Primers, reagents and kits for MEST gene methylation detection

Abstract

The present invention provides primers, reagents and kits for detecting MEST gene methylation, all of which involve two pairs of primers for detecting MEST gene methylation, and the sequences are shown in SEQ ID NO: 1-4. The present invention only requires a small amount of DNA to complete the detection, the detection process is short in time, low in cost, and high in accuracy, and can realize the monitoring of late-stage risks of infants and young children conceived by ART, with an accuracy rate of up to 99%.

Description

Technical Field

[0001] The present invention relates to the fields of epigenetics and nucleic acid detection, and in particular to primers, reagents and kits for detecting methylation of MEST genes. Background Art

[0002] In recent years, the number of offspring conceived through assisted reproductive technology (ART) has increased dramatically, with more than 5 million children born to date. ART includes a variety of procedures, ranging from mild interventions, such as hormone therapy, to invasive procedures such as in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI). Although ART techniques are largely considered harmless, the safety of the procedures has received great attention. Although the vast majority of babies born through ART are healthy, the use of ART has also been associated with a variety of adverse health risks, including obstetric complications and adverse perinatal risks, such as low birth rate and preterm birth, as well as subsequent cardiovascular risks and metabolic dysfunction. In addition, it has been reported that offspring conceived through ART have an increased risk of rare imprinting diseases, such as Beckwith-Wiedemann syndrome (BWS), Silver-Russell syndrome (SRS), Angelman syndrome (AS), and Prader-Willi syndrome (PWS), compared with natural conception, thus raising concerns about potential epigenetic dysregulation in the context of ART.

[0003] Epigenetics refers to the process by which cells acquire heritable genetic variations during mitosis or meiosis due to external factors such as the external environment, which are not caused by changes in the original DNA sequence. During conception through assisted reproductive technology (ART), the genome is particularly susceptible to environmental factors. In mammals, epigenetic mechanisms include DNA methylation, post-translational modification of histones (called the "histone code"), long non-coding RNAs and microRNAs. These different but interrelated marks help to establish and maintain specific gene expression patterns that determine cell identity and can regulate the stable inheritance of cellular memory during mitosis. DNA methylation and post-translational histone modifications change the accessibility and packaging of chromatin, allowing gene activation or repression. DNA methylation, in which a methyl group (-CH3) is added to unmethylated cytosine in cytosine-guanine (CpG) dinucleotides, is a major covalent modification of DNA and the most widely studied epigenetic mark.

[0004] The mesoderm-specific transcript (Mest) gene is located on human chromosome 7q32. It is a paternally expressed imprinted gene that is strongly expressed in many embryonic tissues. An imprinted gene refers to a homologous gene that is expressed from only one parent, but not from the other parent. Imprinted genes are very important for fetal growth, development and behavior, especially the development of the placenta. Abnormal expression of imprinted genes usually leads to the occurrence of many diseases. The MEST gene is the earliest imprinted gene found on human chromosome 7. It is about 13kb long and has a CpG-rich region of about 620bp at its 5' end, extending from the putative promoter region to the first exon including part of the intron. The CpG region is parentally imprinted, with the mother showing a methylated modified imprint and the father showing a non-methylated expression state. In fetal tissues, MEST is expressed as a paternal allele, while in adult lymphocytes, it is expressed as a biallelic gene. The biological function of the MEST gene is still unclear, but its hydrolysis product is highly related to the α / β hydrolase fold family, and it is speculated that it may have hydrolase activity and regulate the development of the mesoderm.

[0005] In fact, the MEST gene is expressed in most fetal organs, tissues, and placenta, indicating that it plays a vital role in placental and fetal growth. During the ART process, Sato et al. observed that superovulated oocytes had abnormal demethylation of the MEST gene DNA, indicating that the DNA methylation of MEST was directly inherited from the oocyte. It was reported that an SR patient conceived in vitro had imprinting loss in the MEST gene. In addition, the loss of MEST imprinted genes was found in different types of human cancers (such as colorectal cancer and breast cancer). These observations indicate the need for long-term monitoring of MEST DNA differential methylation in children conceived by ART. Summary of the invention

[0006] In view of the shortcomings of the prior art, the primers, reagents and kit for MEST methylation detection provided by the present invention can realize such monitoring quickly, simply and economically, so as to timely discover and correct abnormalities.

