A biological sample spatial information detection method and application

Abstract

The present invention belongs to the field of genetic engineering and bioengineering technology, and specifically relates to a biological sample spatial information detection method and its application. The biological sample spatial information detection method of the present invention uses external force to assist in the first step of single-cell spatial information detection of biological samples. By preparing tissue slices and placing the sample to be tested on a first carrier for centrifugation, it can ensure that the intracellular substances released by a single cell in the tissue slice will always be confined to the plane area covered by the cell and cannot escape the cell preparation range. Therefore, the possibility of being captured by the capture probe adjacent to the cell is greatly reduced, so that the spatial information of tissue gene expression obtained by the test is clearer and more accurate, and has better clinical application and scientific research value.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and bioengineering, and specifically relates to a biological sample spatial information detection method and application thereof. Background Art

[0002] Single-cell spatial transcriptome sequencing technology is based on the capture probes with positional label information on the encoded slide, which specifically bind to the mRNA or mRNA reaction products released from the cells of the tissue slices on the slide, and then amplify the template and construct the sequencing library. After sequencing and bioinformatics analysis, not only can the gene expression information of a single cell be obtained, but also the location of the gene expression information can be located.

[0003] At present, the more widely used methods include 10X Genomics Visiμm and BGI Stereo-seq. They are all based on the free diffusion of molecules so that the mRNA or mRNA reaction products released in the cell are captured by the capture probe. However, due to the disorder of free diffusion of molecules, while migrating to the surface of the glass slide in the longitudinal direction and being captured by the capture probe located under a single cell, it will also diffuse in the lateral direction and exceed the plane area occupied by the cell, causing the partially diffused mRNA or mRNA reaction product to be captured by the capture probe outside the cell, thereby making the gene expression location information obtained by sequencing analysis "distorted".

[0004] In order to solve the above problems, Chinese patent CN118186591A discloses a new solution, which uses a capture probe with position label information on the encoded slide to mark the cell nucleus of the tissue section on the slide, and then extracts the cell nucleus of the tissue section, and uses the single-cell transcription sequencing method to detect the single cell nucleus, so as to obtain the spatial gene expression information of the single cell. However, this method will cause cell loss in the process of extracting the cell nucleus, making the spatial gene expression information of the tissue section finally obtained incomplete; at the same time, the detection object of this method is the cell nucleus rather than the cell, which also causes more transcriptome information contained in the cytoplasm to be lost. Therefore, the art expects to develop a method that can comprehensively and completely detect the spatial information of biological samples. Summary of the invention

[0005] To this end, the technical problem to be solved by the present invention is to provide a method for detecting spatial information of biological samples, which detects spatial information of single cells of biological samples with the assistance of external force, and can be used to analyze spatial information of gene expression of biological samples;

[0006] The second technical problem to be solved by the present invention is to provide an application of the above-mentioned biological sample spatial information detection method.

[0007] In order to solve the above technical problems, a biological sample spatial information detection method according to the present invention comprises the following steps:

[0008] (1) preparing a tissue slice from a sample to be tested and placing it on the surface of a first carrier with a capture probe to obtain two-dimensional contour information of the tissue slice;

[0009] (2) continuing to drip the permeabilization reaction solution onto the tissue slice, and centrifuging the sealed tissue slice, so that the intracellular substances in the sample to be tested migrate to the surface and are captured by the capture probe;

[0010] (3) When the intracellular substance is nucleic acid, the reaction products are collected and subjected to a series of amplification reactions to convert the captured nucleic acid into library DNA that can be used for sequencing, and then sequenced and analyzed for data to obtain the result;

[0011] or,

[0012] (3') When the intracellular substance is protein, the reaction product is collected for analysis and detection.

[0013] Specifically, in the biological sample spatial information detection method, in step (1), the step of obtaining two-dimensional contour information includes staining or photographing.

[0014] Specifically, in the biological sample spatial information detection method, in the step (1), the capture probe is directly or indirectly bound to the first carrier in sequence;

[0015] Preferably, the capture probe is connected to the surface of the first carrier by chemical coupling;

[0016] Preferably, the capture probe forms a capture probe sopt spot array on the surface of the first carrier;

[0017] Preferably, each spot on the sopt spot array is composed of capture probes with the same spatial position sequence;

[0018] Preferably, the spot includes a square or a circle;

[0019] Preferably, the first carrier comprises glass or plastic.

[0020] Specifically, in the biological sample spatial information detection method, the intracellular substance is selected from nucleic acids;

[0021] The capture probe comprises a nucleic acid fragment containing at least a spatial position sequence and a nucleic acid capture sequence;

[0022] Preferably, the capture probe comprises a nucleic acid fragment containing at least a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence;

[0023] Preferably, the capture probe comprises a nucleic acid fragment formed by sequentially connecting a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence from the 5' end to the 3' end;

[0024] Preferably, the nucleic acid capture sequence includes a sequence containing multiple T bases, and captures mRNA or mRNA reaction products containing multiple A bases released from cells by base complementary pairing.

