Nucleic acid products, kits, devices and applications for detecting gene mutations

Abstract

The present application discloses a nucleic acid product, a kit, a device and an application for detecting gene variation. The nucleic acid product includes one or more primer sets, and the relevant information of the primer sets is detailed in the present application. The nucleic acid product, the kit and the device in the present application can at least effectively solve the interference of pseudogenes (high homologous sequences) on the target detection results, making the detection easier; the different primer sets included can share a reaction system and amplification conditions, without the need to add additional PCR enhancers, making the experimental operation simple and convenient; the targeted amplification product can be used for first-generation sequencing, second-generation sequencing, and third-generation sequencing; it can be used simultaneously in multiple scenarios according to needs, and the third-generation sequencing of targeted amplicon can distinguish between cis or trans mutations, and whether the mutation has a chain effect.

Description

[0001] Related Applications

[0002] This application claims patent application number CN2024115095065, filed on October 28, 2024, entitled “Nucleic acid products, kits, devices and applications for detecting gene mutations”, which is hereby incorporated by reference in its entirety. Technical Field

[0003] The present application relates to the field of biotechnology, and in particular to nucleic acid products, kits, devices and applications for detecting gene mutations. Background Art

[0004] Single gene genetic diseases are diseases caused by mutations in a specific gene. These gene mutations can be passed on to offspring, causing the same disease or symptoms. Common single gene genetic diseases include spinal muscular atrophy, various skin diseases, incontinence pigmenti, and polycystic kidney disease.

[0005] Among them, spinal muscular atrophy (SMA) is an autosomal recessive genetic disease caused by a single gene mutation. It is the most common lethal genetic disease in infancy, with an incidence of about 1 / 10,000 and a population carrier rate of about 1 / 50; if both spouses are SMA carriers, the probability of their offspring suffering from the disease is 1 / 4. The pathogenic gene SMN1 (OMIM600354) and the modifier gene SMN2 (OMIM 601627) of SMA are highly homologous, with only a difference of 5 bases. SMN1 determines the occurrence of the disease, of which about 95% is caused by SMN1 copy number variation and 5% is caused by SMN1 compound heterozygous mutations. At present, about 90 minor pathogenic variants have been reported at home and abroad (http: / / www.hgmd.cf.ac.uk), and nearly 30 have been reported in Chinese patients; SMN2 affects the severity and progression of the disease, making the genetic diagnosis of SMA different from that of most single-gene genetic diseases.

[0006] The filaggrin (FLG) gene is located in the chromosome 1q21.3 region and is expressed in membrane tissues such as the epidermis, oral and nasal mucosa. It mainly encodes profilaggrin. Profilaggrin is a highly phosphorylated and water-insoluble protein. During epidermal differentiation, it undergoes dephosphorylation and hydrolysis to form soluble FLG monomers. The monomers are tightly combined with keratin and other components to form the protein skeleton of the cell membrane, which serves as a strong epidermal barrier to prevent the invasion of external allergens. The occurrence of various skin diseases is associated with mutations in the FLG gene, such as ichthyosis, atopic dermatitis, and psoriasis. It consists of three exons, of which exons 1 and 2 are smaller and exon 3 is larger. Exon 1 (15 bp) is located in the 5' untranslated region and contains only untranslated sequences; Exon 2 (159 bp) contains the start codon; Exon 3 (12.7-14.7 Kb) is the most important functional domain of FLG, encoding the S100 region, the B binding region, and 10-12 filaggrin repeat sequences. The homology between the repeat sequences at the DNA level is nearly 100%.

[0007] Incontinence pigmenti, also known as Bloch-Sulzberger disease, is an X-linked dominant genetic disease. Children with the disease usually develop symptoms such as urticaria, vesicles, and verrucous dermatitis on both sides of the trunk about 2 weeks after birth. Because males only have one X chromosome, males are more seriously ill and often die in the fetal period, so patients are generally female. This disease is often accompanied by abnormalities of the eyes, bones, and central nervous system, and the neonatal incidence rate is about 1 / 50,000. The main pathogenic gene of incontinence pigmenti is IKBKG, which is also called NEMO gene. It is located on Xq28. The genome in this region is complex and rich in repetitive sequences. It consists of two 35kb sequences with a low replication repetition rate of 98%, one of which contains the IKBKG gene and the other contains a non-functional IKBKGP pseudogene. Therefore, if genetic testing for incontinence pigmenti is performed, it is important to distinguish between true and false genes.

