Multiple miRNA detection system and method based on CpAgo protein mediated RCA reaction

Abstract

The invention belongs to the technical field of miRNA detection, and particularly relates to a multiple miRNA detection system and method based on a CpAgo protein mediated RCA reaction. According to the invention, a system for detecting multiple miRNAs by a one-pot method is designed by utilizing the high-efficiency amplification capacity of RCA at constant temperature and the characteristics of precise cutting and multiple turnover enzymes of CpAgo at constant temperature; the two are integrated in a single closed reaction tube to complete the reaction, so that multiple uncovering operations caused by a two-step method are reduced, and the risk of aerosol pollution is effectively reduced; the system gives full play to the synergistic effect of CpAgo and RCA, has good multiple detection capability, and provides a brand new solution for high detection of miRNA.

Description

Technical Field

[0001] The invention belongs to the technical field of miRNA detection, and specifically relates to a one-pot multiple miRNA detection system and method. Background Art

[0002] Nucleic acid detection plays an important role in biological research and clinical applications. In particular, microRNA (miRNA) is a non-coding small interfering RNA present in biological fluids, which regulates gene expression by binding to target mRNA, thereby affecting the degradation or translation process of genes. Since these miRNAs can enter the blood circulation through cell death, inflammatory response or active secretion, some specific circulating miRNAs are abnormally expressed in different types of cancer and become potential biomarkers. Any imbalance in miRNA concentration, whether up-regulated or down-regulated, may lead to complications in cell function, thereby causing diseases such as cancer and Alzheimer's disease. For example, studies have shown that miR-21, miR-155 and miR-125b are abnormally expressed in breast cancer patients, and these changes in expression levels are related to the diagnosis, prognosis evaluation and treatment response monitoring of breast cancer. Therefore, the detection of miRNA is helpful to achieve early diagnosis and prognosis of the disease.

[0003] Argonaute (Ago) proteins are a class of nucleases widely present in eukaryotes and prokaryotes, and are important members of the PIWI protein family. Ago proteins usually have six structural fragments, including the N-terminus, PAZ domain, MID domain, PIWI domain, and two connecting domains L1 and L2. The N-terminal domain plays a key role in loading the guide chain, assembling the Ago-guide chain complex, and releasing the target. The PAZ domain and the MID domain contain binding pockets, respectively, which anchor the 3' end or 5' end of the guide chain, respectively, to ensure the precise positioning and stability of the guide chain. The PIWI domain has a typical ribonuclease H folding structure, and its catalytic center is composed of four conserved amino acid residues. These residues bind to divalent metal ions (such as Mg 2+ , Mn 2+ ) work synergistically to form an effective catalytic structure responsible for cutting the phosphodiester bond of the target chain. pAgos can accurately identify the target sequence complementary to the guide chain base under the guidance of single-stranded DNA (guide DNA, gDNA) or single-stranded RNA (guide RNA, gRNA) that is phosphorylated at the 5' end or hydroxylated at the 5' end, and cut at the complementary chain position between the 10th and 11th nucleotides of the guide chain, thereby achieving the distinction of single nucleotide differences. In recent years, prokaryotic Ago (pAgos) is becoming an ideal candidate for nucleic acid detection due to its programmability, precise specificity at the single base level, flexible targeting design, and continuous multi-turnover shearing efficiency.

[0004] Real-time quantitative polymerase chain reaction (qRT-PCR) is widely regarded as the gold standard method for miRNA detection, but it still has many limitations in practical application. qRT-PCR requires complex thermal cycling equipment to achieve denaturation, primer annealing and extension through multiple heating and cooling cycles, which limits its application in resource-limited or field detection. In addition, the short length of miRNA molecules makes it difficult to design specific primers, which easily leads to nonspecific amplification and false positive results. Rolling circle amplification (RCA) is a constant temperature amplification technology that usually uses circular DNA as a template (padlock probe). Under the guidance of short nucleic acid primers, linear DNA molecules are connected into closed circular structures using ligase. Subsequently, DNA polymerase performs strand displacement reactions along the template to generate a large number of repetitive single-stranded DNA products. Through this process, RCA can efficiently amplify the target DNA sequence and is widely used in genetic testing, diagnosis and molecular biology research. The main advantages of RCA are that it does not require temperature cycling equipment, mild reaction conditions (usually between 30-37°C), simple operation and can achieve high-specificity and high-sensitivity signal amplification. Mesophilic Ago proteins, such as CpAgo, derived from Clostridium perfringens, have efficient and stable cleavage activity at moderate temperatures (about 37°C), making them highly compatible with the constant temperature reaction conditions of RCA, avoiding the problem of enzyme activity fluctuations caused by different temperatures in the reaction system. Summary of the invention

