)], BzO-9 [164.5(s), 133.3(d), 133.0(s), 130.4x 2(d), 128.6x 2(d)], nButO-1 [173.8(s), 36.9(t), 18.5(t), 13.8(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8S,9S,10S)-6-acetyloxy-8,9-dibenzoyloxy-1-n-butyryloxy-2-hydroxydihydro-β-agarofuran, and it was named Hypogricin XXVIII.

[0054] Hypogricin IX (Compound 26): White amorphous powder, HRESIMS m / z 757.3564 [M+Na] + (calcd for C 42 H 54 O 11 Na, 757.3558), UV(MeOH)λmax(logε)212(4.07),229(4.41)nm.ECD(MeOH)λ max (Δε)202(-1.22),226(7.05),241(-3.44)nm.IR(KBr)ν max 2960,2930,2872,1733,1602,1452,1374,1323,1279,1233,1175,1111,1028,971,802,710cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (800MHz, CDCl3)δ H :AcO-6[2.15,(3H,s)],BzO-1[7.56(2H,d,J=6.9Hz),6.91(2H,t,J=6.9Hz),7.17(1H,t, J=6.8Hz)], BzO-9[7.60(2H,d,J=6.9Hz),7.07(2H,d,J=6.9Hz),7.29(d,J=6.6Hz,1H),He xO-2[2.32(2H,m),1.60(2H,m),1.28(3H,m),0.86(1H,m),0.86(3H,t,J=6.1Hz)],MeButO -8[2.43(1H,m),1.68(1H,m),1.46(1H,m),1.16(3H,t,J=6.3Hz),0.79(3H,t,J=6.8Hz)]. 13 C NMR (CDCl3, 200MHz) δ C:AcO-6[169.9(s),21.5(q)],BzO-1[165.3(s),132.7(d),129.4(s),129.4x 2(d),127.7x 2(d)],BzO-9[165.0(s),132.5(d),129.5(s),129.4x 2(d),127.9x 2(d)], HexO-2[175.3(s),34.9(t),31.3(t),24.3(t),22.4(t),14.0(q)], MeButO-8[175.3(s),41.7(d),26.7(t),16.6(q),11.7(q)]. Based on relevant data from 1DNMR and 2DNMR, and combined with ECD calculations, its absolute configuration was determined to be (1S,2R,4R,5S,6R,7R,8R,9R,10S)-6-acetyloxy-1,9-dibenzoyloxy-2-hexanoyloxy-8-2-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin IX.

[0055] Hypogricin XXIX (Compound 27): White amorphous powder, HRESIMS m / z 821.3152 [M+Na] + (calcd for C 45 H 50 O 13 Na, 821.3144), [α] 25 D +5.6(c 0.25,MeOH),UV(MeOH)λmax(logε)212(3.41),229(3.80)nm.ECD(MeOH)λ max (Δε)220(0.50),232(2.77),247(-0.87)nm.IR(KBr)ν max 2966,2927,2854,1732,1602,1452,1369,1315,1282,1266,1239,1178,1144,1112,1095,1069,1042,1027,708cm -1 . 1 H NMR and 13 The C NMR data are shown in Tables 2 and 4, respectively; the chemical shift values ​​of other substituents are shown in Tables 2 and 4, respectively. 1 H NMR (800MHz, CDCl3)δ H:AcO-6[2.12,(3H,s)],AcO-15[2.20,(3H,s)],BzO-1[7.49(2H,m),7.1 2(1H,m),6.82(2H,m)],BzO-2[8.07(2H,m),7.57(1H,m),7.48(2H,m)], BzO-9[7.49(2H,m),7.33(1H,m),7.10(2H,m)],MeButO-8[2.40(1H,m),1.68(1H,m),1.46(1H,m),0.96(3H,d,J=7.0Hz),0.79(3H,t,J=7.4Hz)]. 13 C NMR (CDCl3, 200MHz) δ C :AcO-6[169.9(s),21.4(q)],AcO-15[171.1(s),21.5(q)],BzO-1[165.4(s),132.7(d),129.4x 2(d),129.1(s),127.8x 2(d)],BzO-2[165.9(s),133.4(d),129.9x 2(d),129.7(s),128.7x 2(d)],BzO-9[164.6(s),132.9(d),129.4x 2(d),128.9(s),128.1x [2(d)],MeButO-8[175.9(s),41.2(d),26.6(t),16.6(q),11.7(q)]. Based on 1D and 2D MR data and ECD calculations, its absolute configuration was determined to be (1R,2S,4R,5S,6R,7R,8S,9S,10S)-6,15-diacetyloxy-1,2,9-tribenzoyloxy-8-(2-methyl)-butyryloxydihydro-β-agarofuran, and it was named Hypogricin XXIX.