[0008] Polycystic kidney disease (PKD) is a common autosomal genetic disease and a common cause of end-stage renal disease in children and adults. It is characterized by multiple progressive cysts in both kidneys. According to the inheritance mode, it can be divided into autosomal dominant polycystic kidney disease (ADPKD) and autosomal recessive polycystic kidney disease (ARPKD). ADPKD is an adult-onset multi-system disease with multiple, progressively enlarged cysts in both kidneys as the main manifestations. It may be accompanied by glomerular filtration dysfunction, hypertension, liver cysts and cerebral aneurysms. About 45% of patients progress to end-stage renal failure before the age of 60, accounting for 7% to 10% of the causes of end-stage renal disease. It is the fourth most common cause of renal replacement therapy (RRT) worldwide. Among them, PKD1 and PKD2 are relatively common causes of the disease, accounting for about 95% of ADPKD patients. It is worth noting that the sequence similarity between PKD1 gene Exon1-33 and the six pseudogenes located nearby (PKD1P1, PKD1P2, PKD1P3, PKD1P4, PKD1P5, PKD1P6) is about 97.7%; the PKD2 gene has high GC content; the GC content of some DNA sequences is as high as 85%, making gene amplification difficult.

[0009] The detection of SMN1, FLG, IKBKG, PKD1 and PKD2 genes can be achieved based on common methods such as MLPA, Sanger sequencing or second-generation sequencing.

[0010] Regarding several detection methods: Sanger sequencing is mainly used to detect and verify mutation sites with known variation information, MLPA is used to detect the copy number of a single exon of a gene, and NGS sequencing is more widespread and cheaper.

[0011] Due to the high homology between SMN1 and SMN2 genes, IKBKG and IKBKGP1, the homology between the internal repeat sequences of the FLG gene at the DNA level is nearly 100%, and PKD1 / PKD2 has high homology and high GC, which can easily cause false positive results in NGS. At present, SMN1 detection is mainly focused on the deletion detection of exons 7 and 8, and there are few detection methods caused by 5% SMN1 compound heterozygous mutations. The commonly used method is to amplify the full length of the SMN1 gene of about 28kb, which puts higher requirements on DNA quality and amplification reaction system, making the experiment cumbersome and easy to fail; and FLG gene exon 3 contains a series of related but different 972bp filaggrin monomer sequence tandem repeats, ranging from 10 to 12 or even rarer repeats, which poses great difficulties for detection. Therefore, based on current technology, it is difficult to simultaneously identify all related variations of the FLG gene in the same detection system, and the mutation location is also difficult to detect. Inaccurate; the IKBKG gene is currently unable to simultaneously detect all point mutation types and structural variation types of the IKBKG gene in the same system; PKD1 / PKD2 has high homology and high GC, and its detection is mainly concentrated on the PKD1 gene, or dozens of primer pairs or several pairs of amplicons with long amplicons greater than 20Kb are used for targeted detection. However, the more short amplicons there are, the more likely it is that cross-amplification, primer dimers, and non-specific amplification will occur if multiple PCR amplification is performed, resulting in poor uniformity and low data efficiency. The longer the amplicon, the higher the requirements for DNA quality and the stricter the requirements for the amplification environment, which is easily contaminated by aerosols.

[0012] Therefore, there is an urgent need in the art to develop a new primer set for detecting the above genes. Summary of the invention

[0013] Based on this, it is necessary to provide at least one nucleic acid product, kit, device and application for detecting gene variation.