[0005] The object of the present invention is to provide a simple, efficient and sensitive one-pot multiple miRNA detection system and method based on RCA reaction mediated by mesophilic Argonaute protein (CpAgo).

[0006] The present invention utilizes the efficient amplification capability of RCA at a constant temperature and the precise cutting and multi-turnover enzyme characteristics of CpAgo at a constant temperature to design a one-pot detection system for multiple miRNAs; the two are integrated into a single reaction tube, and the reaction is completed in a single closed reaction tube, thereby reducing the multiple opening operations caused by the two-step method, thereby effectively reducing the risk of aerosol contamination. This system gives full play to the synergistic effect of CpAgo and RCA, has good multiple detection capabilities, and provides a new solution for high detection of miRNA. Specifically, the one-pot multiple miRNA detection system provided by the present invention specifically includes:

[0007] (a) RCA reaction system, including a padlock probe, SplintR ligase, phi29 polymerase, dNTP, buffer and other necessary reaction components; the padlock probe comprises a region complementary to the target miRNA, and forms a closed loop structure with the target miRNA under the action of SplintR ligase;

[0008] (b) A CpAgo cleavage reaction system, comprising a mesophilic Argonaute protein (CpAgo) and its corresponding guide DNA chain, a molecular beacon, a buffer and other necessary reaction components; wherein the guide DNA chain achieves specific recognition by complementary pairing with the target sequence in the amplified product and can perform an efficient cleavage reaction under the catalysis of CpAgo; the molecular beacon carries different fluorescent groups and quenching groups for signal amplification and detection of the second round of CpAgo cleavage.

[0009] The detection system has single-base recognition capability and can distinguish miRNAs that differ from target miRNAs at only a single base.

[0010] Based on the above detection system, the present invention also provides a one-pot multiple miRNA detection method, the specific steps are as follows:

[0011] (1) Formation of a closed-loop structure of a padlock probe. The target miRNA and the padlock probe form a closed-loop structure under the action of SplintR ligase; the padlock probe contains a region complementary to the target miRNA, and forms a stable closed-loop nucleic acid structure through the catalysis of SplintR ligase, providing a template for the subsequent RCA reaction;

[0012] (2) RCA reaction. Add phi29 polymerase to initiate the RCA reaction and perform amplification at 37°C. phi29 polymerase has high efficiency and specific amplification ability and can perform continuous strand displacement synthesis on a closed-loop template to generate a large number of single-stranded amplification products. These amplification products contain multiple repeated target sequences.

[0013] (3) Complexation of CpAgo with the guide DNA chain and the first round of cleavage of the amplified product; specifically, CpAgo is premixed with the designed guide DNA chain; the guide DNA chain is complementary to the target sequence in the amplified product and can be specifically identified; the complexed CpAgo-guide DNA chain complex efficiently recognizes the target sequence at 37°C and accurately cleaves the amplified product at the 10th / 11th base, releasing free nucleic acid molecules; the released free nucleic acid molecules serve as new guide DNA chains.

[0014] (4) Double amplification and the second round of cleavage of molecular beacons by CpAgo; specifically, the nucleic acid molecules released by the first round of cleavage are combined with the padlock probe again to trigger a further RCA reaction and achieve exponential amplification of the signal; at the same time, the released free nucleic acid molecules are used as new guide DNA chains to complex with CpAgo and then targeted to the molecular beacon for the second round of cleavage; the molecular beacon is designed to have a fluorescent group and a quenching group. After being cleaved by CpAgo, the fluorescent group and the quenching group are separated to generate a detectable fluorescent signal, thereby achieving the detection of the target miRNA.