[0025] Specifically, in the biological sample spatial information detection method, the intracellular substance is selected from proteins;

[0026] The capture probe includes a nucleic acid segment modified by a second protein;

[0027] Preferably, the second protein includes a protein that can recognize and capture the intracellular substance through antigen-antibody interaction.

[0028] Specifically, in the biological sample spatial information detection method, in step (2), the permeabilization reaction solution includes a mixture of one or more of enzyme-free water, hydrochloric acid, Triton X-100, Tween-20, protein digestion enzyme, and tissue removal enzyme;

[0029] Preferably, the permeabilization reaction solution comprises 0.01-0.02M hydrochloric acid solution;

[0030] Preferably, the permeabilization reaction solution includes a proteinase K solution.

[0031] Specifically, in the biological sample spatial information detection method, in step (2), in the centrifugation step:

[0032] The centrifugation speed is 100-4000×g; and / or,

[0033] The centrifugation time is 5-50 min; and / or,

[0034] The centrifugation temperature is 4-37°C.

[0035] Specifically, in the biological sample spatial information detection method, in step (3): the series of amplification reactions includes:

[0036] Reverse transcription is performed on the captured nucleic acid to form cDNA using a reverse transcription reaction solution;

[0037] Amplifying the cDNA by second-strand reaction solution to obtain a complementary DNA strand;

[0038] PCR amplification was performed using PCR reaction solution, and DNA was purified to obtain a next-generation sequencing library;

[0039] Preferably, the reverse transcription reaction solution contains at least enzyme-free water, dNTP, reverse transcriptase, primers, and salt ions;

[0040] Preferably, the second chain reaction solution contains at least enzyme-free water, dNTP, second chain synthetase, primers, and salt ions;

[0041] Preferably, the PCR reaction solution contains at least enzyme-free water, dNTP, PCR amplification enzyme, primers, and salt ions;

[0042] Preferably, it further comprises the steps of adding a cleaning solution to remove the nucleic acid and / or adding a cleaning solution to elute the complementary DNA chain;

[0043] Preferably, the cleaning solution comprises a mixture of one or more of PBS, SSC, PBS containing Tween-20, SSC containing RNase inhibitor, NaOH solution or KOH solution;

[0044] Preferably, the data analysis uses a bioinformatics analysis algorithm to process the sequencing data.

[0045] Specifically, in the biological sample spatial information detection method, in step (3'), the analysis and detection step includes fluorescence technology, chemiluminescence technology, and electrochemical technology.

[0046] The invention also discloses the application of the biological sample spatial information detection method in the field of genetic engineering.

[0047] The biological sample spatial information detection method of the present invention uses external force to assist the first step of single-cell spatial information detection of biological samples. After the sample to be tested is prepared into tissue slices, it is placed on a first carrier for centrifugal treatment, so that the intracellular substances in the cell are released from the cell to the outside of the cell and are affected by centrifugal force and free diffusion force. Since the centrifugal force is greater than the free diffusion force, the nucleic acid mainly migrates in the longitudinal direction and the distance of migration in the transverse direction is much smaller than the distance of migration in the longitudinal direction. Therefore, the intracellular substances released by a single cell in the tissue slice will be confined to the plane area covered by the cell and cannot escape the range of the cell preparation. Therefore, the possibility of being captured by the capture probe near the cell is greatly reduced, so that the spatial information of tissue gene expression obtained by the test is clearer and more accurate, and will not cause the experimenter to make information interpretation. It has better clinical application and scientific research value and can be used to analyze the spatial information of gene expression of biological samples.

[0048] The biological sample spatial information detection method of the present invention is based on centrifugal force-assisted single-cell spatial information detection of biological samples. The entire method is not limited to the cell nucleus and does not involve cell nucleus extraction. It will not cause cell loss and loss of transcriptome information in the cytoplasm, so that the tissue section information obtained by analysis is more complete and the experimental operation is simpler. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0050] Figure 1 is a schematic diagram of a first carrier connected with a capture probe;

[0051] Figure 2 is a schematic diagram of a capture probe array on the first carrier;

[0052] Figure 3 HE images of the ovaries of mice in the experimental group;

[0053] Figure 4 This is the HE image result of the ovary of the mice in the control group;

[0054] Figure 5 This is the UMI distribution result of the ovaries of mice in the experimental group;

[0055] Figure 6 This is the UMI distribution result of the ovaries of mice in the control group;

[0056] Figure 7 This is an example of the quality control results of the library fragment size. DETAILED DESCRIPTION

