Genes, Proteins, Recombinant Expression Vectors, Recombinant Bacteria and Applications of Fish Interferons

Abstract

The present invention relates to the gene, protein, recombinant expression vector, recombinant bacterium and application of fish interferon, belonging to the technical field of fish molecular immunology. The cDNA nucleotide sequence of the gene of fish interferon is as shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO.2. The present invention constructs an engineering strain to obtain a recombinant protein of fish interferon in vitro, and finds that it can significantly improve the phagocytic ability of macrophages of humpback groupers. Moreover, after overexpressing or interfering with the expression of the gene of humpback grouper interferon, it is found that it can significantly enhance the immune function of humpback groupers against Vibrio harveyi infection, and can be developed into an immunopreparation, having good practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of fish molecular immunology, and particularly relates to a gene, a protein, a recombinant expression vector, a recombinant bacterium and an application of fish interferon. Background Art

[0002] Cromileptes altivelis ( Cromileptes altivelis ), as one of the precious marine economic fish species in the southern coastal areas of China, has delicious meat and high edible and ornamental values, and is deeply loved by consumers. However, in recent years, various diseases caused by bacteria, viruses, parasites, etc. have continuously broken out in the cultured population of Trachinotus ovatus, causing huge economic losses. Vibrio harveyi ( Vibrio harveyi ), is one of the main pathogenic bacteria. The innate immune system is the first line of defense for fish to resist pathogen infection. Therefore, the research on the fish immune system is of great significance. At present, there are few studies on the action mechanism of the Cromileptes altivelis immune system, and little is known about the immune-related genes of Cromileptes altivelis. The interferon system is an important part of the innate immune system. In order to further understand the functional characteristics of fish IFNγrel, it is necessary to improve the research at the protein level on the basis of gene-level research. Therefore, it is necessary to study the methods of preventing and treating fish diseases with Cromileptes altivelis IFNγrel and develop useful immune preparations, which has important reference value for the prevention and treatment of fish diseases.

[0003] Interferon (IFN) is a glycoprotein with broad-spectrum antiviral, antitumor and immunomodulatory functions. At present, fish IFN is divided into four types, namely type I, type II, type III and type IV, according to characteristics such as gene structure, locus, interacting receptors and biological functions. Among them, type II IFN, namely IFNγ, is a class of dimeric soluble cytokines, mainly secreted by T lymphocytes and NK cells, and has antiviral and immunomodulatory effects. IFNγ is also a multifunctional cytokine that can promote macrophage activation, increase antigen presentation, activate the innate immune system, and regulate cell proliferation and apoptosis.

[0004] In mammals, there is only one type of type II interferon, namely IFNγ. Different from mammals, there are two IFNγ genes (IFNγ1 and IFNγ2) in fish type II interferon. IFNγ2 is homologous to mammalian IFNγ, while IFNγ1 has very low homology with higher vertebrates, so it is also named interferon-related factor (IFNγrelated molecule, IFNγrel). IFNγrel has been successively found in zebrafish ( Danio rerio ), green puffer fish ( Tetraodon nigirovirdis ), Atlantic salmon ( Salmo salar ), rainbow trout ( Oncorhynchus mykiss ), channel catfish ( Ictaluruspunctatus ), carp ( Cyprinus carpio ), goldfish ( Carassius auratus ), Japanese crucian carp ( Carassius auratus langsdorfii ), grass carp ( Ctenopharyngodon idella ) and Japanese eel ( Anguilla japonica ), two IFNγ genes have been identified in these fish species. The structures of IFNγ gene and IFNγrel gene are different. The C-terminus of IFNγrel gene lacks the nuclear localization signal domain, which makes it lose the ability to induce chemokines. Under the stimulation of immunogen, the expression levels of zebrafish IFNγ and IFNγrel genes in various tissues are different, indicating that their functions may be different. The receptor members of mammalian type II interferon are IFNγR1 and IFNγR2. The function of IFNγR1 is to bind to the ligand, and the function of IFNγR2 is to conduct signal transduction. In teleost fish, IFNγR1 is divided into two genes, IFNγR1-1 and IFNγR1-2, which are also named CRFB17 and CRFB13. IFNγR2 is homologous to CRFB6 of teleost fish and has a similar function. Studies have shown that IFNγrel of zebrafish and grass carp does not bind to CRFB6, indicating that IFNγrel may have specificity in signal transduction. In addition, it has been found that IFNγrel of mandarin fish ( Siniperca chuatsi ) and arapaima ( Arapaima gigas ) can activate the expression of downstream genes through the mediation of CRFB17, indicating that IFNγrel of teleost fish can exert immune regulatory functions through the receptor CRFB17. Fish interferon induces the expression of ISGs through a JAK-STAT signaling pathway similar to that of mammals to establish a host antiviral defense system. Therefore, IFNγrel of fish can also participate in the antiviral immunity of the body. IFNγrel of fish also participates in the antibacterial immune response of the body. However, compared with the antiviral immune response, the research on the participation of fish IFNγrel in the antibacterial immune response of the body is relatively scarce. SUMMARY OF THE INVENTION

