A reducing agent suitable for polymerase chain reaction and its application

Abstract

The present disclosure provides a reducing agent suitable for polymerase chain reaction and its application. The additive uses ammonium sulfite to replace ammonium sulfate, potassium chloride, etc. commonly used in the PCR system; and the reducing agent is added to form a composite enhancer in combination with ectoine, thereby improving the fidelity and specificity of DNA polymerase. It provides a reliable and efficient tool for multiple molecular biology studies such as gene cloning, sequencing, and PCR amplification.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a reducing agent suitable for polymerase chain reaction and application thereof. Background Art

[0002] Polymerase chain reaction (PCR) is a molecular biological technology used to amplify specific DNA fragments. It can greatly increase trace amounts of DNA for use in DNA sequencing and is a necessary step in many next-generation sequencing (NGS) library preparation methods.

[0003] The DNA amplification enzyme used in the NGS process must have excellent amplification capabilities, the ability to adapt to different template types, and good compatibility and scalability. In addition, since NGS is a highly sensitive sequencing technology, the use of high-fidelity DNA polymerases can ensure error-free replication of the template during the amplification process, thereby ensuring the accuracy of the sequencing results.

[0004] Through genetic engineering, the fidelity of DNA polymerase can be improved, so that the enzyme has extremely high fidelity and low mismatch rate, and can perform stable DNA amplification. For example, KAPA formed a KOFU chimera by chimerizing the polymerization region from KOD polymerase and the N-terminal domain, exonuclease domain and thumb domain of PFU polymerase. The elongation speed, processability, thermal stability, TMAC tolerance and PCR performance of this chimeric polymerase are similar to KOD; and KOFU has the approximate replication fidelity of PFU. In addition, the PCR mutation rate can be further reduced by optimizing the PCR reaction conditions, which includes adjusting the buffer composition, the concentration of the heat-resistant polymerase, and optimizing the PCR cycle conditions.

[0005] Adding unique reaction enhancers, hot start factors, and extension factors to the enzyme solution can greatly improve the success rate, specificity, and fidelity of amplification. Common additives include DMSO, bovine serum albumin (BSA), glycerol, polyethylene glycol, Tween-20, betaine, etc. However, these additives have their own limitations. For example, DMSO inhibits the formation of secondary structures. Therefore, when the content of guanine G and cytosine C is high and the content of adenine A and thymine T is low, adding an appropriate amount of DMSO can improve the efficiency of PCR amplification. When the content of G and C is low, PCR amplification is inhibited instead. Tween-20 can make the polymerase more stable, but it also increases nonspecific amplification.

[0006] Therefore, there is an urgent need to develop PCR amplification additives that can improve the fidelity to increase the accuracy of NGS sequencing. Summary of the invention

[0007] In order to solve at least one of the above problems, the present disclosure provides a reducing agent suitable for polymerase chain reaction to increase the fidelity of high-fidelity polymerase amplification.

[0008] According to one aspect of the present disclosure, a reducing agent suitable for polymerase chain reaction is provided, wherein the reducing agent comprises one or more of sulfite, ectoine or thiol compounds.

[0009] In some embodiments, the sulfite includes at least one of ammonium sulfite (NH4)2SO3, sodium sulfite Na2SO3, sodium bisulfite NaHSO3, sodium pyrosulfite Na2S2O5, sodium dithionite Na2S2O6·2H2O, potassium sulfite K2SO3 or potassium bisulfite KHSO3.

[0010] In some embodiments, the thiol compound includes at least one of cysteine, N-acetylcysteine, or glutathione.

[0011] In some embodiments, the glutathione is reduced glutathione.

[0012] In some embodiments, the reducing agent comprises 5-20 mM sulfite.

[0013] In some embodiments, the reducing agent comprises 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, or 20 mM sulfite.

[0014] In some embodiments, the reducing agent comprises 10-20 mM sulfite.

[0015] In some embodiments, the reducing agent comprises 0.1-0.5 M ectoine.

[0016] In some embodiments, the reducing agent comprises 0.1 M, 0.2 M, 0.3 M, 0.4 M or 0.5 M ectoine.

[0017] In some embodiments, the reducing agent comprises 0.165-0.33 M ectoine.

[0018] In some embodiments, the reducing agent comprises 0.1-5.5 mM of a thiol compound.

[0019] In some embodiments, the reducing agent comprises 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1.0 mM, 1.1 mM, 1.2 mM, 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM, 1.7 mM, 1.8 mM, 1.9 mM, 2 mM, 2.1 mM, 2.2 mM, 2.3 mM, 2.4 mM, 2.5 mM, 2.6 mM, 2.7 mM, 2.8 mM, 2.9 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 21 mM, 22 mM, 23 mM, 24 mM, 25 mM, 26 mM, 27 mM, 28 mM 7mM, 2.8mM, 2.9mM, 3mM, 3.1mM, 3.2mM, 3.3mM, 3.4mM, 3.5mM, 3.6mM, 3.7mM, 3.8mM, 3.9mM, 4mM, 4.1mM, 4.2mM, 4.3mM, 4.4mM, 4.5mM, 4.6mM, 4.7mM, 4.8mM, 4.9mM, 5mM, 5.1mM, 5.2mM, 5.3mM, 5.4mM or 5.5mM of thiol compound.

[0020] In some embodiments, the reducing agent comprises 3.5-5.5 mM of a thiol compound.

[0021] In some embodiments, the reducing agent comprises 3.5-4.5 mM of a thiol compound.