[0007] The invention provides primers for detecting MEST gene methylation, including primer pairs M and C, wherein the primer pair M consists of a forward primer and a reverse primer shown in SEQ ID NO: 1-2; and the primer pair C consists of a forward primer and a reverse primer shown in SEQ ID NO: 3-4.

[0008] The present invention also provides a reagent for detecting MEST gene methylation, the reagent comprising primer pairs M and C, the primer pair M consisting of a forward primer and a reverse primer as shown in SEQ ID NO: 1-2; the primer pair C consisting of a forward primer and a reverse primer as shown in SEQ ID NO: 3-4.

[0009] The present invention also provides a kit for detecting MEST gene methylation, the reagent comprising primer pairs M and C, the primer pair M consisting of a forward primer and a reverse primer as shown in SEQ ID NO: 1-2; the primer pair C consisting of a forward primer and a reverse primer as shown in SEQ ID NO: 3-4.

[0010] Furthermore, the kit also includes a DNA sulfidation reagent. Furthermore, the DNA sulfidation reagent is a reagent based on sulfite conversion.

[0011] The present invention also provides a method for detecting MEST gene methylation based on MS-PCR technology, which comprises: extracting sample DNA (the sample may be blood, fresh tissue, paraffin section or free plasma DNA, etc.), performing DNA sulfidation, purifying the sulfided DNA and using it as a template, performing PCR reaction using primer pair M and primer pair C, performing gel electrophoresis on the product, and interpreting the result according to the size of the band.

[0012] Furthermore, DNA sulfide modification can be performed on the extracted DNA using QIAGEN's DNA sulfide kit (EpiTect Bisulfite Kit, 59104).

[0013] Compared with the prior art, the present invention has at least the following advantages: 1) The accuracy of the present invention can reach more than 99%; 2) The present invention only needs a small amount of DNA to complete the detection, the detection process is short, the equipment requirements are simple, and abnormalities can be quickly screened and discovered; 3) The present invention optimizes the primer sequence and synergistically improves the PCR reaction system and reaction procedure, which can effectively reduce the false positives and false negatives caused by nonspecific amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The results are as follows: 10 placental tissue samples from normal pregnancies and deliveries were tested using the method of Example 2, wherein the upper half is the 442 bp product amplified by the non-methylated primer pair C, and the lower half is the amplification by the methylated primer pair M.

[0015] Figure 2 The results are as follows: 10 placental tissue samples of ART conception and normal delivery were tested according to the method of Example 2, wherein the upper half is the 442 bp product amplified by the non-methylated primer pair C, and the lower half is the 408 bp product amplified by the methylated primer pair M.

[0016] Figure 3 It shows the amplification results using different concentrations of post-sulfurization products as templates. The upper part is the amplification product of the non-methylated primer pair C, and the lower part is the amplification product of the methylated primer pair M.

[0017] Figure 4 This is a specific test. The placenta tissue samples of 10 cases of normal pregnancy and delivery were tested according to the method of Example 2. The upper part is the 442bp product amplified by the non-methylated primer pair C, and the lower part is the amplification by the methylated primer pair M.

[0018] Figure 5 This is a test chart of the optimal reaction temperature of the primer, where 50°C is the optimal temperature. DETAILED DESCRIPTION

[0019] The following examples are used to illustrate the method, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are based on conventional experimental conditions, such as the molecular cloning experimental manual of Samdrook, etc. or the conditions recommended by the manufacturer's instructions.