[0005] Aiming at the deficiencies of the prior art, the technical problem to be solved by the present invention is to provide a gene, protein, engineering bacteria and application of fish interferon. The present invention constructs a recombinant plasmid of humpback grouper IFNγrel and transfers it into an expression strain, and uses IPTG to induce the expression of the recombinant protein of humpback grouper IFNγrel, optimizes the expression conditions, purifies the target protein, and further verifies that the prepared recombinant protein of humpback grouper IFNγrel can improve the phagocytic ability of macrophages and enhance the antibacterial function of the body, so it has good practical application value.

[0006] To solve the above technical problems, the present invention provides a gene for fish interferon, and the cDNA nucleotide sequence of the gene for fish interferon is as shown in SEQ ID NO.1:

[0007] atgtcttcatgctgcgcatcattgtatctactggtcttactgggagttgcattggcttctgggattccatgccagtttgctgggaacctgaaagacacccctgactccattgtagatgtgctgaacttgaagcaggcagaaattggcagtaatcctctcttcaattcggtcatcaagagcatcaacacctcctgccagagaaaagtacatctgatgaacgtcactctggatgtctacactcgaatcttcaccagcatcttgcagcacaaccagcaccaagacaagaccaggacacctctgctggaccagctgtctgaccaggaaagctctcaggtggtgtcggttgtgacggagctccaaaagaatatggagaagctgaagagacgcctgagccatgtgagccacgagagagaggacctgctcagcaagctgaacagaatagatgtcgatgaccccgtggttcagaggaaagctctggctcagttcaaggaggtctaccaggcggcctctgtgattggctaccccagctgtggccacacccactcctcgtccgctgagcgacgttga。

[0008] The amino acid sequence of the fish interferon is as shown in SEQ ID NO.2:

[0009] MSSCCASLYLLVLLGVALASGIPCQFAGNLKDTPDSIVDVLNLKQAEIGSNPLFNSVIKSINTSCQRKVHLMNVTLDVYTRIFTSILQHNQHQDKTRTPLLDQLSDQESSQVVSVVTELQKNMEKLKRRLSHVSHEREDLLSKLNRIDVDDPVVQRKALAQFKEVYQAASVIGYPSCGHTHSSSAERR。

[0010] The cDNA nucleotide sequence of the mature protein gene of the fish interferon is as shown in SEQ ID NO.3:

[0011] attccatgccagtttgctgggaacctgaaagacacccctgactccattgtagatgtgctgaacttgaagcaggcagaaattggcagtaatcctctcttcaattcggtcatcaagagcatcaacacctcctgccagagaaaagtacatctgatgaacgtcactctggatgtctacactcgaatcttcaccagcatcttgcagcacaaccagcaccaagacaagaccaggacacctctgctggaccagctgtctgaccaggaaagctctcaggtggtgtcggttgtgacggagctccaaaagaatatggagaagctgaagagacgcctgagccatgtgagccacgagagagaggacctgctcagcaagctgaacagaatagatgtcgatgaccccgtggttcagaggaaagctctggctcagttcaaggaggtctaccaggcggcctctgtgattggctaccccagctgtggccacacccactcctcgtccgctgagcgacgttga。

[0012] The amino acid sequence of the mature protein of the fish interferon is as shown in SEQ ID NO.4:

[0013] IPCQFAGNLKDTPDSIVDVLNLKQAEIGSNPLFNSVIKSINTSCQRKVHLMNVTLDVYTRIFTSILQHNQHQDKTRTPLLDQLSDQESSQVVSVVTELQKNMEKLKRRLSHVSHEREDLLSKLNRIDVDDPVVQRKALAQFKEVYQAASVIGYPSCGHTHSSSAERR。

[0014] A recombinant expression vector, which contains the gene of fish interferon or the gene of the mature protein of fish interferon.

[0015] A recombinant bacterium, which contains the gene of fish interferon or the gene of the mature protein of fish interferon.