[0056] The structures of compounds 1-27 are as follows:

[0057] Table 1. Carbon skeletons of compounds 1–14 in CDCl3 1 H-NMR data (δ) H ,J in Hz)

[0058]

[0059] Table 2 shows the carbon skeletons of compounds 15–27 in CDCl3. 1 H-NMR data (δ) HJin Hz)

[0060] Table 3 shows the carbon skeletons of compounds 1–14 in CDCl3. 13 C-NMR data

[0061]

[0062] Table 4 shows the carbon skeletons of compounds 15–27 in CDCl3. 13 C-NMR data

[0063]

[0064] Note: In Tables 1–4, a uses a 500MHz NMR instrument; b uses a 600MHz NMR instrument; and c uses an 800MHz NMR instrument.

[0065] Example 2: Anti-inflammatory activity of extracts and compounds against TNF-α and IL-17A co-induced inflammation in HaCaT cells

[0066] 1. Experimental Materials

[0067] 1.1 Experimental reagents: Compounds 1-27 were all isolated from the petroleum ether fraction of the fruit of Malus kunmingensis.

[0068] Human immortalized epidermal cells (HaCat) were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China). Fetal bovine serum (Thermo Fisher Scientific), 100 U / mL penicillin and 0.1 mg / mL streptomycin (Beyotime), and DMEM medium (Thermo Fisher Scientific, Waltham, MA, USA) were used. Thiazol blue (MTT: 3-(4,5-dimethylthiazol-2)-2,5-diphenyltetrazolium bromide), dimethyl sulfoxide (DMSO), and dexamethasone were purchased from Sigma.

[0069] 2. Experimental Procedure

[0070] 2.1 Cell Culture and Treatment

[0071] HaCaT cells were cultured in DMEM medium (10% bovine serum) containing 100 U / mL penicillin and 100 μg / mL streptomycin, and incubated at 37°C in a 5% CO2 incubator for routine culture. The medium was changed every other day. After the cells reached confluence, they were digested with 0.25% trypsin and passaged at a ratio of 1:3. HaCaT cells in logarithmic growth phase were seeded at 10,000 cells / well in 96-well plates with three replicates and incubated for 16 hours. After cell attachment, the test compound was added to each well, with dexamethasone as a positive control. The mixture was then incubated at 37°C in a 5% CO2 incubator for 72 hours. Cell viability was determined using the MTT assay.

[0072] 2.2 The compound's anti-inflammatory activity against TNF-α and IL-17A-induced HaCaT cell inflammation

[0073] Healthy HaCaT cells were seeded into 12-well plates at a density of 1.5 x 10⁶ cells per well. 5 HaCaT cells were incubated at 16 h / well for 16 h. After cell adhesion, 50 ng / ml TNF-α / IL-17A was added to each well to co-stimulate HaCaT cells for 24 h. Based on the cytotoxicity screening results, the test compound was added to each well within a safe concentration range, with dexamethasone as a positive control. The mixture was then incubated at 37°C in 5% CO2 for 24 h. RNA was extracted from each well (method referred to in [reference needed]). The extracted total RNA was reverse transcribed using the "Super Total RNA Extraction Kit Simplified Instructions" (following the Novizan Reverse Transcription Kit instructions). The RNA was then reverse transcribed using Yeasen's Hifair III 1st Strand cDNA Synthesis Ultramix, followed by quantitative PCR analysis on a Bio-Rad CFX96 real-time quantitative PCR system using Vazyme's ChamQ Universal SYBR Green qPCR master mix. Gene expression levels were calculated using the 2-ΔΔCT method, with the internal reference gene GAPDH as the standard. Primer sequences:

[0074] GAPDH:

[0075] Forward primer: GGAGCGAGATCCCTCCAAAAT;

[0076] Reverse primer GGCTGTTGTCATACTTCTCATGG.