[0057] The present invention provides a method for detecting the spatial information of a single cell of a biological sample based on external force assistance, which can be used to analyze the spatial information of gene expression of a biological sample. Specifically, the biological sample spatial information detection method of the present invention selects a first carrier combined with an appropriate capture probe. When the sample to be tested is made into a tissue slice and attached to the first carrier, the tissue slice is stained and photographed to obtain its two-dimensional contour information. Then the first carrier is loaded in a matching card holder, and the tissue slice is placed face up in a centrifugal device with a vertical centrifugal rotor. Tissue permeabilization solution is dripped onto the tissue slice and sealed, and then the centrifugal device is immediately started, so that the intracellular material in the cell is subjected to centrifugal force and free diffusion force while being released from the cell to the outside of the cell. Because when the centrifugal force is greater than the free diffusion force, the intracellular material mainly migrates in the longitudinal direction and the distance of migration in the transverse direction is much smaller than the distance of migration in the longitudinal direction, so the intracellular material released by a single cell in the tissue slice is always limited to the plane area covered by the cell. When the intracellular material migrates to the surface of the first carrier, it will be specifically captured by the capture probe located under each cell. Subsequently, the cartridge is removed from the centrifugal device, and after appropriate processing, sequencing or analysis is performed to ultimately obtain the spatial information of gene expression in the tissue section.

[0058] In the biological sample spatial information detection method of the present invention, during centrifugation, since the centrifugal force is greater than the free diffusion force, the intracellular substances mainly migrate in the longitudinal direction and the distance migrated in the transverse direction is much smaller than the distance migrated in the longitudinal direction, so that the intracellular substances released from the cells are always confined to the plane area covered by the cells. Therefore, the possibility of the intracellular substances being captured by the capture probes adjacent to the outside of the cells is greatly reduced, thereby making the test to obtain the spatial information of tissue gene expression more accurate, without generating information interpretation, and having better clinical application and scientific research value.

[0059] In some embodiments, the biological sample spatial information detection method of the present invention comprises the following steps:

[0060] (1) preparing a tissue slice from a sample to be tested and placing it on the surface of a first carrier with a capture probe to obtain two-dimensional contour information of the tissue slice;

[0061] (2) continuing to drip the permeabilization reaction solution onto the tissue slice, and centrifuging the sealed tissue slice, so that the intracellular substances in the sample to be tested migrate to the surface and are captured by the capture probe;

[0062] (3) When the intracellular substance is nucleic acid, the reaction products are collected and subjected to a series of amplification reactions to convert the captured nucleic acid into library DNA that can be used for sequencing, and then sequenced and analyzed for data to obtain the result;

[0063] or,

[0064] (3') When the intracellular substance is protein, the reaction product is collected for analysis and detection.

[0065] In some specific embodiments, the material of the first carrier can be glass, plastic, etc., and its appearance size can be customized according to experimental needs. As an embodiment, the first carrier is glass, and its appearance size is the size of a conventional glass slide 25mm×75mm, so as to have good compatibility with photographic equipment such as microscopes.

[0066] In some specific embodiments, the capture probe is combined with the first carrier in a direct or indirect manner known in the art. For example, as an exemplary embodiment, the capture probe is connected to the surface of the first carrier by chemical coupling.

[0067] In some specific embodiments, in the first carrier, the capture probe is combined with it and forms a capture probe sopt point array. Wherein, each spot on the point array is composed of capture probes with the same spatial position sequence, and the spot can be square or circular. As an embodiment, when the spot can be square, its size can be any one of 50μm×50μm, 30μm×30μm, 20μm×20μm, 15μm×15μm, 10μm×10μm, 8μm×8μm, 5μm×5μm, 2μm×2μm, etc. The spatial position sequence is known and can be used to define the plane coordinate (X-axis, Y-axis) position of each spot on the point array, so the spatial position sequence of the capture probe of each spot is different.

[0068] In some specific embodiments, when the intracellular substance is nucleic acid, the capture probe includes a nucleic acid fragment containing at least a spatial position sequence and a nucleic acid capture sequence, which can be directly or indirectly bound to the first carrier in a certain arrangement order.

[0069] In some specific embodiments, the capture probe suitable for nucleic acid capture can be a nucleic acid fragment containing at least a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence, which can be directly or indirectly bound to the first carrier in a certain arrangement order. Among them, the PCR primer sequence is a known sequence, and the PCR primer sequence of each capture probe can be the same or different. The unique molecular identification tag sequence is used to count the gene expression information of cells during bioinformatics analysis, and the unique molecular identification tag sequence of each capture probe is different.

[0070] In some specific embodiments, the capture probe suitable for nucleic acid capture is a nucleic acid fragment formed by sequentially connecting a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence from the 5' end to the 3' end; wherein the nucleic acid capture sequence is a sequence containing multiple T bases, which can capture mRNA or mRNA reaction products with multiple A bases released from cells by base complementary pairing. As a preferred embodiment, the nucleic acid capture sequence is a sequence containing 30 consecutive T bases.