[0016] A biological preparation, which contains the mature protein of the fish interferon as described above, and the biological preparation can improve the phagocytic ability of the macrophages of the humpback grouper.

[0017] An interference preparation, which is prepared using the gene of fish interferon as a template, can overexpress the interferon gene of humpback grouper to improve the antibacterial ability of humpback grouper.

[0018] The present invention also provides the application of the gene of the fish interferon, the recombinant expression vector, and the recombinant bacterium in the preparation of a biological preparation for improving the phagocytic ability of humpback grouper macrophages.

[0019] The present invention also provides the application of the fish interferon gene in the preparation of a biological preparation for improving the antibacterial ability of humpback grouper.

[0020] The present invention provides a recombinant expression method for the gene of fish interferon and its encoded protein. Specifically, RNA is extracted from the head kidney tissue of humpback grouper, the RNA is reverse transcribed into cDNA, and then using the cDNA as a template and the following sequences as primers, the nucleotide sequence of the IFNγrel gene is obtained by PCR. The sequences of the primers are:

[0021] Ca IFNγrel-F1: 5’- ggatccgccaccATTCCATGCCAGTTTGCTG -3’ (SEQ ID NO.5);

[0022] Ca IFNγrel-R1: 5’-gaattcACGTCGCTCAGCGGAC-3’, (SEQ ID NO.6).

[0023] The nucleotide sequence of the IFNγrel gene without the signal peptide obtained by PCR is ligated to the pMD19-T vector, transformed into Escherichia coli DH5α, and the recombinant is identified by sequencing. After correct sequencing, it is named Ca IFNγrel-Tsimple.

[0024] Extract the above plasmid, and after digestion with Bam HⅠ and Eco RⅠ restriction endonucleases, recover the 64 - 564 bp fragment; extract the pET-28a plasmid, after digestion with Bam HⅠ and Eco RⅠ, use T4 ligase to ligate the above 64 - 564 bp recovered fragment to pET-28a to construct a recombinant plasmid; the recombinant plasmid is verified by gene sequencing to contain the IFNγrel gene, and it is named pET28a- Ca IFNγrel; transfer the above recombinant pET28a- Ca IFNγrel plasmid into Escherichia coli BL21 expression strain by conventional methods, and then perform induction culture and purification to obtain the recombinant protein with the amino acid sequence in SEQ ID NO.4 of the sequence listing.

[0025] Meanwhile, using the following sequences as primers, the 1 - 564 bp fragment of the IFNγrel gene was amplified by the above method. The 1 - 564 bp fragment recovered by enzyme digestion was ligated to the pCN3 vector in the same method to construct a p Ca IFNγrel recombinant plasmid, and a recombinant protein with the amino acid sequence in SEQ ID NO.2 in the Sequence Listing can be expressed in fish.

[0026] Ca IFNγrel - F2: 5’ - gatatcgccaccATGTCTTCATGCTGCGCA - 3’ (SEQ ID NO.7);

[0027] Ca IFNγrel - R2: 5’ - gatatcACGTCGCTCAGCGGAC - 3’ (SEQ ID NO.8).

[0028] Advantages of the present invention compared with the prior art: The IFNγrel protein of humpback grouper in the present invention can significantly improve the phagocytic ability of macrophages. The IFNγrel of humpback grouper in the present invention can improve the anti - bacterial infection ability of fish, can be used as an immune enhancer, and has application value in the preparation of antiviral drugs, antibacterial drugs, anti - inflammatory agents, prevention and treatment of fish diseases, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the result of the predicted analysis of the full - length protein structure of humpback grouper IFNγrel;

[0030] Figure 2 It is the electrophoresis pattern of the Ni - column affinity - purified humpback grouper IFNγrel recombinant protein in the example of the present invention; where M is the standard molecular weight protein; 1 represents rIFNγrel; the molecular weight of rIFNγrel is 25.0 kDa;

[0031] [[ID= It is the result diagram of the improvement of the phagocytic ability of macrophages by IFNγrel in the example of the present invention;

[0032] ​ It is the diagram of the change in the number of bacteria in the liver, spleen and head kidney of experimental fish at each time point after over - expressing IFNγrel in the example of the present invention;

[0033] ​ It is the diagram of the change in the number of bacteria in the liver, spleen and head kidney of experimental fish at each time point after interfering with the expression of IFNγrel in the example of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0034] The technical solution of the present invention will be further explained by way of examples below, but the technical solution of the present invention is not limited by the examples in any form.

