A quenching probe for detecting serum amyloid protein A1 genotype and its application

Abstract

The present invention discloses a quenching probe and its application in SAA1 gene detection; specifically, a method and a corresponding kit for detecting two gene polymorphic sites related to SAA1 genotype in one reaction by using nested PCR technology and multi-channel quenching probe technology. The present invention detects SAA1 genotype by combining specific SAA1 nested PCR and SNP-targeted QP, providing a powerful tool for research and future clinical applications.

Description

[0001] This application is a divisional application of a patent application entitled "Detection method and kit for serum amyloid A1 genotype based on quenching probe". The filing date of the original application is December 17, 2020, and the application number is CN202011495980.9. Technical Field

[0002] The invention belongs to the field of gene technology and relates to a method for detecting serum amyloid A1 (SAA1) genotype based on a quenching probe (QP), comprising a kit for clinical application. Background Art

[0003] Human serum amyloid A1 (SAA1) is an acute phase response protein composed of 104 amino acids. Its molecular weight in the natural state is about 12-14kDa, and its encoding gene is located on human chromosome 11. Early studies believed that SAA1 is an acute inflammatory protein because the concentration of SAA1 in the blood can increase by 100-1000 times in acute inflammation. In addition, SAA1 can bind to high-density lipoprotein (HDL) under physiological conditions, and its level increases during inflammation by regulating HDL metabolism. However, a large number of studies in recent years have shown that SAA1 is no longer just an acute phase inflammatory protein in the traditional sense, but as a natural innate immune regulator, SAA1 can interact with inflammatory cytokines such as IL-6 and TNF-a, and participate in regulating the body's innate and acquired immunity. For example, it has been found that SAA1 plays an important role in the occurrence and development of chronic inflammatory diseases and autoimmune diseases such as diabetes, coronary heart disease, and rheumatoid arthritis (RA).

[0004] Genetic polymorphism refers to the existence of two or more discontinuous variants or genotypes or alleles in a biological population, also known as genetic polymorphism or genetic polymorphism. Single Nucleotide Polymorphism (SNP) refers to the difference in a single base within a gene sequence, including the deletion, insertion and substitution of a single base. Human genetic polymorphism is closely related to the occurrence, diagnosis and treatment of diseases. The changes in polymorphism play an important role not only in clarifying the body's susceptibility and tolerance to diseases and drugs, the diversity of clinical manifestations of diseases, as well as the responsiveness to drug treatment and predicting outcomes. Through the study of genetic polymorphism, the essence of the differences in the functions and effects of bioactive substances between individuals can be revealed at the genetic level. Therefore, genetic polymorphism research has become a new field of clinical medicine and preventive medicine research.

[0005] At present, due to two SNP sites in the third exon of SAA1 (rs1136743 and rs1136747), three SAA1 alleles α, β and γ are formed, forming a total of 6 genotypes: α+ / +, β+ / +, γ+ / +, αβ, αγ and βγ. Studies have shown that the proportion of different SAA1 genotypes in the population is different. For example, Yamada et al. studied the SAA1 genotypes of 321 Japanese and found that the distribution frequencies of the three alleles SAA1α, SAA1β and SAA1γ in Japanese were 0.310, 0.347 and 0.330, respectively. Ishii et al. found that among 127 RA patients, the most common genotype of those with amyloidosis was SAA1γ+ / +, and the appearance of amyloid deposits was also highly correlated with the gene frequency of SAA1γ. In Caucasians, amyloidosis is positively correlated with the frequency of the SAA1α allele. It has been reported that the incidence of SAA1α+ / + type in patients with Mediterranean hemorrhagic fever is 7 times that of other types. Lung et al. found that SAA1 genotype is significantly associated with a higher risk of NPC (nasopharyngeal carcinoma), and the frequency of β+ / + genotype in NPC patients is 2 times higher than that in healthy individuals.