[0071] In some specific embodiments, in the capture probe suitable for nucleic acid capture, the nucleic acid capture sequence can undergo base complementary pairing with the nucleic acid released from the cell, thereby enabling the capture probe to capture the nucleic acid.

[0072] In some specific embodiments, when the intracellular substance to be analyzed is a protein, the capture probe can be a nucleic acid fragment modified by a second protein. The second protein can recognize and capture the protein released from the cell through antigen-antibody interaction. Furthermore, the captured protein can be analyzed and detected by fluorescence, chemiluminescence, electrochemistry, etc.

[0073] In some specific embodiments, the matching card clip can be a fixture made of plastic, metal and / or rubber material, having a cavity inside to allow the first carrier to be installed and fixed, and leaving space above the tissue slice to allow reagents to be added to the card clip so that the reagents can react with cells and / or intracellular substances.

[0074] In some embodiments, when the first carrier is mounted in the matching clip, the tissue slice faces upward and is surrounded by the silicone pad of the matching clip, forming a chamber that can accommodate reaction reagents. Then, when appropriate reaction reagents including permeabilization reaction solution are added to the chamber, they begin to react with cells and / or intracellular substances.

[0075] In some specific embodiments, in order to seal the tissue slice, the reaction reagent added thereto can be a permeabilization reaction solution. As an example, the permeabilization reaction solution is 0.01M hydrochloric acid. As an example, the permeabilization reaction solution is a proteinase K solution, which can digest and remove tissue.

[0076] In some specific embodiments, the centrifugal device is a device that can generate centrifugal force. When a vertical centrifugal rotor is installed, the centrifugal force on the object on the centrifugal rotor is mainly vertically downward. Therefore, when the centrifugal force is large enough, the nucleic acid released from the cells of the tissue section will be subjected to the vertical downward centrifugal force and dominate, so that the nucleic acid mainly migrates in the longitudinal direction and the distance migrated in the transverse direction is much smaller than the distance migrated in the longitudinal direction. At this time, the nucleic acid released by a single cell in the tissue section is always confined to the plane area covered by the cell. When intracellular substances such as nucleic acids migrate to the surface of the glass slide, they will be specifically captured by the capture probe located below each cell. As an embodiment, the centrifugal speed of the centrifugal device can be 100×g, 500×g, 1000×g, 2000×g, 4000×g, etc., and the centrifugal time can be 5min, 10min, 20min, 30min, 50min, etc. As a preferred embodiment, the centrifugal condition of the centrifugal device is 1000×g, 30min.

[0077] As a preferred embodiment, the centrifugal transposition has a temperature control function, and when an object is placed inside it, a constant reaction temperature is maintained. As an embodiment, the centrifugal transposition can provide a constant temperature condition of 4°C. As an embodiment, the centrifugal transposition can provide a constant temperature condition of 20°C. As a preferred embodiment, the centrifugal transposition can provide a constant temperature condition of 37°C.

[0078] As an exemplary embodiment, when it is necessary to analyze the single-cell spatial transcriptome gene expression information of a biological sample, the tissue section of the biological sample is attached to the spot array on the surface of the first carrier. The surface of the first carrier has a square spot array formed by capture probes. The capture probe is a nucleic acid fragment formed by sequentially connecting a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence from the 5' end to the 3' end, wherein the nucleic acid capture sequence is a sequence containing 30 consecutive T bases. The tissue section is stained using HE staining, and then scanned and photographed using a 3D microscope to record the contour morphology of the tissue section.

[0079] In some specific embodiments, when the nucleic acid migrates to the surface of the first carrier, it will be specifically captured by the capture probe located below each cell. Subsequently, the clamp is removed from the centrifugal device, washed, and the tissue permeabilization solution is removed. The captured mRNA is reverse transcribed using a reverse transcription reaction solution to form cDNA, and then the mRNA is washed and removed using an alkaline solution, and a second-chain reaction solution is added to amplify the cDNA to obtain a complementary DNA chain. The complementary DNA chain is eluted using an alkaline solution and the solution is recovered, and then multiple rounds of PCR amplification and DNA purification steps are performed to obtain a second-generation sequencing library. The sequencing library is sequenced using a second-generation sequencing instrument, and the sequencing data is processed using a bioinformatics analysis algorithm to ultimately obtain the spatial information of gene expression in the tissue section.

[0080] As an exemplary embodiment, the cleaning solution can be 1×PBS, 2×SSC, 6×SSC, 1×PBS (containing 0.1% Tween-20), 2×SSC (containing 1U / μL RNase inhibitor), 0.1M NaOH, 0.1M KOH, etc.