[0022] In some embodiments, the reducing agent includes sulfite, tetrahydropyrimidine and thiol compounds.

[0023] In some embodiments, the reducing agent comprises sulfite, ectoine, and glutathione.

[0024] In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.25-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (2.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (3.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (3.5-4.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.25-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (2.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (3.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (3.5-4.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.1-5.5).In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.25-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (2.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (3.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (3.5-4.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.25-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (1-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (2.5-5.5). In some embodiments, the reducing agent comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (3.5-5.5). In some embodiments, the reducing agent comprises sulfite, tetrahydropyrimidine and thiol compounds in a molar ratio of (5-20): (165-330): (3.5-4.5). In some embodiments, the reducing agent comprises sulfite, tetrahydropyrimidine and thiol compounds in a molar ratio of 17.5:165:3.5. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 0.1-5.5 mM thiol compounds.In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 0.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 0.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 3.5-4.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 0.1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 0.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 0.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-4.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 0.1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine and 0.25-5.5 mM thiol compound. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine and 0.5-5.5 mM thiol compound.In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-4.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.210-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the reducing agent comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-4.5 mM thiol compounds.

[0025] In some embodiments, the reducing agent comprises 17.5 mM sulfite, 0.165 M ectoine, and 3.5 mM thiol compound.

[0026] The concentration of each component in the reducing agent refers to the final concentration in the amplification system. Those skilled in the art should understand that the reducing agent can also exist in a concentrated form, such as a 1 to 10× times concentrated reducing agent, and the concentration of each component needs to be adjusted accordingly according to the concentration multiple of the reducing agent, which is within the scope of protection of the present disclosure.

[0027] In some embodiments, the reducing agent is a 1×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, or 10× times concentrated reducing agent.

[0028] According to yet another aspect of the present disclosure, a composition suitable for polymerase chain reaction is provided, the composition comprising the reducing agent.

[0029] In some embodiments, the composition comprises 5-20 mM sulfite.

[0030] In some embodiments, the composition includes 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, or 20 mM sulfite.

[0031] In some embodiments, the concentration of the sulfite is 10-20 mM.

[0032] In some embodiments, the composition comprises 17.5 mM sulfite.

[0033] In some embodiments, the composition comprises 0.1-0.5 M ectoine.

[0034] In some embodiments, the composition comprises 0.1M, 0.2M, 0.3M, 0.4M or 0.5M.

[0035] In some embodiments, the composition comprises 0.165-0.33 M ectoine.

[0036] In some embodiments, the composition comprises 0.1-5.5 mM of the thiol compound.

[0037] In some embodiments, the composition comprises 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM, 1.2mM, 1.3mM, 1.4mM, 1.5mM, 1.6mM, 1.7mM, 1.8mM, 1.9mM, 2mM, 2.1mM, 2.2mM, 2.3mM, 2.4mM, 2.5mM, 2.6mM, 2.7mM, 2.8mM, 2. 9mM, 3mM, 3.1mM, 3.2mM, 3.3mM, 3.4mM, 3.5mM, 3.6mM, 3.7mM, 3.8mM, 3.9mM, 4mM, 4.1mM, 4.2mM, 4.3mM, 4.4mM, 4.5mM, 4.6mM, 4.7mM, 4.8mM, 4.9mM, 5mM, 5.1mM, 5.2mM, 5.3mM, 5.4mM or 5.5mM of thiol compound.

[0038] In some embodiments, the composition comprises 3.5-5.5 mM of the thiol compound.

[0039] In some embodiments, the composition comprises 3.5-4.5 mM of the thiol compound.

[0040] In some embodiments, the composition comprises 3.5 mM of the thiol compound.

[0041] In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.25-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (0.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (2.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (3.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (100-500): (3.5-4.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.25-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (0.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (2.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (3.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (100-500): (3.5-4.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.1-5.5).In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.25-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (0.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (2.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (3.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (10-20): (165-330): (3.5-4.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.25-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (0.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (1-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (2.5-5.5). In some embodiments, the composition comprises a sulfite, tetrahydropyrimidine and a thiol compound in a molar ratio of (5-20): (165-330): (3.5-5.5). In some embodiments, the composition comprises sulfite, tetrahydropyrimidine and thiol compounds in a molar ratio of (5-20): (165-330): (3.5-4.5). In some embodiments, the composition comprises sulfite, tetrahydropyrimidine and thiol compounds in a molar ratio of 17.5:165:3.5. In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M tetrahydropyrimidine and 0.25-5.5 mM thiol compounds.In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 0.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-4.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 0.1-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 0.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 0.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.1-0.5 M ectoine, and 3.5-4.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 0.1-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 0.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 0.5-5.5 mM thiol compound. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 1-5.5 mM thiol compound.In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 10-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-4.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.210-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.1-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 0.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 1-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 2.25-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-5.5 mM thiol compounds. In some embodiments, the composition comprises 5-20 mM sulfite, 0.165-0.33 M ectoine, and 3.5-4.5 mM thiol compounds.

[0042] In some embodiments, the composition comprises 17.5 mM sulfite, 0.165 M ectoine, and 3.5 mM thiol compound.

[0043] In some embodiments, the composition further comprises tetramethylammonium chloride (TMAC), and / or glycerol, and / or serum albumin, and / or N-methyl-2-pyrrolidone, and / or a surfactant.

[0044] In some embodiments, the surfactant includes one or more of SDS, Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, Triton X-200, Triton X-400, NP-20, or NP-40.