[0015] The method can simultaneously detect multiple miRNAs, including but not limited to miR-21, miR-141, miR-92a and miR-31.

[0016] In order to achieve the simultaneous detection of multiple miRNAs, the present invention also designs different padlock probes, guide DNA chains and molecular beacons with different fluorescent groups. Specifically including:

[0017] (a) Each miRNA corresponds to a specific padlock probe, which contains a region complementary to the target miRNA, ensuring that the amplification reaction of each miRNA is carried out independently and avoiding the occurrence of cross reactions.

[0018] (b) Different guide DNA chain designs: Each miRNA amplification product corresponds to a designed guide DNA chain, which achieves efficient recognition through complementary pairing with the amplification product; using the non-sequence-dependent characteristics of CpAgo, the sequence design of the guide DNA chain is not restricted by a specific nucleotide arrangement. This enables CpAgo to cut the corresponding amplification product under different sequence guide chains.

[0019] (c) Design of molecular beacons with different fluorescent groups: To achieve multiple fluorescence detection, molecular beacons are designed with different fluorescent groups and quenching groups. The corresponding fluorescent signals are released in the CpAgo-mediated cleavage reaction. Multiple fluorescent signals of different wavelengths are generated in the same reaction system. The detection instrument is configured with multiple fluorescence detection channels to read the signal intensity of each fluorescent group separately, thereby achieving simultaneous detection of multiple miRNAs.

[0020] The present invention has the following advantages:

[0021] (1) By combining the efficient cleavage characteristics and amplification capabilities of CpAgo and RCA reactions at 37°C, dual signal amplification was achieved, significantly improving the sensitivity and specificity of detection.

[0022] (2) All reaction components are added simultaneously in one reaction tube, eliminating the need for multiple operations and the frequent opening of the lid during multiple operations, thus reducing the risk of aerosol contamination.

[0023] (3) The detection reaction of each miRNA is carried out independently in the same reaction system without interfering with each other, thus achieving the simultaneous detection of multiple miRNAs and improving the throughput and efficiency of detection.

[0024] The multiple miRNA detection system and method of the present invention combines the efficient cleavage ability of CpAgo nuclease with the specific amplification advantage of RCA reaction to provide a simple, efficient and sensitive one-pot multiple miRNA detection solution, which is suitable for clinical diagnosis, disease monitoring and biomarker research. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of CpAgo-mediated RCA reaction for one-pot multiplex miRNA detection.

[0026] Figure 2 This is a graph showing the real-time fluorescence detection results of the miR-21 standard detection in Example 1.

[0027] Figure 3 This is the polyacrylamide gel electrophoresis diagram for feasibility verification of the system in Example 1.

[0028] Figure 4 This is a graph showing the real-time fluorescence detection results of the single-base mismatch experiment in Example 2.

[0029] Figure 5 This is the polyacrylamide gel electrophoresis diagram of the single base mismatch experiment in Example 2.

[0030] Figure 6 This is a graph showing the real-time fluorescence detection results of multiplex detection of miRNA in Example 3. DETAILED DESCRIPTION

[0031] The present invention is further described below by examples in conjunction with the accompanying drawings, but is not intended to limit the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention, and materials identical or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0032] definition:

[0033] "miRNA," "microRNA," and "miR" are synonymous and refer to a collection of noncoding single-stranded RNA molecules of approximately 18-28 nucleotides in length that regulate gene expression. miRNAs are found in a wide range of organisms and have been shown to play a role in development, homeostasis, and disease etiology.

[0034] "Molecular beacon" generally refers to a nucleotide or polynucleotide labeled with a marker (eg, fluorescent marker, fluorescent group) that can be used to detect or identify its corresponding target nucleotide or polynucleotide by hybridizing to the corresponding target sequence in a hybridization reaction.

[0035] "dNTP" refers to deoxynucleoside triphosphates. NTP refers to ribonucleoside triphosphates. Purine bases (Pu) include adenine (A), guanine (G), and their derivatives and analogs. Pyrimidine bases (Py) include cytosine (C), thymine (T), uracil (U), and their derivatives and analogs.