[0035] Cromileptes altivelis IFNγrel, the nucleotide sequence of the cDNA of the Cromileptes altivelis IFNγrel gene is as shown in SEQ ID NO.1, the amino acid sequence of the Cromileptes altivelis IFNγrel gene is as shown in SEQ ID NO.2, the nucleotide sequence of the mature protein of the Cromileptes altivelis IFNγrel is as shown in SEQ ID NO.3, and the amino acid sequence of the mature protein of the Cromileptes altivelis IFNγrel is as shown in SEQ ID NO.4.

[0036] The preparation method of the above-mentioned recombinant protein of the Cromileptes altivelis IFNγrel gene is carried out successively according to the following steps:

[0037] 1. Construction of recombinant vector.

[0038] Extract the RNA of the head kidney tissue of Cromileptes altivelis, reverse transcribe the RNA into cDNA, and then use the cDNA as a template and primers ​ IFNγrel-F1 / R1 to obtain the nucleotide sequence (SEQ ID NO.3) encoding the mature protein of IFNγrel by PCR, and use primers ​ IFNγrel-F2 / R2 to obtain the nucleotide sequence (SEQ ID NO.1) of the cDNA of the IFNγrel gene by PCR. The sequences of the primers are:

[0039] ​ IFNγrel-F1: 5’-ggatccgccaccATTCCATGCCAGTTTGCTG-3’ (SEQ ID NO.5);

[0040] ​ IFNγrel-R1: 5’-gaattcACGTCGCTCAGCGGAC-3’ (SEQ ID NO.6).

[0041] ​ IFNγrel-F2: 5’-gatatcgccaccATGTCTTCATGCTGCGCA-3’ (SEQ ID NO.7);

[0042] ​ IFNγrel-R2: 5’- gatatcACGTCGCTCAGCGGAC-3’ (SEQ ID NO.8).

[0043] The specific operation steps are to clone ​The gene of IFNγrel (amino acids 31 - 158) was ligated to the pMD19-T vector, transformed into Escherichia coli DH5α, and the recombinants were identified by sequencing. After correct sequencing, it was named ​ IFNγrel-Tsimple.

[0044] The above recombinant plasmid was extracted and digested with ​ HⅠ and ​ RⅠ restriction endonucleases, and the 64 - 564 bp fragment was recovered; the pET-28a plasmid was extracted, digested with ​ HⅠ and ​ RⅠ, and then the above 501 bp recovered fragment was ligated to it using T4 ligase to construct a recombinant plasmid; the recombinant plasmid was verified by gene sequencing to contain IFNγrel and was named pET28a- ​ IFNγrel. In the same way, the 1 - 564 bp fragment (amino acids 1 - 188; as ​ ) was ligated to pCN3 to obtain the p ​ IFNγrel recombinant plasmid.

[0045] 2. Induction expression and purification of recombinant protein rIFNγrel

[0046] To express the recombinant protein rIFNγrel of humpback grouper, we introduced pET28a- ​ IFNγrel into Escherichia coli BL21 and stored the strain at -80 °C. Subsequently, the strain was inoculated into LB liquid medium and cultured at 37 °C until OD 600 ≈0.6. Then, 0.1 mM IPTG was used to induce for 30 h at 16 °C, and the bacteria were collected. Then, the bacteria were resuspended with 10 mM imidazole buffer, lysed by ultrasonic disruption, and the target protein was obtained by Ni column affinity purification. After purification, the recombinant protein after dialysis is shown in ​ , which is consistent with the expected protein size. That is, the recombinant protein rIFNγrel of humpback grouper was obtained. The amino acid sequence is shown in SEQ ID NO.4, length: 167 amino acids, type: amino acid, chain type: single chain, characteristics: molecular weight is 25.0 kDa, and isoelectric point is 8.48.

[0047] Example 1: Recombinant protein r ​ IFNγrel can significantly improve the phagocytic activity of humpback grouper macrophages:

[0048] Macrophages of humpback grouper were extracted from the head kidney tissue, and a 500 μL suspension of humpback grouper macrophages was inoculated into a 12-well plate (5×10 6cells / well), and incubated at 26°C for 2 h to allow macrophages to adhere to the wall. Discard the medium, wash the cells 3 times with sterile PBS, and add recombinant protein r ​ IFNγrel and BSA (as a control group) to each well at a final concentration of 20 μg / mL. Then add 30 μL of green fluorescent microspheres to each well and incubate in the dark at 26°C for 2 h. After incubation, discard the supernatant, wash the cells 3 times with PBS, digest the adherent cells with trypsin, and resuspend the cells with medium. Centrifuge the cell suspension at 4°C for 10 min, collect the cells, and resuspend the cells with 300 μL of medium. Finally, count the cells using a flow cytometer. Use FlowJo V10 for data analysis.