[0045] In some embodiments, the nucleic acid amplification system further includes 1% to 10% v / v glycerol, and / or 0.01% to 0.5% v / v Triton X-100, and / or 5 to 25 mM tetramethylammonium chloride, and / or 10 to 50 ug / mL serum albumin.

[0046] In some embodiments, the nucleic acid amplification system further comprises 2% to 8% v / v glycerol, 0.01% to 0.1% v / v Triton X-100, 10 to 30 mM tetramethylammonium chloride, and / or 15 to 20 ug / mL serum albumin.

[0047] In some embodiments, the composition further comprises a buffer, a nucleic acid polymerase, dNTPs, a nucleic acid to be amplified, and / or a primer pair.

[0048] In some embodiments, the buffer comprises one or more of Tris buffer, Tris-HCl buffer, and phosphate buffer.

[0049] In some embodiments, the nucleic acid polymerase includes a DNA polymerase and an RNA polymerase.

[0050] In some embodiments, the nucleic acid polymerase comprises a high-fidelity polymerase, a low-temperature polymerase, or a thermophilic polymerase.

[0051] In some embodiments, the DNA polymerase comprises KOFU, KOD-Plus-Neo, T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I or DNA polymerase I large fragment Klenow, Taq DNA polymerase, 2G Robust DNA polymerase, rTaq DNA polymerase, TaqB DNA polymerase, kapa HIFI hot start high fidelity polymerase, pfu DNA polymerase, phusion DNA polymerase, Phi29 DNA polymerase, Bst DNA polymerase, Pyrophage 3137, Vent polymerase, TOPO Taq DNA polymerase, Klenow Fragment DNA polymerase I, MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, T7 phase DNA polymerase variant, super fidelity DNA polymerase, Taq polymerase, E. coli DNA polymerase, LongAmp Taq DNA polymerase, OneTaq DNA polymerase, Deep Vent DNA polymerase, Vent (exo-) DNA polymerase, Deep One or more of Vent (exo-) DNA polymerase, Psp GBD (exo-) DNA polymerase.

[0052] In some preferred embodiments, the DNA polymerase is KOFU, which has an amino acid sequence as set forth in SEQ ID NO: 1, or an amino acid sequence having 85% sequence identity thereto.

[0053] In some embodiments, the composition further comprises 10-50 mM buffer, 0.1-1 U nucleic acid polymerase, and / or 100-200 μM dNTP.

[0054] In some embodiments, the composition further comprises an inorganic salt.

[0055] In some embodiments, the composition further comprises 0.1-10 mM inorganic salt.

[0056] In some embodiments, the inorganic salt includes the following ions Mg 2+ , K+, Na+, and / or the following ions SO4 2- , Cl - A combination of one or more of .

[0057] In some embodiments, the pH of the composition is 7-9.

[0058] The concentration of each component in the composition is the final concentration in the amplification system. Those skilled in the art will appreciate that the reducing agent may also be present in a concentrated form, such as a 1 to 10× times concentrated composition, and the concentration of each component needs to be adjusted accordingly according to the concentration multiple of the composition, all of which are within the scope of the present disclosure.

[0059] In some embodiments, the composition is a 1×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, or 10×-fold concentrated composition.

[0060] According to yet another aspect of the present disclosure, an amplification system is provided, comprising the reducing agent or the composition.

[0061] According to yet another aspect of the present disclosure, a kit is provided, which contains the reducing agent or the composition.

[0062] According to another aspect of the present disclosure, a method for improving the fidelity of an amplification enzyme is provided, the method comprising adding the reducing agent to a nucleic acid amplification system.

[0063] According to another aspect of the present disclosure, a method for improving the fidelity of an amplification enzyme is provided, the method comprising performing amplification using the amplification system or the kit.

[0064] According to another aspect of the present disclosure, a method for improving the fidelity of an amplification enzyme is provided, the method comprising using the reducing agent or the composition to prepare an amplification system for amplification.

[0065] According to another aspect of the present disclosure, provided is a use of the reducing agent or the composition in preparing a kit.

[0066] According to yet another aspect of the present disclosure, provided is a use of the reducing agent, the composition or the kit for improving the fidelity of a polymerase.

[0067] According to another aspect of the present disclosure, provided is a use of the reducing agent, the amplification system, the composition or the kit for improving the fidelity of an amplification reaction.

[0068] In some embodiments, improving the fidelity of the polymerase comprises reducing the mutation frequency of C>A, C>T, G>A, G>T in the polymerase chain reaction.

[0069] In some embodiments, improving the fidelity of the polymerase comprises reducing the mutation frequency of low C>T and G>A in the polymerase chain reaction.

[0070] In some embodiments, the amplification comprises the polymerase chain reaction (PCR), an isothermal amplification reaction.

[0071] In some embodiments, the polymerase chain reaction is any one of RT-PCR, immune PCR, nested PCR, fluorescent PCR, in situ PCR, anchored PCR, gradient PCR, multiplex PCR, micro-PCR, asymmetric PCR, long-distance PCR, and touchdown PCR.

[0072] In some embodiments, the isothermal amplification reaction includes LAMP loop-mediated isothermal amplification, RAA recombinase-mediated isothermal nucleic acid amplification, RPA recombinase polymerase amplification, RCA rolling circle amplification, CPA cross primer amplification, SDA chain displacement amplification technology, HDA helicase-dependent amplification, MIRA multi-enzyme constant temperature rapid amplification, etc.