[0006] At present, the commonly used methods for SAA1 genotype research are restriction endonuclease fragment length detection (RFLP), polymerase chain reaction direct sequencing (PCR direct sequencing) and allele-specific PCR (allele-specific PCR). However, most of the methods are cumbersome and complicated, and it is not easy to carry out large-scale SNP analysis. And because of the high homology of SAA1 and SAA2 genes, how to effectively eliminate the interference of SAA2 while detecting the genotype of SAA1 is also a challenge faced by SAA1 genotype detection. Therefore, the development of a simple and reliable SAA1 genotype detection method has important clinical significance for the diagnosis and risk analysis of SAA1 genotype-related diseases. Summary of the invention

[0007] In view of the defects of the prior art, the purpose of the present invention is to provide a kit for detecting SNP sites of the SAA1 gene to determine the genotype; specifically, a method and a corresponding kit for completing the detection of two gene polymorphic sites related to the SAA1 genotype in one reaction using nested PCR technology and multi-channel quenching probe technology.

[0008] The use of quenching probes (QP) is very effective in detecting SNPs of target genes. By adding a specific primer set, a gene amplification reaction is generated, and then the arrangement of a specific gene is quickly and easily detected using a fluorescence method using QP. The present invention detects SAA1 genotypes by combining specific SAA1 nested PCR and QP for SNPs, providing a powerful tool for research and future clinical applications.

[0009] The present invention provides a quenching probe, the nucleotide sequence of which is shown in SEQ ID NO.5 and SEQ ID NO.6:

[0010] CCAGACACCCCCAGGTC(SEQ ID NO.5)

[0011] CTGATCACTTCTGCAGC (SEQ ID NO. 6).

[0012] The present invention also provides a primer sequence, the primer sequence comprising:

[0013] Specific amplification primer sequences:

[0014] TGGGAGGTGGAGGTTGCGATG(SEQ ID NO.1)

[0015] AGGAAGGAGGGATGAAAACACTGGG(SEQ ID NO.2)

[0016] Specific nested primer sequences:

[0017] GGAACTATGATGCTGCCAAAA(SEQ ID NO.3)

[0018] GCTCGTCTCCCTCCTGACTG(SEQ ID NO.4)

[0019] The present invention also provides an amplification system, which comprises:

[0020] PCR primer mixture; PCR nested primer mixture; quenching probe mixture; PCR reaction solution; template; ddH 2O.

[0021] Wherein, the PCR primer mixture: SAA1 forward primer, SAA1 reverse primer, and the primer sequences thereof are shown in SEQ ID NO.1 and SEQ ID NO.2; the final concentration of the PCR primer mixture is 0.01-0.2 μM; preferably, it is 0.02 μM.

[0022] Wherein, the PCR nested primer mixture: nested forward primer, nested reverse primer, and its primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; the final concentration of the PCR nested primer mixture is 0.01-1.0 μM; preferably, it is 0.2 μM or 0.6 μM.

[0023] Wherein, the quenching probe mixture: QP1-FAM: rs1136743, QP1-TMARA: rs1136747, and its primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6; the final concentration of the quenching probe mixture is 0.01-1.0 μM; preferably, it is 0.6 μM.

[0024] Wherein, the PCR reaction solution includes: PCR buffer, Taq enzyme, dNTPs and Mg 2+; the volume of the PCR reaction solution is 7.0-10.0 μL; preferably, it is 10.0 μL.

[0025] The PCR reaction solution specifically refers to a solution prepared by PCR buffer, Taq enzyme, dNTPs, Mg 2+ and ddH 2O.

[0026] The usage amount of the Taq enzyme is 0.1-2.0U; preferably, 2.0U.

[0027] The final concentration of the dNTPs in the PCR reaction solution (PCR system) is 0.02-1.0 μM; preferably, 0.2 μM.

[0028] The final concentration of the Mg 2+ in the PCR reaction solution (PCR system) is 1.0-4.0 μM; preferably, 2.5 μM.

[0029] Wherein, the template: positive control or negative control or genomic DNA; the volume of the template is 0.2-5.0 μL; preferably, 1 μL.

[0030] The positive control specifically refers to the human genome products amplified using SEQ ID NO.1 and SEQ ID NO.2 and cloned into pMD TM 19-T vector (or pMD TM 18-T vector) (SAA1α+ / +, SAA1β+ / + and SAA1γ+ / + samples are used as amplification templates, respectively).

[0031] The negative control specifically refers to the self-ligation product of the pMD™19-T vector (or pMD™18-T vector).