[0081] As an exemplary embodiment, the reverse transcription reaction solution contains at least enzyme-free water, dNTP, reverse transcriptase, primers, salt ions, etc., so that the reverse transcriptase can react with the nucleic acid captured by the capture probe as a template and convert it into cDNA.

[0082] As an exemplary embodiment, the second chain reaction solution contains at least enzyme-free water, dNTP, second chain synthesizing enzyme, primers, salt ions, etc., so that the base complementary chain (second chain reaction product) can be synthesized using cDNA or the nucleic acid captured by the capture probe as a template.

[0083] As an exemplary embodiment, the PCR reaction solution at least contains enzyme-free water, dNTP, PCR amplification enzyme, primers, salt ions, etc., which can be amplified using cDNA and / or the second chain reaction product as a template to obtain a large amount of DNA.

[0084] In some specific embodiments, in addition to adding reaction reagents to the matching card holder, reaction reagents can also be sucked out of the matching card holder. Therefore, when the second chain reaction liquid is added to react and the second chain reaction product is obtained, since the second chain reaction product is not covalently linked to the surface of the first carrier, the second chain reaction product can be recovered from the surface of the first carrier by alkaline elution denaturation. Then, the second chain reaction product is used as a template for PCR amplification to obtain a large amount of DNA. Further, sequencing adapters can be connected to the target DNA through DNA shearing, enrichment, and PCR amplification to form sequencing adapters, so that sequencing can be performed on a sequencing instrument.

[0085] As a specific preferred embodiment, for the sample to be tested where the intracellular substance to be detected is nucleic acid, the biological sample spatial information detection method of the present invention, after tissue preparation, the tissue slice is placed on the surface of the first carrier, and then the first carrier is loaded in the matching card clip, and is fixed on the vertical centrifugal rotor of the centrifugal device, and the centrifuge is symmetrically balanced. Tissue permeabilization liquid is dripped into the tissue slice and sealed, and the centrifugal device is immediately started to centrifuge, so that the mRNA with multiple consecutive A bases in the cell is gradually released from the cell to the outside of the cell. At this time, the mRNA is subjected to centrifugal force and free diffusion force. When the centrifugal force is large enough, the mRNA mainly migrates in the longitudinal direction and the distance migrated in the transverse direction is much smaller than the distance migrated in the longitudinal direction, so the mRNA released by a single cell in the tissue slice is always limited to the plane area covered by the cell. When the mRNA migrates to the surface of the first carrier, it will be specifically captured by the capture probe located below each cell. Subsequently, the card clip is removed from the centrifugal device, washed, and the tissue permeabilization liquid is removed. The captured mRNA is reverse transcribed using a reverse transcription reaction solution to form cDNA, and then the mRNA is washed with an alkaline solution to remove it, and a second-chain reaction solution is added to amplify the cDNA to obtain a complementary DNA chain. The complementary DNA chain is eluted with an alkaline solution and the solution is recovered, and then multiple rounds of PCR amplification and DNA purification steps are performed to obtain a second-generation sequencing library. The sequencing library is sequenced using a second-generation sequencing instrument, and the sequencing data is processed using a bioinformatics analysis algorithm to finally obtain the spatial information of gene expression in the tissue section.

[0086] The following examples shall describe in detail and specifically all necessary conditions required for ordinary technicians in this field to implement and reproduce the present invention, such as reaction temperature, reaction time, operating precautions, etc., as well as necessary instruments and equipment. If new substances or self-prepared materials are used, their manufacturing methods shall also be described. The description method in the examples is not restricted, and various methods and methods can be used to explain the technical solutions, principles, and functions and effects that can be achieved in this patent.

[0087] Example 1

[0088] The biological sample described in this embodiment is OCT-embedded mouse ovaries, and the composition and ratio of the entire detection system are set according to its conventional properties.

[0089] The cross-sectional schematic diagram of the first carrier with capture probes described in this embodiment is as follows Figure 1 As shown. The first carrier 1000 is a transparent glass with carboxyl chemical functional groups on the surface, and its size is 25mm×75mm. By using micro-nano processing technology and DNA probe connection technology, a patterned capture probe spot array can be formed on the surface of the first carrier 1000, that is, Figure 2shown.

[0090] The capture probe is a nucleic acid fragment formed by sequentially connecting a PCR primer sequence 1001, spatial position sequences 1002 and 1003, a unique molecular identification tag sequence 1004, and a nucleic acid capture sequence 1005 from the 5' end to the 3' end.