[0073] Beneficial effects:

[0074] The reducing agent used in this application uses sulfite to replace the commonly used ammonium sulfate, potassium chloride, etc. in the PCR system; further, the commonly used tissue-compatible substances such as betaine and trehalose are replaced with ectoine, and the reducing agent is added to form a composite enhancer in combination with ectoine, thereby improving the fidelity of DNA polymerase, and the addition of these substances will not reduce the PCR yield. Provide reliable and efficient tools for multiple molecular biology studies such as gene cloning, sequencing, and PCR amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 A line graph showing the yield statistics of the PCR amplification results in Example 3 is shown.

[0076] Figure 2 A statistical line graph of base mutation frequencies in the sequencing results of Example 3 is shown.

[0077] Figure 3 A statistical bar graph of the number of base mutations of different mutation types in the sequencing results of Example 3 is shown.

[0078] Figure 4 A line graph showing the yield statistics of the PCR amplification results of Example 4 is shown.

[0079] Figure 5 A statistical bar graph of the number of base mutations of different mutation types in the sequencing results of Example 4 is shown.

[0080] Figure 6 A bar graph showing the yield statistics of the PCR amplification results in Example 5 is shown.

[0081] Figure 7 A statistical bar graph of the number of base mutations of different mutation types in the sequencing results of Example 5 is shown.

[0082] Figure 8 A statistical bar graph of the number of base mutations of different mutation types in the sequencing results of Example 7 is shown. DETAILED DESCRIPTION

[0083] The present invention uses ammonium sulfite to replace ammonium sulfate, potassium chloride, etc. commonly used in PCR systems; commonly used tissue-compatible substances such as betaine and trehalose are replaced with ectoine, and a reducing agent (vitamin C, reduced glutathione, N-acetylcysteine) is added to form a composite enhancer in combination with ectoine. The additives of the present invention are used to perform amplification reactions, which significantly improves the fidelity of DNA polymerase, especially thermophilic DNA polymerase, ensures the accuracy of the DNA replication process, and thus significantly improves the reliability and efficiency of the experimental results.

[0084] definition

[0085] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0086] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0087] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0088] In the present disclosure, the term "nucleic acid" may refer to DNA, RNA, dsDNA, dsRNA, ssDNA, ssRNA, or DNA / RNA complexes or hybrids of sequences obtained from any source, containing target sequences and non-target sequences. For example, nucleic acid samples can be obtained from artificial sources or by chemical synthesis, or from viruses, prokaryotic cells including microorganisms, or eukaryotic cells. Biological samples can be vertebrates, invertebrates, plants, microorganisms, viruses, mycoplasmas, fungi, or archaea, including humans or non-humans.

[0089] In this disclosure, the term "DNA", the full name of which is "deoxyribonucleic acid" (abbreviated as DNA), is one of the four biological macromolecules contained in biological cells. DNA carries the genetic information necessary for the synthesis of RNA and proteins, and is an essential biological macromolecule for the development and normal functioning of organisms. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose and phosphate. There are four types of bases: adenine (A), guanine (G), thymine (T) and cytosine (C)

[0090] As used herein, the term "polymerase chain reaction" or "PCR" refers to a technique used in molecular biology for the amplification of nucleic acid templates. PCR gets its name from one of its basic components, DNA polymerase, which is used to amplify a section of DNA through cycles in in vitro enzymatic replication. Typically, PCR employs a thermostable polymerase, deoxynucleoside triphosphates ("dNTPs"), a pair of primers, and template DNA. A single PCR reaction (or cycle) often includes: (1) increasing the sample temperature to a temperature sufficient to melt or denature the double-stranded DNA molecules into single-stranded templates, (2) cooling the sample so that the DNA primers can bind or anneal to each template, and optionally (3) re-adjusting the sample temperature to optimize the enzymatic addition of dNTPs to the ends of each bound primer, thereby forming new DNA molecules. Due to the development of PCR technology, the generated DNA ("amplicon") itself is used as a template for further replication. This initiates a chain reaction in which the DNA template is exponentially amplified. With PCR, a single copy or multiple copies of DNA can be amplified across several orders of magnitude, thereby generating millions or more copies of DNA. Those skilled in the art will appreciate that, in this article, the PCR includes any reaction involving a polymerase that can amplify a nucleic acid, such as in situ PCR, anchored PCR, asymmetric PCR, long-distance PCR, touchdown PCR, RAA recombinase-mediated isothermal nucleic acid amplification, RPA recombinase polymerase amplification, RCA rolling circle amplification, CPA cross primer amplification, SDA strand displacement amplification, HDA helicase-dependent amplification, or MIRA multienzyme isothermal rapid amplification.

[0091] As used herein, the term "sequence identity" refers to the "percentage of sequence identity" or "percentage of identity" between two polynucleotides, i.e., the number of identical matching positions shared by the sequences within the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position in which the same nucleotides are present in both the target sequence and the reference sequence. Since a gap is not a nucleotide, the gap present in the target sequence is not counted. Similarly, since the target sequence nucleotides are counted, and the nucleotides from the reference sequence are not counted, the gap present in the reference sequence is not counted. At least 85% sequence identity includes at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the total length of the sequence having a continuous segment with sequence identity.

[0092] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The determination of the sequence identity percentage between the comparison of the sequence and the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses the BLASTN algorithm to compare between two sequences. BLASTN is used to compare nucleic acid sequences. Other suitable programs are, for example, a part of the EMBOSS suite of Needle, Stretcher, Water or Matcher, bioinformatics programs, and can also be obtained at www.ebi.ac.uk / Tools / psa.