[0020] Example 1 Design and synthesis of primers for detecting methylation of MEST gene

[0021] MethPrimer software was used to analyze the CpG island of the MEST gene, and then primers were designed based on the following three sequences: 1) The original sequences targeting the promoter and first exon of the MEST gene are as follows:

[0022] ggtctgctgtttttgcccgtggccttaactcatcaggggagggtttctgcagcagaatctcgggctcagggttggcggttaacgagggagcag

[0023] cggggtcttggggagggggctcgacacccctgaaggtgccccctaaaggagccactgttagaggggcaccccatctttgtggccatggcg

[0024] gtggtagagcggctgggaggggctctgcggcgagcaagggagcaggcggtaggggttctgcggcgatgggcgggctaggggcggggc

[0025] gcgggtgggctctaaaagtcggtgcccactcgctccgcgcTGCCGCGGCAACCAGCACACCCCGGCACCTCC

[0026] TCTGCGGCAGCTGCGCCTCGCAAGCGCAGTGCCGCAGCGCACGCCGGAGTGGCTGTA

[0027] GCTGCCCGGCGCGGCGCCGCCCTGCGCGGGCTGTGGGCTGCGGGCTGCGCCCCCGCT

[0028] GCTGGCCAGCTCTGCACGGCTGCGGGCTCTGCGGCGCCCGGTGCTCTGCAACGCTGC

[0029] GGCGGGCGGCATGGGATAACGCGGCCATGGTGCGCCGAGATCGCCTCCGCAGAACGC

[0030] GGCCATGGTGCGCCGAGATCGCCTCCGCAGGTGAGTGTGCGGTGGGAACGAGGGGGTGT(SEQ IDNO:5);

[0031] 2) Assuming that none of the Cs at all CG sites are methylated, the bisulfite-converted sequence is as follows: ggtTtgTtgtttttgTTTgtggTTttaaTtTatTaggggagggtttTtgTagTagaatTtTgggTtTagggttggTggttaaTgagggagTagTggggtTttggggagggggTtTgaTaTTTTtgaaggtgTTTTTtaaaggagTTaTtgttagaggggTaTTTTatTtttgtggTTatggTggtggtagagTggTtgggaggggTtTtgTggTgagTaagggagTaggTggtaggggttTtgTggTgatgggTgggTtaggggTggggTgTgggtgggTtTtaaaagtTggtgTTTaTtTgTtTTgTgTTGTTGTGGTAATTAGTATATTTTGGTATTTTTTTTGTGGTAGTTGTGTTTTGTAAGTGTAGTGTTGTAGTGTATGTTGGAGTGGTTGTAGTTGTTTGGTGTGGTGTTGTTTTGTGTGGGTTGTGGGTTGTGGGTTGTGTTTTTGTTGTTGGTTAGTTTTGTATGGTTGTGGGTTTTGTGGTGTTTGGTGTTTTGTAATGTTGTGGTGGGTGGTATGGGATAATGTGGTTATGGTGTGTTGAGATTGTTTTTGTAGAATGTGGTTATGGTGTGTTGAGATTGTTTTTGTAGGTGAGTGTGTGGTGGGAATGAGGGGGTGT(SEQ ID NO:6);

[0032] 3) Assuming that all CG sites are methylated, the bisulfite-converted sequence is as follows:

[0033] ggtTtgTtgtttttgTTCGtggTTttaaTtTatTaggggagggtttTtgTagTagaatTtCGggTtTagggttggCGgttaaCGa

[0034] gggagTagCGgggtTttggggagggggTtCGaTaTTTTtgaaggtgTTTTTtaaaggagTTaTtgttagaggggTaTT

[0035] TTatTtttgtggTTatggCGgtggtagagCGgTtgggaggggTtTtgCGgCGagTaagggagTaggCGgtaggggttTtg

[0036] CGgCGatgggCGggTtaggggCGgggCGCGggtgggTtTtaaaagtCGgtgTTTaTtCGTtTCGCGTTGTC

[0037] GCGGTAATTAGTATATTTCGGTATTTTTTTTGCGGTAGTTGCGTTTCGTAAGCGTAGTGT

[0038] CGTAGCGTACGTCGGAGTGGTTGTAGTTGTTCGGCGCGGCGTCGTTTTGCGCGGGTTG

[0039] TGGGTTGCGGGTTGCGTTTTCGTTGTTGGTTAGTTTTGTACGGTTGCGGGTTTTGCGG

[0040] CGTTCGGTGTTTTGTAACGTTGCGGCGGGCGGTATGGGATAACGCGGTTATGGTGCGT

[0041] CGAGATCGTTTTCGTAGAACGCGGTTATGGTGCGTCGAGATCGTTTTCGTAGGTGAGTGTGCGGTGGGAACGAGGGGGTGT(SEQ ID NO:7);