[0049] The results showed that: compared with the control group, r ​ The ability of macrophages treated with IFNγrel to phagocytose fluorescent microspheres was significantly increased (37.3% and 60.7% respectively; as ​ ). These results indicate that IFN-γrel of humpback grouper can improve the phagocytic ability of macrophages.

[0050] Experimental Example 2: IFNγrel of humpback grouper of the present invention can significantly improve the anti-bacterial infection ability of humpback grouper

[0051] To study ​ the anti-bacterial immunity induced by overexpression of IFNγrel in vivo, we used an endotoxin-free plasmid extraction kit (Tiangen, China) to extract p ​ IFNγrel endotoxin-free plasmid and diluted it to 200 μg / mL with PBS. In addition, 60 humpback groupers were divided into 3 groups (20 fish / group), and 100 μL of p ​ IFNγrel, pCN3 or PBS (as a control group) were injected intramuscularly respectively. Five days after immunization, 5 fish were randomly selected from each group and dissected aseptically to collect head kidney tissues. Then extract the RNA of the head kidney tissues, reverse transcribe it into cDNA, and use this as a template for PCR detection to confirm the expression of the plasmid. Subsequently, the remaining fish were intraperitoneally injected with 100 μL of Vibrio harveyi (2×10 6 CFU / mL). At 6, 9, and 12 hours after injection, 5 fish from each group were aseptically collected for spleen and head kidney. Finally, the extracted tissues were ground, diluted and spread on LB solid medium with ampicillin. The bacterial loads of each group were counted by plate counting method.

[0052] To further determine ​ IFNγrel is involved in the antibacterial effect of humpback grouper, we used siRNA (small interfering RNA) technology to interfere with the fish body ​Specifically, we used T7 RiboMAX™ Express RNAi System (Promega, USA) to design and synthesize primers for siCaIFN-γrel, namely si ​ IFNγrel-P1 / si ​ IFNγrel-P2 and si ​ IFNγrel-P3 / si ​ IFNγrel-P4, then prepared si ​ IFNγrel. We randomly divided 60 fish into three groups (20 fish / group) and injected 15 μg si ​ IFNγrel, 15 μgsi ​ IFNγrel-C (control siRNA) and 100 μL PBS (control group). 12 hours after siRNA injection, 5 fish were extracted from each group and confirmed as described above. ​ IFNγrel was knocked down. Then, 45 fish were intraperitoneally injected with 100 μL of Vibrio harveyi (2×10 6 CFU / mL). Bacterial loads in the spleen and head kidney of fish from each group were analyzed 6, 12, and 24 hours after injection using the plate count method as described above.

[0053] The results showed that compared with the control group, overexpression of p ​ IFNγrel can effectively reduce the bacterial load in fish (such as ​ ). Spleen: 6, 9 and 12 hours after challenge, injection of p ​ The bacterial load of IFNγrel fish was approximately 4.8-fold, 9.6-fold, and 3.4-fold lower than that of the control group (e.g. ​ ). Head kidney: 6, 9 and 12 hours after the challenge, inject p ​ The bacterial counts in IFNγrel-treated fish were approximately 1.4-fold, 12.4-fold, and 1.8-fold lower than those in the control group (e.g. ​ Consistent with this, compared with the control group, the interference expression of si ​ After IFNγrel, the bacterial load in fish bodies increased significantly in the two examined tissues at each time point (e.g. ​ ). In contrast, si ​ The bacterial loads of IFNγrel-C treated fish were almost the same as those of the control group (e.g. ​ These results indicate that humpback sea bass ​ IFNγrel can enhance the body's antibacterial function.

Claims

1. A gene of fish interferon, characterized in that, The cDNA nucleotide sequence of the gene of the fish interferon is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

2.

2. A recombinant expression vector, characterized in that, The recombinant expression vector contains the gene of the fish interferon described in claim 1.

3. A recombinant bacterium, characterized in that, The recombinant bacterium contains the gene of the fish interferon described in claim 1.

4. A biological preparation, characterized in that, The biological preparation contains the protein encoded by the gene of the fish interferon described in claim 1, and the biological preparation can improve the ability of humpback grouper to resist Vibrio harveyi.

5. Use of the protein encoded by the gene of the fish interferon described in claim 1 in the preparation of a biological preparation for improving the ability of humpback grouper to resist Vibrio harveyi.

Images