[0036] "Amplification," "nucleic acid amplification," or "amplified" refers to the generation of multiple copies of a nucleic acid template, or the generation of multiple copies of a nucleic acid sequence that is complementary to a nucleic acid template. Terms (including the term "polymerization") may also refer to extending a nucleic acid template (e.g., by polymerization). The amplification reaction may be a polymerase-mediated extension reaction. For example, polymerase chain reaction (PCR). However, any known amplification reaction may be suitable for the purposes described herein.

[0037] "RCA reaction", a constant temperature amplification technology, usually uses circular DNA as a template (padlock probe). Under the guidance of short nucleic acid primers, ligase is used to connect linear DNA molecules into a closed circular structure. Subsequently, DNA polymerase performs a strand displacement reaction along the template to generate a large number of repeated single-stranded DNA products.

[0038] "SplintR ligase" can efficiently catalyze the ligation of adjacent single-stranded DNA anchored by complementary RNA strands.

[0039] "Phi29 polymerase" generally refers to a DNA polymerase derived from bacteriophage phi29, which has high fidelity, strong strand displacement activity and high processivity, and can achieve efficient isothermal DNA amplification.

[0040] The sequences (5'-3') used in the present invention are as follows:

[0041] miR-21: UAGCUUAUCAGACUGAUGUUGA (SEQ.ID.NO.1)

[0042] Padlock Type Probe-21:

[0043] P-CTGATAAGCTAACTAGAACTCGTCGCTAATAGAACTCGTCGCTAATAACTCAACATC AGT(SEQ.ID.NO.2)

[0044] Molecular Beacon-21: FAM-CGACCCGCTAATAGAACTCGTGGTCG-BHQ1 (SEQ.ID.NO.3)

[0045] Guide DNA strand-21: TAGAACTCGTCGCTAA (SEQ.ID.NO.4)

[0046] miR-141:UAACACUGUCUGGUAAAGAUGG(SEQ.ID.NO.5)

[0047] Padlock Type Probe-141:

[0048] P-AGACAGTGTTAACTGCATAGTCACCAAGATGCATAGTCACCAAGACACCATCTTTAC C(SEQ.ID.NO.6)

[0049] Molecular Beacon-141: ROX-CGACCCCAAGATGCATAGTCAGGTCG-BHQ2 (SEQ.ID.NO.7)

[0050] Guide DNA strand-141: TCCGTTTACTTATCAA (SEQ.ID.NO.8)

[0051] miR-92a:UAUUGCACUUGUCCCGGCCUGU(SEQ.ID.NO.9)

[0052] Padlock Probe-92a:

[0053] P-CAAGTGCAATAACTCCGTTTACTTATCAATCCGTTTACTTATCAACAACAGGCCGGG A(SEQ.ID.NO.10)

[0054] Molecular Beacon-92a: HEX-CGACCTATCAATCCGTTTACTGGTCG-BHQ1 (SEQ.ID.NO.11)

[0055] Guide DNA strand-92a: TCCGTTTACTTATCAA (SEQ.ID.NO.12)

[0056] miR-31: AGGCAAGAUGCUGGCAUAGCU (SEQ.ID.NO.13)

[0057] Padlock Probe-31:

[0058] P-GCATCTTGCCTACTGGAACTAAGTTTAACTGGAACTAAGTTTAACCAAGCTATGCCA(SEQ.ID.NO.14)

[0059] Molecular beacon-31: Cy3-CGACCTTTAACTGGAACTAAGGGTCG-BHQ2 (SEQ.ID.NO.15)

[0060] Guide DNA strand-31: TGGAACTAAGTTTAAC (SEQ.ID.NO.16)

[0061] One upstream base mismatch: U C ACACUGUCUGGUAAAGAUGG(SEQ.ID.NO.17)

[0062] A midstream base mismatch: UAACACUGUCU A GUAAAGAUGG (SEQ.ID.NO.18)

[0063] One downstream base mismatch: UAACACUGUCUGGUAAAGAU A G(SEQ.ID.NO.19)

[0064] Two base mismatches: UAACACU A UCUGGUA C AGAUGG (SEQ.ID.NO.20)