[0042] The designed methylation and non-methylation amplification primers are as follows:

[0043] Primer pair M: F: GGTATTTTATTTTTGTGGTTATGGC(SEQ ID NO:1);

[0044] R: CTACGAAAACGATCTCGACG(SEQ ID NO:2)

[0045] Primer pair C: F: TATTTTATTTTTGTGGTTATGGTGG(SEQ ID NO:3);

[0046] R: CCTACAAAAACAATCTCAACACA(SEQ ID NO:4).

[0047] Example 2 Establishment of MEST gene methylation detection method based on MS-PCR technology

[0048] A MEST gene methylation detection method is established based on MS-PCR technology. The method includes: extracting sample DNA (the sample can be blood, fresh tissue, paraffin section or free plasma DNA, etc.), performing DNA sulfidation, purifying the sulfided DNA and using it as a template, performing PCR reaction using primer pair M and primer pair C in Example 1, performing gel electrophoresis on the product, and interpreting the result according to the size of the band.

[0049] DNA sulfide modification can be performed on the extracted DNA using QIAGEN's DNA sulfide kit (EpiTect Bisulfite Kit, 59104).

[0050] The specific method for purification of the extracted DNA after sulfurization is as follows:

[0051] a. Transfer the sulfurized sample to a 1.5 ml EP tube, add 1 ml of buffer GDF and 40 μl of magnetic bead suspension (mix thoroughly before use), vortex and mix for 10 seconds, and let stand at room temperature for 5 minutes;

[0052] b. Centrifuge instantly and place the centrifuge tube on the magnetic rack for 1 minute. After the magnetic beads are completely adsorbed, carefully remove the liquid.

[0053] c. Add 600 μl PWG buffer and oscillate for 10 seconds;

[0054] d. Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, carefully remove the liquid;

[0055] e. Add 600 μl of buffer DB, shake and mix for 10 seconds, and let stand at room temperature for 15 minutes;

[0056] f. Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, carefully remove the liquid;

[0057] g. Add 600 μl PWG buffer and oscillate for 10 seconds;

[0058] h. Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, carefully remove the liquid;

[0059] i. Repeat the above buffer PWG washing once;

[0060] j. Briefly centrifuge to collect the remaining liquid at the bottom of the tube and remove as much liquid as possible;

[0061] k. Dry at room temperature for 3-5 minutes until no liquid remains;

[0062] l. Add 35 μl of elution buffer TBC, mix by pipetting repeatedly, and leave at room temperature for 3 min;

[0063] m. Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes, then transfer the liquid to the corresponding centrifuge tube. The result is the sulfurized DNA product.

[0064] The quality control method is as follows: Use NanoDrop2000 to measure the purified DNA, the purification recovery efficiency should be greater than 80%; if the recovery efficiency is not 80%, the purification recovery step should be repeated.

[0065] The PCR reaction program used is shown in the following table:

[0066]

[0067] The electrophoresis test used 2% agarose gel at 120V for 30min. The electrophoresis interpretation was as follows:

[0068] Complete methylation: only primer pair M band appears;

[0069] No methylation: only primer pair C band appears;

[0070] Partial methylation: Bands appear with both primer pair M and primer pair C.

[0071] Example 3 Accuracy of the detection method and primers of the present invention

[0072] 10 placenta specimens of normal pregnancy and normal delivery were selected, and 10 placenta specimens of normal delivery by ART pregnancy were selected. The 20 samples were tested according to the method of Example 2. The test results are shown in the table below. The specific results are shown in Figure 1 and Figure 2 .

[0073]

[0074]

[0075] From the above results, it can be seen that the detection results of the primers and detection system of the present invention are completely consistent with QPCR, and all results are completely in line with expectations, with an accuracy of 100%.