[0032] The genomic DNA specifically refers to human genomic deoxyribonucleic acid obtained from whole blood samples or tissues of normal persons or patients using molecular biology extraction methods.

[0033] The present invention also provides a kit, which includes the quenching probe and / or primer sequence, a sample processing solution, the amplification system, a positive control, and a negative control.

[0034] Wherein, the sample processing solution is whole blood PCR lysis solution, which is ddH2O or TE or NaOH solution.

[0035] The positive control refers to the human genome product amplified by SEQ ID NO.1 and SEQ ID NO.2 cloned in pMD TM 19-T vector (or pMD TM 18-T vector) (SAA1α+ / +, SAA1β+ / + and SAA1γ+ / + samples are used as amplification templates respectively). There are three types of positive controls: α+ / +, β+ / +, and γ+ / +.

[0036] The negative control refers to the self-ligation product of the pMD TM 19-T vector (or pMD TM 18-T vector).

[0037] The present invention also provides the use of the quenching probe, or primer sequence, or kit, or amplification system in preparing reagents for SNP site detection, SAA1 genotype detection, and gene polymorphism.

[0038] The sites are rs1136743 and rs1136747.

[0039] The present invention also provides the use of the quenching probe, or primer sequence, or kit, or amplification system in the prediction of clinical disease risk based on SAA1 genotype or gene polymorphism.

[0040] The present invention also provides the use of the quenching probe, or primer sequence, or kit, or amplification system in the prevention / diagnosis / treatment of diseases associated with SAA1 genotype or gene polymorphism.

[0041] The diseases include chronic inflammatory diseases and autoimmune diseases such as diabetes, coronary heart disease, rheumatoid arthritis (RA), as well as amyloid lesions, Mediterranean hemorrhagic fever, nasopharyngeal carcinoma and other diseases.

[0042] Among them, the autoimmune diseases include rheumatoid arthritis, ankylosing spondylitis, sarcoidosis, Crohn's disease, ulcerative colitis, etc.

[0043] The quenching probe is used in combination with a specific nested PCR in the application.

[0044] The present invention also provides an amplification method, using an (exo-)DNA polymerase (NEB) amplification system, and performing amplification on a Roche Light Cycler 480 II PCR instrument according to the amplification system shown above.

[0045] Among them, the nested PCR reaction conditions were: 95°C, 5 min→8 cycles (95°C, 15 s; 64°C, 15 s; 72°C, 1 min)→50 cycles (95°C, 10 s; 60°C, 10 s; 72°C, 15 s).

[0046] The present invention also provides a method for detecting SAA1 genotype based on a quenching probe, the method comprising the following steps:

[0047] (1) synthesizing the primers and probes as described above;

[0048] (2) Use QIAamp DNA BloodMini kit to extract DNA from whole blood or tissue samples, determine its concentration, identify its quality by OD260 / 280 and OD260 / 230, and dilute qualified samples with ddH2O to 10-20 ng / μL;

[0049] (3) Prepare the corresponding amplification system according to Table 3, and run it according to the following program settings: 95°C, 5 min→8 cycles (95°C, 15 s; 64°C, 15 s; 72°C, 1 min)→50 cycles (95°C, 10 s; 60°C, 10 s; 72°C, 15 s)→melting curve fluorescence analysis {40°C, 1 min→85°C, 10 s (collect 3 fluorescence signal points per degree Celsius)}.

[0050] Result determination: The corresponding base type of the SNP site is determined according to the melting temperature (Tm) corresponding to the peak of fluorescence change in the melting curve. Since the two quenching probes completely match the T base, if the corresponding SNP site is a T base, a relatively high Tm peak should be detected, while a C base should be detected to obtain a relatively low Tm peak. The corresponding Tm and peak type diagrams obtained by the detection of the specific 6 SAA1 genotypes are detailed in Table 4 and Figure 1 .

[0051] The present invention also provides application of the detection method in SAA1 genotype detection.