[0065] Three base mismatches: UA C CACUGUCU A GUAAAGA C GG (SEQ.ID.NO.21)

[0066] Example 1, Detection of miR-21 Standard

[0067] In a sterile centrifuge reaction tube, add the following reagents in sequence to make the final concentrations of each reagent: Phi29 polymerase buffer (1X), padlock probe-21 (200nM), guide DNA chain-21 (100nM), CpAgo (500nM), Phi29 polymerase (1U / μL), SplintR ligase (1U / μL), molecular beacon-21 (1μM), dNTP (500μM), manganese chloride (500μM), bovine serum albumin (250ng / μL) and RNase inhibitor (0.8U / μL). It should be noted that CpAgo and guide DNA chain should be pre-incubated at 37°C for 30 minutes in advance.

[0068] Subsequently, the miR-21 standard sample (1nM, 10pM) to be tested was added to the reaction system, and a negative control group was set up at the same time. The negative control group used DEPC-treated water instead of miR-21. The centrifuge reaction tube was placed in a real-time fluorescence quantitative nucleic acid amplification instrument and incubated at 37°C for 2 hours. During this process, miR-21 and the padlock probe formed a closed-loop structure under the action of SplintR ligase, followed by RCA reaction and CpAgo-mediated cleavage reaction to achieve dual amplification of the signal. At the same time, the changes in the fluorescence signal in the system were monitored in real time, and the results are as follows: Figure 2 As shown in the figure, the fluorescence signal of miR-21 in the 1nM group was significantly enhanced, and the fluorescence signal in the 10pM group was enhanced, but the intensity was weaker than that in the 1nM group. There was no obvious fluorescence signal in the blank group, indicating that the detection method has good specificity.

[0069] In order to confirm the feasibility of the one-pot RCA amplification method, the amplification results were verified by polyacrylamide gel electrophoresis. Figure 3 As shown. Lane 1 in the figure is a molecular weight control marker, and lane 2 is a group containing ligase, polymerase, lock probe molecule, miR-21, and dNTP. Obvious dragging can be seen, indicating that the RCA amplification reaction proceeds smoothly and forms amplification products of varying lengths. Lanes 3 and 4 correspond to RCA amplification groups without phi29 polymerase and miR-21, respectively. It can be seen that the amplification reaction cannot proceed without the addition of miRNA target or polymerase. Lane 5 corresponds to a one-pot reaction containing the target. It can be seen that the amplification product is cut into fragments of varying lengths, further verifying the cleavage activity of CpAgo and the successful amplification of RCA. Lanes 6 and 7 correspond to the blank group. It can be seen that no obvious amplification and cleavage products are formed, which can rule out the influence of environmental factors on amplification.

[0070] Example 2, miR-21 base mismatch experiment

[0071] First, add Phi29 polymerase buffer (1X), padlock probe-21 (200nM), guide DNA chain-21 (100nM), CpAgo (500nM), Phi29 polymerase (1U / μL), SplintR ligase (1U / μL), molecular beacon-21 (1μM), dNTP (500μM), manganese chloride (500μM), bovine serum albumin (250ng / μL) and RNase inhibitor (0.8U / μL) to a sterile centrifuge reaction tube to ensure that the final concentration of each reagent reaches the required value. It is particularly important to note that CpAgo and guide DNA chain-21 need to be pre-incubated at 37°C for 30 minutes in advance to ensure sufficient binding.