[0091] In this embodiment, the capture probe parts are set as follows for the sample to be tested:

[0092] PCR primer sequence 1001: CTACACGACGCTCTTCCGATCT;

[0093] Spatial position sequences 1002 and 1003: Specifically, the base sequences may be set to be non-unique, and the purpose is only to mark different position information. In this embodiment, the four bases A, T, G, and C may form a fixed-length sequence by any arrangement and combination, and it is required that the five consecutive bases in the formed sequence cannot be completely the same; specifically, the base sequence lengths of 1002 and 1003 are 34 bases respectively, and the specific sequence setting needs to ensure that the overall sequences of each spatial position sequence 1002 and 1003 are different;

[0094] Unique molecular identification tag sequence 1004: Specifically, the base sequence may be set to be non-unique. In this embodiment, the base sequence is formed by any arrangement and combination of four bases A, T, G, and C, and the base sequence length is controlled to be 8 bases, i.e., NNNNNNNN, so that the tag of each sequence is different;

[0095] Nucleic acid capture sequence 1005: set 30 T bases.

[0096] The spot size formed by the capture probe is 15μm×15μm square, the spacing size between adjacent spots is 15μm, each spot contains tens of thousands of capture probes, and the plane coordinate position of each spot is defined by the spatial position sequence 1002 and 1003. Therefore, it can be understood that one of the spatial position sequences 1002 and 1003 is used to define the X-axis coordinate, and the other sequence defines the Y-axis coordinate. For ease of understanding, it is set here that the spatial position sequence 1002 is used to define the X-axis coordinate, and the spatial position sequence 1003 is used to define the Y-axis coordinate, so the plane coordinate of each spot is (Xi, Yi), where i is a natural number, which can be 0, 1, 2, 3, 4, 5, ..., 50, 60, ..., 90, 96.

[0097] In this embodiment, the OCT-embedded mouse ovary was sliced ​​using a cryostat, and the tissue slice thickness was 10 μm. The slice was then attached to the first carrier, and the target tissue area was located inside the spot array. It was then immediately placed at 37°C for constant temperature heating for 1 minute. The tissue slice was completely immersed in methanol and incubated in a -20°C refrigerator for 30 minutes to achieve tissue fixation.

[0098] Take out the tissue slices, carefully clean the methanol with isopropanol, and air-dry the tissue slices at room temperature. When the transparent color changes to white, it is the best termination time point. Add Hematoxylin solution to the tissue slices, incubate at room temperature for 7 minutes, wash with enzyme-free water 3 times, and then add Bluing Buffer (return to blue solution) and incubate at room temperature for 2 minutes. After washing with enzyme-free water twice, add freshly prepared 10% Eosin Mix (eosin solution) to the tissue slices, incubate at room temperature for 1 minute, then wash with enzyme-free water twice, and centrifuge on a slide centrifuge until there are no visible water droplets on the surface of the first carrier. Heat the first carrier at 37°C for 5 minutes, and use an optical microscope to photograph and record the morphology of the tissue slices.

[0099] In this embodiment, two groups of slices were prepared, respectively, for subsequent experimental group and control group operations, and the results of the ovarian slices of mice in the experimental group and control group were respectively shown in the attached Figure 3-4 To facilitate the subsequent bioinformatics analysis, a 10x objective lens was used for taking photos, and the size of the saved images was no less than 4000*4000 pixels.

[0100] The first vector was loaded into the matching clip and fixed on the vertical rotor of the centrifuge. A 1× pepsin solution prepared with 0.1M hydrochloric acid was carefully added to the tissue slices. The clips were immediately sealed and the centrifuge was leveled. The centrifuge was started and centrifuged at 1000×g for 15 minutes at 25°C to release the intracellular mRNA to the extracellular space and be captured by the capture probe. As a control group, after adding 1× pepsin solution to the tissue slices of the control experiment, the reaction was allowed to stand at 25°C for 15 minutes.

[0101] After the reaction is finished, remove the card, aspirate the solution, and then wash the tissue sections three times with 0.1×SSC buffer. Then add 100 μL of reverse transcription reaction solution (Nuclease-free Water 38 μL, RT Buffer 50 μL, TemplateSwitch Oligo 2 μL, RT Enzyme D 5 μL, RNase Inhibitor 5 μL), seal the card, and place it at 42°C for 2 hours.

[0102] After the reverse transcription reaction is completed, remove the cartridge, aspirate the reaction solution, and wash the tissue sections three times with 0.1×SSC buffer. Add 80mM KOH and incubate at room temperature for 5 minutes, then wash three times with Buer EB, then add 100μL of the second chain reaction solution (Nuclease-free Water 47μL, Second Strand Buffer 40μL, Second Strand Primer 8μL, Second Strand Enzyme 5μL), and after sealing, react according to the temperature conditions described in Table 1 below.