[0076] Example 4 Sensitivity of the detection primers and detection methods of the present invention

[0077] This method uses the concentration of the sulfurized DNA template to determine the sensitivity of the detection primer and the detection system. The concentrations of the sulfurized DNA are 40 ng / μl, 10 ng / μl, 1 ng / μl, 0.1 ng / μl and 0.01 ng / μl, respectively. The final result of electrophoresis is a negative sample. For details, see Figure 3 When the DNA template concentration is lower than 1 ng / μl, this method cannot amplify any identifiable bands. As long as the DNA template concentration is not lower than 1 ng / μl, the detection purpose can be achieved.

[0078] Example 5 Specificity of the detection method and detection primers of the present invention

[0079] The specificity of this example is defined as the negative coincidence rate. 10 placenta samples from normal pregnancy and normal delivery were selected to test the methylation status using the method of Example 2. The test results are shown in the following table. Figure 4 :

[0080]

[0081]

[0082] From the above results, it can be seen that the normal pregnancy samples detected by the method of the present invention all showed methylation negative, indicating that the specificity of the detection primers of the present invention is 100%.

[0083] Example 6 Design and optimization of primers for MEST gene methylation

[0084] For CpG islands of known genes, due to the special situation of high GC content, it is very easy to judge using biological software. For example, using MethPrimer to judge its CpG island, the software defaults to a CpG island span of at least 200bp, a GC content greater than 50%, and a CpG frequency of >0.6. Therefore, regions that meet these parameters are defaulted to CpG islands, and in principle, primers can be designed for amplification based on any CpG position. However, since methylation modification can cause the failure of protein function, it is generally at the promoter position. If the modification of this position encodes the protein promoter, it will change the translation of the entire protein and is more likely to cause protein failure.

[0085] When designing primers, in order to distinguish methylation from non-methylation to the greatest extent, the primer sequence should contain as many CpG sites as possible. And the 3' end of the methylation and non-methylation primer sequences should be at the same CpG site. If the two pairs of primers do not anneal at the same CpG site, the PCR results cannot accurately reflect the methylation of the sample DNA. However, methylation and non-methylation primers can span different lengths and can also be different in starting site and length.

[0086] Example 7 Optimization of MEST gene methylation reaction system and reaction conditions

[0087] Due to the large number of CG positions in CpG primers, the recommended primer Tm is generally very high, above 69°C; however, in actual experiments, the Tm is often adjusted to around 50°C, otherwise amplification will not be achieved. Therefore, after the primers are designed, a temperature gradient experiment will be conducted to determine the optimal reaction Tm. The specific results of this experiment are shown in Figure 5 .Depend on Figure 5 It can be seen that the optimal temperature is 50°C.

[0088] In addition, due to the high CG content in the methylation amplification process, the buffer used by ordinary enzymes cannot achieve good results, and MgCl needs to be added to the PCR reaction solution. 2 The content can achieve the best effect. The present invention increases Mg 2+ The concentration of the ion was adjusted to reach a final concentration of 2 mM in a 25 μl PCR reaction system.

Claims

1. Primers for detecting methylation of MEST gene, characterized in that: It comprises primer pair M and C, wherein primer pair M is composed of a forward primer and a reverse primer as shown in SEQ ID NO: 1-2; and primer pair C is composed of a forward primer and a reverse primer as shown in SEQ ID NO: 3-4.

2. A reagent for detecting MEST gene methylation, characterized in that: The reagents include primer pairs M and C, wherein the primer pair M consists of a forward primer and a reverse primer as shown in SEQ ID NO: 1-2; and the primer pair C consists of a forward primer and a reverse primer as shown in SEQ ID NO: 3-4.

3. A kit for detecting MEST gene methylation, the kit being used for detecting a PCR reaction solution for MEST gene methylation, characterized in that: The PCR reaction solution includes primer pairs M and C, wherein primer pair M consists of a forward primer and a reverse primer as shown in SEQ ID NO: 1-2; and primer pair C consists of a forward primer and a reverse primer as shown in SEQ ID NO: 3-4.

4. The kit according to claim 3, characterized in that The Mg content of the PCR reaction solution 2+ The concentration is 2mM.

5. The kit according to claim 3, characterized in that The kit also includes a DNA sulfurization reagent.

6. The kit according to claim 5, characterized in that The DNA sulfidation reagent is a reagent based on sulfite conversion.

Images