[0072] Subsequently, different test samples were added to each reaction tube, including miR-21 standard samples, and miR-21 samples with one upstream base mismatch, one midstream base mismatch, one downstream base mismatch, two base mismatches, and three base mismatches. The concentration of each group of samples was set the same as that of the standard sample. In addition, a negative control group was set, and DEPC-treated water was added to the reaction tube of each negative control group instead of the miR-21 sample. All reaction tubes were placed in a real-time fluorescence quantitative nucleic acid amplification instrument and incubated at 37°C for 2 hours. During this process, miR-21 and the padlock probe formed a closed-loop structure under the action of SplintR ligase, followed by RCA reaction and CpAgo-mediated cleavage reaction to achieve dual amplification of the signal, while monitoring the changes in the fluorescence signal in each independent reaction tube in real time. The expected results are as follows. Figure 4 As shown in the figure, when miR-21 that is completely matched with the padlock probe is used as the target, a strong fluorescence signal is observed. However, the presence of mismatched miR-21 produces a weaker signal, and the more mismatches there are, the weaker the signal. In addition, the strength of the mismatch group signal is also related to the position of the mismatch. If the mismatch base is closer to the connection of the padlock probe, the weaker the signal is, and the signal far away from the connection of the padlock probe is stronger. The experimental results show that for the group where the mismatch is located upstream or downstream of miR-21 5', that is, far away from the connection, the signal intensity is weakened compared with the fully matched group; and the signal weakening degree of the midstream mismatch group is greater than that of the upstream and downstream. For samples with two or three base mismatches, the fluorescence signal is similar to that of the blank group, with almost no obvious change. The experimental results show that the detection method has high specificity and can effectively distinguish miRNAs with single-base mismatches, showing good specificity and single-base recognition ability.

[0073] In order to further verify the single base recognition ability of this method, polyacrylamide gel electrophoresis was performed, and the results were as follows Figure 5 As shown. From left to right, the first lane corresponds to the molecular weight control marker, the second lane corresponds to the miRNA-21 experimental group, the 3rd and 4th lanes are the single base mismatch groups in the upstream and downstream, respectively, and the 5th, 6th, and 7th lanes correspond to the single base mismatch group, double base mismatch group, and triple base mismatch group in the midstream, respectively. As can be seen from the figure, the miRNA-21 experimental group presents a bright band, showing obvious amplification and cleavage products. The upstream and downstream groups only have less obvious bands, indicating that there are fewer RCA amplification and cleavage products. For the last three groups, namely the midstream single base mismatch group, double base mismatch group, and triple base mismatch group, almost no electrophoresis bands were observed, indicating that these groups have basically no amplification and cleavage products. The above results further verify that this method has good single-base recognition ability and can effectively distinguish different degrees of base mismatches.

[0074] Example 3, Multiplex Detection of miR-21, miR-141, miR-92a, and miR-31 Standards

[0075] Add the following reagents to a sterile centrifuge tube, with the final concentrations of each reagent being: Phi29 polymerase buffer (1X), padlock probes-21, -141, -92a and -31 (200 nM each), guide DNA strands-21, -141, -92a and -31 (100 nM each), CpAgo (500 nM), Phi29 polymerase (1 U / μL), SplintR ligase (1 U / μL), molecular beacons-21, -141, -92a and -31 (1 μM each), dNTPs (500 μM), manganese chloride (500 μM), bovine serum albumin (250 ng / μL), and RNase inhibitor (0.8 U / μL). It should be noted that CpAgo and all guide DNA strands should be pre-incubated at 37°C for 30 minutes in advance to ensure sufficient binding.

[0076] Subsequently, the miRNA standard samples to be tested, including miR-21, miR-141, miR-92a and miR-31, were added to the reaction system. The centrifugal reaction tube was gently mixed and placed in a real-time fluorescence quantitative nucleic acid amplification instrument and incubated at 37°C for 2 hours. During the incubation process, the miRNA and the corresponding padlock probe formed a closed-loop structure under the action of SplintR ligase, followed by RCA and CpAgo-mediated cleavage reactions to achieve dual amplification of the signal. At the same time, the changes in the fluorescence signal in the system were monitored in real time, and the corresponding molecular beacons were used to detect the fluorescence signals of different miRNAs. Four-channel acquisition was set to collect the signals of ROX, FAM, HEX and Cy3 respectively. The experimental results show that Figure 6 , the fluorescence signals of miR-21, miR-141, miR-92a, and miR-31 were significantly enhanced, indicating that this multiplex detection method is suitable for the simultaneous detection and analysis of multiple miRNAs.