[0103] Table 1 Reaction temperature conditions

[0104] step temperature time 1 37℃ 15min 2 45℃ 15min 3 55℃ 15min 4 65℃ 15min 5 4℃ Hold

[0105] After the reaction, wash with Bu er EB three times, and then dry at room temperature until there is no visible liquid on the tissue slice. Then, add 37 μL 80 mM KOH to the tissue slice and make sure that the KOH solution completely covers the tissue slice, incubate at room temperature for 10 min, completely recover the solution into a centrifuge tube, and add 5 μL Tris-HCl (1 M, pH 7.0) to the tube, mix by pipetting, and set aside.

[0106] Add 50 μL PCR Mix and 10 μL cDNA Primers to the above centrifuge tube, mix well by pipetting, and place on a PCR instrument for reaction. The specific reaction procedure is shown in Table 2 below.

[0107] Table 2 PCR program

[0108] step temperature time 1 98℃ 3min 2 98℃ 20s 3 63℃ 20s 4 72 ℃ 1min 5 Repeat steps 2-4 for 4 rounds Repeat steps 2-4 for 4 rounds 6 72 ℃ 5min 7 4℃ Hold

[0109] After the reaction was completed, the PCR product was purified using 0.8× DNA purification magnetic beads, and the purified magnetic beads were eluted with 41 μL of enzyme-free water to obtain a target DNA solution.

[0110] In order to obtain more target DNA, a qPCR instrument can be used to measure the Cq value of the target DNA solution, and then the target DNA solution can be amplified again by PCR according to the following procedure. The PCR reaction system is: 40 μL of the target DNA solution, 50 μL of PCR Mix and 10 μL of cDNA Primers. The specific reaction procedure is shown in Table 3 below.

[0111] Table 3 PCR program

[0112]

[0113]

[0114] After the reaction was completed, the PCR product was purified using 0.6× DNA purification magnetic beads, and the purified magnetic beads were eluted with 31 μL of enzyme-free water to obtain a DNA solution.

[0115] In order to make the DNA meet the requirements of the second-generation sequencing instrument, the DNA was sheared with a fragmentase, "A" tailed, and connected to a linker, and then PCR amplification was performed according to the following procedure. The specific procedure is shown in Table 4 below.

[0116] Table 4 PCR program

[0117] step temperature 1 98℃ 1min 2 98℃ 20s 3 65℃ 15s 4 72℃ 30s 5 Repeat steps 2-4, number of cycles 11 Repeat steps 2-4, then repeat 11 6 72 ℃ 1min 7 4℃ Hold

[0118] After the amplification reaction is completed, add enzyme-free water to a total volume of 100 μL, and then purify with DNA purification magnetic beads. Specifically: Pipette 60 μL (0.6×) magnetic beads into the centrifuge tube, vortex to mix, and incubate at room temperature for 5 minutes. Briefly centrifuge the centrifuge tube and place it on a magnetic stand to separate the magnetic beads and liquid. After the solution is clarified, carefully transfer the supernatant to a new centrifuge tube and discard the magnetic beads. Pipette 20 μL magnetic beads (0.2×) into the supernatant, mix with a pipette, and incubate at room temperature for 5 minutes. Briefly centrifuge the centrifuge tube and place it on a 0.2mL magnetic stand to separate the magnetic beads and liquid. After the solution is clarified, carefully remove the supernatant. Keep the PCR tube on the magnetic stand at all times, add 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant; repeat once, and rinse with 80% ethanol twice in total. Remove the centrifuge tube from the magnetic rack, centrifuge briefly, and place it on the magnetic rack again. Remove the residual ethanol and open the lid to dry (observe that there is no water light reflection on the surface of the magnetic beads and no cracks). Remove the centrifuge tube from the magnetic rack, add 21μL Bu er EB, vortex and oscillate to mix the magnetic beads, and incubate at room temperature for 2min. Centrifuge the centrifuge tube briefly and place it on the magnetic rack. After the solution is clarified, carefully pipette 20μL of supernatant into a new centrifuge tube, mark it, and perform quality control of the library fragment size (such as Figure 7 or stored in a -20℃ freezer.

[0119] In this embodiment, when the library is sequenced using an Illμmina second-generation sequencer, and the sequencing results are analyzed using a bioinformatics analysis algorithm, the tissue section gene expression statistics and spatial location information are finally obtained.

[0120] like Figure 5 The following is the UMI distribution result of the tissue sections of the experimental group; Figure 6 The following is the UMI distribution result of the tissue sections of the control group. Figure 6 It can be seen that due to the serious free lateral diffusion of mRNA released from the cells, the UMI result map is diffuse, compared with the corresponding HE map (such as Figure 4 The tissue morphology shown in Figure 1 is not clear. Figure 3 and Figure 5 As shown in the figure, due to the vertical centrifugation condition in the experimental group, the longitudinal migration distance of the mRNA released from the cell is much greater than the lateral migration distance, so the lateral free diffusion phenomenon of the mRNA molecules is improved, and the final UMI result has a clear tissue morphology structure, so it can more truly reflect the spatial information of gene expression in tissue sections.