[0093] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the examples. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. The actual protection scope of the present invention is set forth in the claims. In the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are not mentioned in terms of their sources, and are all commercially available on the market or obtained by conventional methods known to those skilled in the art.

[0094] Example

[0095] Example 1: Fidelity Test Substrate Preparation

[0096] Using the target sequences shown in SEQ ID NOs: 101 to 149 in λDNA (genebank ID: NC 001416) and PET28a plasmid (Shenggong: B540183) as templates, 49 pairs of corresponding primers were designed, and each pair of primers was amplified separately. The commercial amplification enzyme KOD-Plus-Neo (TOYOBO: KOD-401) was used to amplify the target DNA sequence. The PCR reaction system is shown in Table 1, and the nucleotide sequences of the primers used are shown in SEQ ID NOs: 3 to 100.

[0097] Table 1. KOD-Plus-Neo amplification system and procedures

[0098]

[0099]

[0100] The PCR products were detected by agarose electrophoresis, and the target bands were cut and recovered according to the electrophoresis results. After recovery, 49 amplified products were mixed in equal molar amounts, and the mixed products were used for library construction kit (Yisheng: Ultima Pro DNA Library Prep Kit for Illumina) was used for adapter ligation and magnetic bead purification, and the purified product was used as a substrate for fidelity detection.

[0101] Example 2: Preparation of KOFU amplification enzyme

[0102] Codon optimization: The nucleotide sequence of SEQ ID NO 1 was codon optimized to obtain a DNA sequence of KOFU (SEQ ID NO: 2) synthesized by Bio-Industry, which encodes the KOFU enzyme having the amino acid sequence shown in SEQ ID NO: 1. The synthesized DNA sequence was cloned into the expression vector pET28a.

[0103] KOFU expression: The pET28a expression vector containing the KOFU target gene was transformed into the BL21 (DE3) strain. In the clean bench, a single colony was picked and inoculated into 1 mL LB (K + ) medium and cultured at 37°C overnight with shaking. In a clean bench, inoculate 10 mL LB (K +) medium, and culture at 37℃ with shaking for 4 hours until the bacteria grow in logarithmic phase. After 4 hours, transfer all 10mL of expression strain to 1L LB (K + ) medium and cultured at 37°C with shaking. After the expression bacteria were cultured for about 3 hours, the bacteria were cultured to OD 600 When the pH is about 0.8, add IPTG to 1 L of fermentation broth to a final concentration of 0.5 mM and culture at 25°C with shaking overnight (16 h to 18 h).

[0104] Purification: Collect bacterial sludge by centrifugation, resuspend the bacterial sludge with lysis solution, and ultrasonically disrupt at 350W, 2s / 3s, 30min; heat-treat the disrupted bacterial solution at 80℃ for 30min; centrifuge at 4℃, 11000r / min for 20min to collect the supernatant; filter the supernatant with a 0.45μm filter and place it on ice for later use. Purify KOFU DNA polymerase using Ni column and ion exchange column on AKTA purification system respectively. The eluted protein is finally dialyzed into PBS.

[0105] Example 3: Effect of Reduced Glutathione (GSH) on Fidelity

[0106] KOFU was used as DNA amplification enzyme, and 2× basic reaction composition was prepared. The basic formula of the reaction composition was excluding buffer, Mg 2+ In addition to the essential factors for PCR reaction such as dNTP, it also contains common PCR additives such as glycerol, Triton X-100, and tetramethylammonium chloride (TMAC), as shown in Table 2. The library amplification system and procedure are shown in Table 3, where Tris-HCl, glycerol, KCl, Triton X-100, (NH4)2SO4, TMAC, betaine and GSH were purchased from Bio-Tech, magnesium sulfate and BSA were purchased from Merck, and dNTP was purchased from Takara. In addition, different concentrations of reduced glutathione (GSH) were added to the basic reaction system to analyze the effect of GSH on the fidelity of KOFU. The test concentrations of GSH were 0.25Mm, 0.5mM, 1mM, 2mM, 4.5mM, 7mM, 9mM, and 11mM, respectively. The PCR product was purified by magnetic beads and then sequenced by double-end 150 sequencing using the MGI sequencing system.

[0107] Table 2. Basic reaction composition (2×) components

[0108]

[0109]

[0110] Table 3. Library amplification system

[0111]

[0112] Primer F:

[0113] TCCTCAGTACGTCAGCAGTTCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCG

[0114] ACT (SEQ ID NO: 150)

[0115] Primer R: GGCATGGCGACCTTATCAGTTGTCTTCCTAAGACCGCTTGGCC (SEQ ID NO:

[0116] 151).

[0117] Analyze data: Use SEQ ID NO: 101-149 as reference sequence for comparison, select data that are valid in both the forward and reverse directions, and then select the position where the same mutation is detected in both directions and mark it as a mutation introduced during DNA polymerase amplification. If a mutation is detected in only one direction, but no mutation occurs in the other direction, or the mutation is different, it indicates that the mutation is introduced by the sequencing platform and does not belong to a mutation introduced during DNA polymerase amplification. The mutation is a mutation relative to the nucleotide sequence of SEQ ID NO: 101-149. Fidelity is expressed by mutation frequency. The higher the mutation rate, the lower the fidelity.

[0118] Calculation of mutation rate (also known as error rate): mutation rate = number of mutated bases / number of valid bases.

[0119] Fidelity calculation: Fidelity = 1-mutation rate.