[0052] The beneficial effects of the present invention are as follows: the present invention provides a simple and reliable SAA1 genotype detection method, which has important clinical significance for the diagnosis and risk analysis of SAA1 genotype-related diseases. The present invention detects the SAA1 genotype by combining specific SAA1 nested PCR and QP for SNP, providing a powerful tool for research and future clinical applications. The method provided by the present invention realizes detection in a closed system and avoids the risk of product contamination; the simultaneous detection of two SNP sites in the same system can avoid the waste of reagents and templates, which is particularly important for special case medical samples with limited sources; the use of two-color fluorescence effectively avoids the drift of the melting curve caused by the slight change of the salt concentration of the amplification system, which leads to misjudgment of the results. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Results obtained using the quenched probe method for the six SAA1 genotypes. DETAILED DESCRIPTION

[0054] The present invention is further described in detail in conjunction with the following specific embodiments and drawings, and the protection content of the present invention is not limited to the following embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

[0055] The experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer.

[0056] Example 1: Design and synthesis of primers and probes

[0057] For the gene polymorphism sites of rs1136743 and rs1136747 of the SAA1 gene related to the SAA1 genotype, the corresponding SAA1 gene specific amplification primer sequences (SEQ ID No: 1 and SEQ ID No: 2) and specific nested primers (SEQ ID No: 3 to SEQ ID No: 4) were designed, as shown in Table 1:

[0058] Table 1

[0059] serial number Sequence (5'-3') use SEQ ID No: 1 TGGGAGGTGGAGGTTGCGATG SAA1 forward primer SEQ ID No: 2 AGGAAGGAGGGATGAAAACACTGGG SAA1 reverse primer, sequencing primer SEQ ID No: 3 GGAACTATGATGCTGCCAAAA Nested forward primer SEQ ID No: 4 GCTCGTCTCCCTCCTGACTG Nested reverse primer

[0060] Specific quenching probes with different fluorescent labels (SEQ ID No: 5 and SEQ ID No: 6) were designed for the rs1136743 and rs1136747 sites of the SAA1 gene, as shown in Table 2:

[0061] Table 2

[0062] serial number Targeting site Tags and sequences (5'-3') use SEQ ID No: 5 rs1136743 FAM-CCAGACACCCCCAGGTC SNP Detection SEQ ID No: 6 rs1136747 TAMRA-CTGATCACTTCTGCAGC SNP Detection

[0063] Example 2: Sample DNA Extraction

[0064] QIAamp DNA Blood Mini kit is used to extract DNA from whole blood or tissue samples; DNA concentration is measured on Thermo Fisher NanoDrop 2000 ultra-micro UV spectrophotometer; when measuring samples, it is necessary to record the concentration, OD260 / 280 (optical density ratio of nucleic acid to protein of the substance being tested, which is required to be greater than or equal to 1.8) and OD260 / 230 (optical density ratio of nucleic acid to residual organic matter of the substance being tested, which is required to be greater than or equal to 1.7) three values, so as to find possible causes of contamination if the concentration does not meet the requirements. At the same time, it is also required that the experimenter must package the DNA sample so as to reduce the number of sample freeze-thaw cycles during the experiment and ensure the high quality of DNA. Then dilute the extracted sample concentration to 10-20ng / μL with deionized water to meet the basic requirements for subsequent genotyping sample quality control.

[0065] Example 3, biological experiment

[0066] Using (exo-)DNA polymerase (NEB) amplification system, amplification was performed on a Roche LightCycler 480 II PCR instrument according to the 20 μL reaction system shown in Table 3 to detect SNP sites associated with the SAA1 genotype.

[0067] Table 3

[0068]

[0069] 1. Nested PCR reaction conditions: 95°C, 5 min→8 cycles (95°C, 15 s; 64°C, 15 s; 72°C, 1 min)→50 cycles (95°C, 10 s; 60°C, 10 s; 72°C, 15 s).

[0070] 2. Melting curve fluorescence analysis method: 40℃, 1min→85℃, 10s (collect 3 fluorescence signal points per degree Celsius).

[0071] The corresponding base type of the SNP site is determined according to the melting temperature (Tm) corresponding to the peak of fluorescence change in the melting curve. Since the two quenching probes completely match the T base, if the corresponding SNP site is a T base, a relatively high Tm peak should be detected, while a C base should be detected to obtain a relatively low Tm peak. The corresponding Tm and peak type diagrams obtained by the detection of the specific 6 SAA1 genotypes are detailed in Table 4 and Figure 1 .