[0121] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A method for detecting spatial information of a biological sample, characterized in that: The steps include: (1) preparing a tissue slice from a sample to be tested and placing it on the surface of a first carrier with a capture probe to obtain two-dimensional contour information of the tissue slice; (2) continuing to drip the permeabilization reaction solution onto the tissue slice, and centrifuging the sealed tissue slice, so that the intracellular substances in the sample to be tested migrate to the surface and are captured by the capture probe; (3) When the intracellular substance is nucleic acid, the reaction products are collected and subjected to a series of amplification reactions to convert the captured nucleic acid into library DNA that can be used for sequencing, and then sequenced and analyzed for data to obtain the result; or, (3') When the intracellular substance is protein, the reaction product is collected for analysis and detection.

2. The biological sample spatial information detection method according to claim 1, characterized in that: In the step (1), the step of obtaining the two-dimensional contour information includes dyeing or taking pictures.

3. The biological sample spatial information detection method according to claim 1 or 2, characterized in that: In the step (1), the capture probe is directly or indirectly bound to the first carrier in sequence; Preferably, the capture probe is connected to the surface of the first carrier by chemical coupling; Preferably, the capture probe forms a capture probe sopt spot array on the surface of the first carrier; Preferably, each spot on the sopt spot array is composed of capture probes with the same spatial position sequence; Preferably, the spot includes a square or a circle; Preferably, the first carrier comprises glass or plastic.

4. The biological sample spatial information detection method according to any one of claims 1 to 3, characterized in that: The intracellular material is selected from nucleic acids; The capture probe comprises a nucleic acid fragment containing at least a spatial position sequence and a nucleic acid capture sequence; Preferably, the capture probe comprises a nucleic acid fragment containing at least a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence; Preferably, the capture probe comprises a nucleic acid fragment formed by sequentially connecting a PCR primer sequence, a spatial position sequence, a unique molecular identification tag sequence, and a nucleic acid capture sequence from the 5' end to the 3' end; Preferably, the nucleic acid capture sequence includes a sequence containing multiple T bases, and captures mRNA or mRNA reaction products containing multiple A bases released from cells by base complementary pairing.

5. The biological sample spatial information detection method according to any one of claims 1 to 3, characterized in that: The intracellular substance is selected from proteins; The capture probe includes a nucleic acid segment modified by a second protein; Preferably, the second protein includes a protein that can recognize and capture the intracellular substance through antigen-antibody interaction.

6. The biological sample spatial information detection method according to any one of claims 1 to 5, characterized in that: In the step (2), the permeabilization reaction solution comprises a mixture of one or more of enzyme-free water, hydrochloric acid, Triton X-100, Tween-20, protein digestion enzyme, and tissue removal enzyme; Preferably, the permeabilization reaction solution comprises 0.01-0.02M hydrochloric acid solution; Preferably, the permeabilization reaction solution includes a proteinase K solution.

7. The biological sample spatial information detection method according to any one of claims 1 to 6, characterized in that: In the step (2), in the centrifugation step: The centrifugation speed is 100-4000×g; and / or, The centrifugation time is 5-50 min; and / or, The centrifugation temperature is 4-37°C.

8. The biological sample spatial information detection method according to any one of claims 1 to 7, characterized in that: In the step (3): the series of amplification reactions comprises: Reverse transcription is performed on the captured nucleic acid to form cDNA using a reverse transcription reaction solution; Amplifying the cDNA by second-strand reaction solution to obtain a complementary DNA strand; PCR amplification was performed using PCR reaction solution, and DNA was purified to obtain a next-generation sequencing library; Preferably, the reverse transcription reaction solution contains at least enzyme-free water, dNTP, reverse transcriptase, primers, and salt ions; Preferably, the second chain reaction solution contains at least enzyme-free water, dNTP, second chain synthetase, primers, and salt ions; Preferably, the PCR reaction solution contains at least enzyme-free water, dNTP, PCR amplification enzyme, primers, and salt ions; Preferably, it further comprises the steps of adding a cleaning solution to remove the nucleic acid and / or adding a cleaning solution to elute the complementary DNA chain; Preferably, the cleaning solution comprises a mixture of one or more of PBS, SSC, PBS containing Tween-20, SSC containing RNase inhibitor, NaOH solution or KOH solution; Preferably, the data analysis uses a bioinformatics analysis algorithm to process the sequencing data.

9. The biological sample spatial information detection method according to any one of claims 1 to 8, characterized in that: In the step (3'), the analysis and detection step includes fluorescence technology, chemiluminescence technology, and electrochemical technology.

10. Application of the biological sample spatial information detection method according to any one of claims 1 to 9 in the field of genetic engineering.

Images