[0120] The results are as follows Figure 1-Figure 3 As shown in the figure: With the increase of GSH concentration, the PCR yield showed a trend of first increasing and then decreasing. When 0.25mM GSH was added to the reaction system, the PCR yield decreased significantly ( Figure 1 ). Adding GSH to the reaction system can improve the fidelity of KOFU amplification ( Figure 2 ). The frequencies of four types of mutations, namely C>A, G>T, C>T, and G>A, were significantly reduced. In particular, 7mM to 11mM GSH could significantly improve the fidelity of KOFU amplification ( Figure 3 ). Therefore, the optimal concentration of GSH is 7mM~9mM.

[0121] Example 4: Effect of ammonium sulfite on fidelity

[0122] KOFU was used as DNA amplification enzyme, and 2× reaction composition was prepared. The basic formula of the reaction composition was excluding buffer, Mg 2+In addition to the essential factors for PCR reaction such as dNTP, it also contains common PCR additives such as glycerol, Triton X-100, and TMAC. Ammonium sulfite (McLean) was used to replace the ammonium sulfate in the basic system to analyze the effect of ammonium sulfite on the fidelity of KOFU, see Table 4. The library amplification system and procedure are shown in Table 5. The test concentrations are 10mM, 20mM, and 35mM, respectively. The PCR product was purified by magnetic beads, and then paired end 150 sequencing was performed using the MGI sequencing system to analyze the effect of ammonium sulfite on the fidelity of KOFU.

[0123] Table 4. Basic reaction composition (2×) containing ammonium sulfite

[0124] Components Final concentration Tris-HCl 50mM Magnesium sulfate 1.5mM dNTP 280uM glycerin 6%v / v KCl 10mM KOFU 1U TritonX-100 0.05% v / v BSA 50ug / mL <![CDATA[(NH4)2SO3]]> 10mM, 20mM or 35mM TMAC 35mM Betaine 0.5M

[0125] Table 5. Library amplification system

[0126]

[0127]

[0128] Analyze data: Filter valid data in both the forward and reverse directions, then select the positions where the same mutation is detected in both directions, and mark them as mutations introduced during DNA polymerase amplification. If a mutation is detected in only one direction, and no mutation occurs in the other direction (or the mutation is different), it indicates that the mutation is introduced by the sequencing platform and does not belong to the mutation introduced during DNA polymerase amplification. The mutation is a mutation relative to the nucleotide sequence of SEQ ID NO: 101-149. Fidelity is expressed by mutation frequency. The higher the mutation rate, the lower the fidelity.

[0129] Calculation of mutation rate (also known as error rate): mutation rate = number of mutated bases / number of valid DNA bases.

[0130] Fidelity calculation: Fidelity = 1-mutation rate.

[0131] The results are as follows Figure 4-Figure 5 As shown: Ammonium sulfite provides the necessary cations in the PCR reaction system. As the concentration increases from 10 mM to 35 mM, the PCR yield also increases slowly ( Figure 4 ). In the test concentration range of 10mM to 35mM, using ammonium sulfite instead of ammonium sulfate can improve the fidelity of KOFU amplification, especially the mutation frequencies of C>T and G>A are significantly reduced ( Figure 5 ).

[0132] Example 5: Effect of Ectohydropyrimidine on Fidelity

[0133] Ectoine was used to replace betaine to test the effect of different concentrations of ectoine (McLean) on fidelity. The test concentrations were 0.33 M, 0.66 M, 0.99 M, and 1.32 M. KOFU was used as the DNA amplification enzyme, and a 2× reaction composition was prepared. In addition to the buffer and Mg 2+ In addition to the essential factors for PCR reaction such as dNTP, it also contains common PCR additives such as glycerol, Triton X-100, and TMAC. In addition, ectoine was used to replace betaine to test the effect of different concentrations of ectoine on fidelity. The test concentrations were 0.33M, 0.66M, 0.99M, and 1.32M, as shown in Table 6. The library amplification system and procedures are shown in Table 7. The PCR product was purified by magnetic beads, and then paired end150 sequencing was performed using the MGI sequencing system to analyze the effect of ectoine on the fidelity of KOFU.

[0134] Table 6. Basic reaction composition (2×) containing ectoine:

[0135]

[0136]

[0137] Table 7. Library amplification system:

[0138]

[0139] The raw data fastq files were processed as follows: (1) low-quality bases at the 3' end were removed; (2) adapter sequences contained in the reads were removed; (3) reads containing N bases were removed;

[0140] Analyze data: Filter valid data in both the forward and reverse directions, then select the positions where the same mutation is detected in both directions, and mark them as mutations introduced during DNA polymerase amplification. If a mutation is detected in only one direction, and no mutation occurs in the other direction (or the mutation is different), it indicates that the mutation is introduced by the sequencing platform and does not belong to the mutation introduced during DNA polymerase amplification. The mutation is a mutation relative to the nucleotide sequence of SEQ ID NO: 101-149. Fidelity is expressed by mutation frequency. The higher the mutation rate, the lower the fidelity.

[0141] Calculation of mutation rate (also known as error rate): mutation rate = number of mutated bases / number of valid DNA bases.

[0142] Fidelity calculation: Fidelity = 1-mutation rate.

[0143] The results are as follows Figure 6-Figure 7As shown: When the concentration is ≤0.66M, the PCR yield does not change significantly. As the concentration of ectoine continues to increase, the PCR yield decreases significantly ( Figure 6 ). Adding ectoine instead of betaine as an additional additive can significantly improve the fidelity of KOFU amplification, especially the mutation frequencies of C>T and G>A are significantly reduced ( Figure 7 ). Therefore, the optimal concentration range of ectoine is 0.33M-0.66M.