[0072] Table 4

[0073]

[0074]

[0075] Example 4: Comparison of SAA1 genotype detection results between the quenching probe method and the PCR direct sequencing method

[0076] In order to evaluate the clinical application of the quenching probe (QP) method of the present invention in SAA1 genotyping, the nested PCR primer pair and the two QPs of the present invention were combined in the detection of clinical samples. Peripheral blood genomic DNA was extracted, and the QP method detection and direct sequencing detection were performed simultaneously. In the sequencing detection of the QP methodology and the PCR direct sequencing detection of 10 volunteers, the SAA1 genotype of each sample is listed in Table 5. The genotyping results of the QP method and the PCR direct sequencing method were consistent, indicating that the QP method of the present invention is reliable for SAA1 genotyping. Therefore, the QP method provides a rapid and reliable strategy for SAA1 genotyping and clinical application.

[0077] Table 5

[0078]

[0079] In summary, the present invention provides an effective detection method for predicting the SAA1 genotype and its gene polymorphism and clinical disease risk in the population, and also provides an effective tool for the study of personalized genomics. The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which does not affect the essential content of the present invention.

[0080] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

[0081] SEQUENCE LISTING

[0082] Desay Diagnostic Systems (Shanghai) Co., Ltd.

[0083] Method and kit for detecting serum amyloid A1 genotype based on quenching probe 6

[0085] PatentIn version 3.3 1 twenty one

[0088] DNA

[0089] Artificial sequence 1

[0091] tgggaggtgg aggttgcgat g 21 2 25

[0094] DNA

[0095] Artificial sequence 2

[0097] aggaaggagg gatgaaaaca ctggg 25 3 twenty one

[0100] DNA

[0101] Artificial sequence 3

[0103] ggaactatga tgctgccaaa a 21 4 20

[0106] DNA

[0107] Artificial sequence 4

[0109] gctcgtctcc ctcctgactg 20 5 17

[0112] DNA

[0113] Artificial sequence 5

[0115] ccagacaccc ccaggtc 17 6 17

[0118] DNA

[0119] Artificial sequence 6

[0121] ctgatcactt ctgcagc 17

Claims

1. A quenching probe, characterized in that: The nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6: CCAGACACCCCCAGGTC(SEQ ID NO.5); CTGATCACTTCTGCAGC (SEQ ID NO. 6).

2. A primer sequence, characterized in that: The primer sequences include: Specific amplification primer sequences: TGGGAGGTGGAGGTTGCGATG (SEQ ID NO. 1); AGGAAGGAGGGATGAAAACACTGGG (SEQ ID NO. 2); Specific nested primer sequences: GGAACTATGATGCTGCCAAAA(SEQ ID NO.3); GCTCGTCTCCCTCCTGACTG (SEQ ID NO. 4).

3. An amplification system, characterized in that: It includes: PCR primer mix; PCR nested primer mix; quenching probe mixture; PCR reaction solution; template; ddH 2O; Wherein, the PCR primer mixture: SAA1 forward primer, SAA1 reverse primer, the primer sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2 as described in claim 2; the final concentration of the PCR primer mixture is 0.01-0.2 μM; Wherein, the PCR nested primer mixture: nested forward primer, nested reverse primer, the primer sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4 as described in claim 2; the final concentration of the PCR nested primer mixture is 0.01-1.0 μM; Wherein, the quenching probe mixture: QP1-FAM: rs1136743, QP1-TMARA: rs1136747, the primer sequences thereof are shown in SEQ ID NO.5 and SEQ ID NO.6 as described in claim 1; the final concentration of the quenching probe mixture is 0.01-1.0 μM; Wherein, the PCR reaction solution includes: PCR buffer, Taq enzyme, dNTPs and Mg 2+; the volume of the PCR reaction solution is 7.0-13.0 μL; Wherein, the template: positive control or negative control or genomic DNA; the volume of the template is 0.2-5.0 μL.

4. Use of the quenching probe according to claim 1, or the primer sequence according to claim 2, or the amplification system according to claim 3 in preparing a reagent for SNP site detection, or SAA1 genotype detection, or gene polymorphism detection.

Images