Claims

1. A multiple miRNA detection system based on CpAgo protein-mediated RCA reaction, characterized in that: The efficient amplification capability of RCA at a constant temperature and the precise cutting and multi-turnover enzyme characteristics of CpAgo at a constant temperature are utilized to integrate the two into a single reaction tube to complete the reaction; specifically, the following are included: (a) RCA reaction system, including a padlock probe, SplintR ligase, phi29 polymerase, dNTP, buffer and other necessary reaction components; the padlock probe comprises a region complementary to the target miRNA, and forms a closed loop structure with the target miRNA under the action of SplintR ligase; (b) A CpAgo cleavage reaction system, comprising a mesophilic Argonaute protein (CpAgo) and its corresponding guide DNA chain, a molecular beacon, a buffer and other necessary reaction components; wherein the guide DNA chain achieves specific recognition by complementary pairing with the target sequence in the amplified product and can perform an efficient cleavage reaction under the catalysis of CpAgo; the molecular beacon carries different fluorescent groups and quenching groups for signal amplification and detection of the second round of CpAgo cleavage; The detection system has single-base recognition capability and can distinguish miRNAs that differ from target miRNAs at only a single base.

2. A one-pot multiple miRNA detection method based on the detection system of claim 1, characterized in that: The specific steps are as follows: (1) Formation of a closed-loop structure of a padlock probe; forming a closed-loop structure between the target miRNA and the padlock probe under the action of SplintR ligase; the padlock probe comprises a region complementary to the target miRNA, and forms a stable closed-loop nucleic acid structure through the catalysis of SplintR ligase, thereby providing a template for a subsequent RCA reaction; (2) RCA reaction; phi29 polymerase is added to initiate the RCA reaction and amplification is performed at 37°C; phi29 polymerase has high efficiency and specific amplification ability and can perform continuous strand displacement synthesis on a closed-loop template to generate a large number of single-stranded amplification products; these amplification products contain multiple repeated target sequences; (3) CpAgo complexes with guide DNA chains and the first round of cleavage of amplified products; specifically, CpAgo is premixed with the designed guide DNA chain; the guide DNA chain is complementary to the target sequence in the amplified product and can be specifically identified; the complexed CpAgo-guide DNA chain complex efficiently recognizes the target sequence at 37°C and accurately cleaves the amplified product at the 10th / 11th base, releasing free nucleic acid molecules; the released free nucleic acid molecules serve as new guide DNA chains; (4) Double amplification and the second round of cleavage of molecular beacons by CpAgo; specifically, the nucleic acid molecules released by the first round of cleavage are combined with the padlock probe again to trigger a further RCA reaction and achieve exponential amplification of the signal; at the same time, the released free nucleic acid molecules are used as new guide DNA chains to complex with CpAgo and then targeted to the molecular beacon for the second round of cleavage; the molecular beacon is designed to have a fluorescent group and a quenching group. After being cleaved by CpAgo, the fluorescent group and the quenching group are separated to generate a detectable fluorescent signal, thereby achieving the detection of the target miRNA.

3. The detection method according to claim 2, characterized in that: Different padlock probes, guide DNA strands, and molecular beacons with different fluorescent groups are also designed to achieve simultaneous detection of multiple miRNAs; specifically, they include: (a) Each miRNA corresponds to a specific padlock probe, which contains a region complementary to the target miRNA, ensuring that the amplification reaction of each miRNA is carried out independently to avoid the occurrence of cross-reactions; (b) Different guide DNA chain designs: Each miRNA amplification product corresponds to a designed guide DNA chain, and the guide DNA chain achieves efficient recognition through complementary pairing with the amplification product; by utilizing the non-sequence-dependent characteristics of CpAgo, the sequence design of the guide DNA chain is not restricted by a specific nucleotide arrangement, so that CpAgo cuts the corresponding amplification product under guide chains of different sequences; (c) Design of molecular beacons with different fluorescent groups; specifically, the molecular beacons are designed to carry different fluorescent groups and quenching groups, so that corresponding fluorescent signals are released in the CpAgo-mediated cleavage reaction, and multiple fluorescent signals of different wavelengths are generated in the same reaction system; the detection instrument is configured with multiple fluorescence detection channels to read the signal intensity of each fluorescent group separately, thereby realizing the simultaneous detection of multiple miRNAs.

4. The detection method according to claim 3, characterized in that: The miRNAs are miR-21, miR-141, miR-92a and miR-31.

Images