[0144] Example 6: Amplification enzyme reaction reagent configuration in the present invention

[0145] KOFU was used as DNA amplification enzyme, and 2× reaction composition was prepared, as shown in Table 8. In addition to buffer, Mg 2+ In addition to the essential factors for PCR reaction such as dNTP, it also contains common PCR additives such as glycerol, TritonX-100, TMAC, etc. In addition, (NH4)2SO3 is used to replace (NH4)2SO4; Ectoine and reduced glutathione (GSH) are used to replace betaine.

[0146] Table 8. Improved reaction composition (2×) formulation

[0147]

[0148]

[0149] Example 7: Fidelity test of the reaction system of the present invention

[0150] After the product in Example 1 was purified by magnetic beads, the library was amplified using the 2× improved reaction composition configured as shown in Table 8 and the 2× basic reaction composition (containing ammonium sulfate betaine) as shown in Table 2 according to the amplification system shown in Table 9. Then paired end 150 sequencing was performed using the MGI sequencing system.

[0151] Table 9. Library amplification system:

[0152]

[0153] The raw data fastq files were processed as follows: (1) low-quality bases at the 3' end were removed; (2) adapter sequences contained in the reads were removed; and (3) reads containing N bases were removed.

[0154] Analyze data: Filter valid data in both the forward and reverse directions, then select the positions where the same mutation is detected in both directions, and mark them as mutations introduced during DNA polymerase amplification. If a mutation is detected in only one direction, and no mutation occurs in the other direction (or the mutation is different), it indicates that the mutation is introduced by the sequencing platform and does not belong to the mutation introduced during DNA polymerase amplification. The mutation is a mutation relative to the nucleotide sequence of SEQ ID NO: 101-149. Fidelity is expressed by mutation frequency. The higher the mutation rate, the lower the fidelity.

[0155] Calculation of mutation rate (also known as error rate): mutation rate = number of mutated bases / number of valid DNA bases.

[0156] Fidelity calculation: Fidelity = 1-mutation rate.

[0157] Mutation rate calculation: mutation rate = number of mutations / effective DNA sequencing amount.

[0158] The results are as follows Figure 8 As shown in Table 10: The mutation frequency (error rate) of the 2× improved reaction composition configured by the present invention is significantly lower than that of the basic formula (2×), especially the mutation frequencies of six types, A>G, T>C; C>A, C>T; C>T, G>A, are significantly reduced. And there is no significant effect on the PCR yield.

[0159] Table 10. Comparison of mutation frequency and library yield between the reaction buffer of the present invention and the basic formula

[0160] Reaction buffer of the present invention Basic formula PCR-free Library yield (ng) 1433.6 1337.6 / Total number of aligned bases 1000000000 1000000000 1000000000 A>C mutation number 164 107 81 Number of A>G mutations 712 1057 544 Number of A>T mutations 109 264 177 C>A mutation number 2383 3005 718 Number of C>G mutations 266 194 227 Number of C>T mutations 3023 4989 2974 Number of G>A mutations 4227 6821 3429 Number of G>C mutations 293 185 143 Number of G>T mutations 1495 1858 468 Number of T>A mutations 191 456 251 Number of T>C mutations 536 628 308 Number of T>G mutations 76 56 18 Total number of mutations 13475 19620 9338 Mutation frequency <![CDATA[1.35×10 -5 ]]> <![CDATA[1.96×10 -5 ]]> <![CDATA[9.34×10 -6 ]]> True error rate <![CDATA[4.14×10 -6 ]]> <![CDATA[1.03×10 -5 ]]> /

[0161] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A reducing agent suitable for polymerase chain reaction, the reducing agent comprising one or more of sulfite, tetrahydropyrimidine or thiol compounds.

2. The reducing agent according to claim 1, characterized in that: The sulfite includes at least one of ammonium sulfite, sodium sulfite, sodium bisulfite, sodium pyrosulfite, sodium dithionite, potassium sulfite or potassium bisulfite; Preferably, the thiol compound comprises at least one of cysteine, N-acetylcysteine ​​or glutathione; Preferably, the glutathione is reduced glutathione; Preferably, the reducing agent comprises 5 to 20 mM sulfite; preferably comprises 10 to 20 mM sulfite; Preferably, the reducing agent comprises 0.1 to 0.5 M ectoine; preferably comprises 0.165 to 0.33 M ectoine; Preferably, the reducing agent comprises 0.1 to 5.5 mM of a thiol compound; more preferably, it comprises 3.5 to 5.5 mM of a thiol compound; more preferably, it comprises 3.5 to 4.5 mM of a thiol compound.

3. The reducing agent according to claim 1, characterized in that: The reducing agent includes sulfite, tetrahydropyrimidine and thiol compounds; Preferably, sulfite, ectoine and glutathione are included; More preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol compound is (5-20): (100-500): (0.1-5.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol compound is (10-20): (165-330): (3.5-5.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol is (10-20): (165-330): (3.5-4.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol is 17.5:165:3.5; Preferably, it comprises 5 to 20 mM sulfite, 0.1 to 0.5 M ectoine and 0.1 to 5.5 mM thiol compound; Preferably, it comprises 10-20 mM sulfite, 0.165-0.33 M tetrahydropyrimidine and 3.5-5.5 mM thiol compound; Preferably, it comprises 10-20 mM sulfite, 0.165-0.33 M ectoine and 3.5-4.5 mM thiol compound; Preferably, it includes 17.5 mM sulfite, 0.165 M ectoine and 3.5 mM thiol compound.