[0077] S100A8:

[0078] Forward primer: ATTTCCATGCCGTCTACAGG;

[0079] Reverse primer ACGCCCATCTTTATCACCAG.

[0080] DEFB4A:

[0081] Forward primer TTCTCGTTCCTCTTCATATTCCTG;

[0082] Reverse primer GACCACAGGTGCCAATTTG).

[0083] CCL-2:

[0084] Forward primer: CAGCCACCTTCATTCCCC;

[0085] Reverse primer CTTCTTTGGGACACTTGCTG).

[0086] 3. Data Analysis

[0087] Data analysis was primarily performed using GraphPad Prism software. Differences within two groups were analyzed using a two-tailed t-test, and comparisons among multiple groups were performed using analysis of variance. A p-value < 0.05 was considered statistically significant between the two groups. The notation * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, **** indicates p < 0.0001, and ns indicates no statistically significant difference between the two groups.

[0088] 4. Experimental Results

[0089] 4.1 Results of compound screening for HaCaT cell toxicity

[0090] The toxicity of the compounds and the petroleum ether fraction of the fruit to human immortalized epidermal cells (HaCaT) was verified by experiments, with dexamethasone as a positive control. The results showed that the viability of HaCaT cells in the petroleum ether fraction (FP) of *Malus kunmingensis* fruit was greater than 80% at a concentration of 100 μg / mL; except for compound 7, the viability of HaCaT cells was greater than 75% at concentrations greater than or equal to 25 μM for all monomeric compounds, indicating that the compounds had no significant toxicity to HaCaT cells. Figure 3 ).

[0091] The petroleum ether fraction of *Malus kunmingensis* fruit and all the aforementioned compounds were tested at safe concentrations to counteract the inflammatory activity of HaCaT cells induced by TNF-α and IL-17A, with dexamethasone as a positive control. The results showed that the petroleum ether fraction (FP) of *Malus kunmingensis* fruit at a concentration of 20 μg / mL significantly downregulated the expression of related inflammatory factors S100A8, DEFB4A, and CCL-2 in HaCaT cells induced by TNF-α and IL-17A, with downregulation effects comparable to dexamethasone. Compounds 2, 8, 17, 22, 24, and 26, at a concentration of 25 μM, all downregulated the expression of related inflammatory factors S100A8, DEFB4A, and CCL-2 in HaCaT cells induced by TNF-α and IL-17A to varying degrees. Figure 4 ).

[0092] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A dihydroagarinuran-type sesquiterpene compound, characterized in that, It has the following structure: 。 2. An extract, characterized in that, Contains the dihydroagarinuran-type sesquiterpene compound as described in claim 1; The method for preparing the extract includes: Using dried fruits of *Malus kunmingensis* as raw material, the extract was refluxed with 95% methanol 2-3 times, and the extracts were combined. The extract was concentrated under reduced pressure to obtain a total extract; The total extract was suspended in water, extracted with petroleum ether, and the petroleum ether extract was collected and concentrated to obtain the extract.

3. A pharmaceutical composition, characterized in that, It includes the dihydroargentinium furan-type sesquiterpenoid compound as described in claim 1 and its pharmaceutically acceptable carrier or excipient.

4. A pharmaceutical composition, characterized in that, It includes the extract as described in claim 2 and its pharmaceutically acceptable carrier or excipient.

5. The use of the dihydroargentinium furan-type sesquiterpene compound of claim 1, the extract of claim 2, the pharmaceutical composition of claim 3, or the pharmaceutical composition of claim 4 in the preparation of anti-inflammatory drugs.

6. The application according to claim 5, characterized in that, The anti-inflammatory drug is used to treat skin inflammation.

Images