4. A composition suitable for polymerase chain reaction, comprising the reducing agent according to any one of claims 1 to 3.

5. The composition according to claim 4, characterized in that The composition comprises 5 to 20 mM sulfite; preferably 10 to 20 mM sulfite; and / or The composition comprises 0.1 to 0.5 M ectoine; preferably 0.165 to 0.33 M ectoine; and / or The composition comprises 0.1 to 5.5 mM of a thiol compound; preferably comprises 3.5 to 5.5 mM of a thiol compound; more preferably comprises 3.5 to 4.5 mM of a thiol compound; Preferably, the composition comprises sulfite, tetrahydropyrimidine and a thiol compound; Preferably, the composition comprises sulfite, ectoine and glutathione; Preferably, the composition comprises sulfite, tetrahydropyrimidine and thiol compound in a molar ratio of (5-20):(100-500):(0.1-5.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol is (10-20): (165-330): (3.5-5.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol is (10-20): (165-330): (3.5-4.5); Preferably, the molar ratio of sulfite, tetrahydropyrimidine and thiol is 17.5:165:3.5; Preferably, it comprises 5 to 20 mM sulfite, 0.1 to 0.5 M ectoine and 0.1 to 5.5 mM thiol compound; Preferably, it comprises 10-20 mM sulfite, 0.165-0.33 M tetrahydropyrimidine and 3.5-5.5 mM thiol compound; Preferably, it comprises 10-20 mM sulfite, 0.165-0.33 M tetrahydropyrimidine and 3.5-4.5 mM thiol compound; Preferably, it includes 17.5 mM sulfite, 0.165 M ectoine and 3.5 mM thiol compound.

6. The composition according to claim 5, characterized in that The composition further comprises tetramethylammonium chloride (TMAC), glycerol, serum albumin and / or a surfactant; Preferably, the surfactant includes one or more of SDS, Tween-20, Tween-40, Tween-60, Tween-80, TritonX-100, Triton X-200, Triton X-400, NP-20 or NP-40; Preferably, the composition further comprises 1% to 10% v / v glycerol, 0.01% to 0.5% v / v Triton X-100, 5 to 25 mM tetramethylammonium chloride, and / or 10 to 50 ug / mL serum albumin; Preferably, the composition further comprises 2% to 8% v / v glycerol, 0.01% to 0.1% v / v Triton X-100, 10 to 20 mM tetramethylammonium chloride, and / or 15 to 30 ug / mL serum albumin; Preferably, the composition further comprises one or more of a buffer, a nucleic acid polymerase, dNTPs, a nucleic acid to be amplified and / or a primer pair; Preferably, the buffer comprises one or more of Tris buffer, Tris-HCl buffer and phosphate buffer; Preferably, the nucleic acid polymerase includes DNA polymerase and RNA polymerase; Preferably, the nucleic acid polymerase comprises a high-fidelity polymerase, a low-temperature polymerase or a thermostable polymerase; Preferably, the DNA polymerase comprises KOFU enzyme, KOD-Plus-Neo, T4 DNA polymerase, T7 DNA polymerase, DNA polymerase I or DNA polymerase I large fragment Klenow, Taq DNA polymerase, 2G Robust DNA polymerase, rTaq DNA polymerase, TaqB DNA polymerase, kapa HIFI hot start high fidelity polymerase, pfu DNA polymerase, phusion DNA polymerase, Phi29 DNA polymerase, Bst DNA polymerase, Pyrophage 3137, Vent polymerase, TOPO Taq DNA polymerase, Klenow Fragment DNA polymerase I, MMLV reverse transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, T7 phase DNA polymerase variant, super fidelity DNA polymerase, Taq polymerase, E.coli DNA polymerase, LongAmp Taq DNA polymerase, OneTaq DNA polymerase, Deep Vent DNA polymerase, Vent (exo-) DNA polymerase, Deep One or more of Vent (exo-) DNA polymerase, Psp GBD (exo-) DNA polymerase; more preferably KOFU enzyme; Preferably, the composition further comprises 10-50 mM buffer, 0.1-1 U nucleic acid polymerase, and / or 100-200 μM dNTP; Preferably, the composition further comprises an inorganic salt; Preferably, the inorganic salt comprises Mg 2+ , K + 、Na + One or more of the following ions SO4 2- , Cl - One or more combinations of; Preferably, the composition further comprises 0.1 to 10 mM inorganic salt; Preferably, the pH of the composition is 7-9.

7. An amplification system, characterized in that: The amplification system comprises the reducing agent according to any one of claims 1 to 3 or the composition according to any one of claims 4 to 6.

8. A kit comprising the reducing agent according to any one of claims 1 to 3 or the composition according to any one of claims 4 to 6.

9. A method for improving the fidelity of an amplification enzyme, the method comprising performing amplification using the amplification system of claim 7 or the kit of claim 8.

10. Use of the reducing agent according to any one of claims 1 to 3, the composition according to any one of claims 4 to 6, the amplification system according to claim 7 or the kit according to claim 8 in improving the fidelity of a polymerase; Preferably, said improving the fidelity of the polymerase comprises reducing the mutation frequency of C>A, C>T, G>A, G>T in the polymerase chain reaction; It is more preferred to reduce the mutation frequency of C>T and G>A in the polymerase chain reaction.

Images