[0014] In a first aspect of the present application, a nucleic acid product for detecting gene variation is provided, the nucleic acid product comprising one or more of the following primer sets: a first primer set: the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively; a second primer set: the sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; a third primer set: the sequences are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; a fourth primer set: the sequences are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; a fifth primer set: the sequences are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; a sixth primer set: the sequences are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; a seventh primer set: the sequences are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; an eighth primer set: the sequences are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; a ninth primer set: the sequences are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively; a tenth primer set: the sequences are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively. NO:20; the eleventh primer set: the sequences are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; the twelfth primer set: the sequences are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively; the thirteenth primer set: the sequences are shown in SEQ ID NO:25 and SEQ ID NO:26, respectively; the fourteenth primer set: the sequences are shown in SEQ ID NO:27 and SEQ ID NO:28, respectively; the fifteenth primer set: the sequences are shown in SEQ ID NO:29 and SEQ ID NO:30, respectively; the sixteenth primer set: the sequences are shown in SEQ ID NO:31 and SEQ ID NO:32, respectively; the seventeenth primer set: the sequences are shown in SEQ ID NO:33 and SEQ ID NO:34, respectively; the eighteenth primer set: the sequences are shown in SEQ ID NO:35 and SEQ ID NO:36, respectively; the nineteenth primer set: the sequences are shown in SEQ ID NO:37 and SEQ ID NO:38, respectively; the twentieth primer set: the sequences are shown in SEQ ID NO:39 and SEQ ID NO:40; the twenty-first primer set: the sequences are shown in SEQ ID NO:41 and SEQ ID NO:42 respectively; the twenty-second primer set: the sequences are shown in SEQ ID NO:43 and SEQ ID NO:44 respectively; the twenty-third primer set: the sequences are shown in SEQ ID NO:45 and SEQ ID NO:46 respectively; the twenty-fourth primer set: the sequences are shown in SEQ ID NO:47 and SEQ ID NO:48 respectively;The twenty-fifth primer set: the sequences are shown in SEQ ID NO:49 and SEQ ID NO:50, respectively; the twenty-sixth primer set: the sequences are shown in SEQ ID NO:51 and SEQ ID NO:52, respectively; the twenty-seventh primer set: the sequences are shown in SEQ ID NO:53 and SEQ ID NO:54, respectively; the twenty-eighth primer set: the sequences are shown in SEQ ID NO:55 and SEQ ID NO:56, respectively; the twenty-ninth primer set: the sequences are shown in SEQ ID NO:57 and SEQ ID NO:58, respectively; the thirtieth primer set: the sequences are shown in SEQ ID NO:59 and SEQ ID NO:60, respectively; the thirty-first primer set: the sequences are shown in SEQ ID NO:61 and SEQ ID NO:62, respectively; the thirty-second primer set: the sequences are shown in SEQ ID NO:63 and SEQ ID NO:64, respectively; the thirty-third primer set: the sequences are shown in SEQ ID NO:65 and SEQ ID NO:66, respectively; the thirty-fourth primer set: the sequences are shown in SEQ ID NO:67 and SEQ ID NO:68, respectively. NO:68; the 35th primer set: the sequences are shown in SEQ ID NO:69 and SEQ ID NO:70; the 36th primer set: the sequences are shown in SEQ ID NO:71 and SEQ ID NO:72; the 37th primer set: the sequences are shown in SEQ ID NO:73 and SEQ ID NO:74; the 38th primer set: the sequences are shown in SEQ ID NO:75 and SEQ ID NO:76; the 39th primer set: the sequences are shown in SEQ ID NO:77 and SEQ ID NO:78; the 40th primer set: the sequences are shown in SEQ ID NO:79 and SEQ ID NO:80.;

[0015] In some embodiments, the nucleic acid product includes one or more of the following primer sets: the first primer set, the second primer set, the third primer set, the fourth primer set, the fifth primer set, the sixth primer set, the seventh primer set, the eighth primer set, the ninth primer set, the tenth primer set, the eleventh primer set, the twelfth primer set, the thirteenth primer set, the fourteenth primer set, the seventeenth primer set, the eighteenth primer set, the nineteenth primer set, the twentieth primer set, the twenty-second primer set, the twenty-third primer set, the twenty-fourth primer set, the twenty-fifth primer set, the twenty-sixth primer set, the twenty-seventh primer set, the twenty-eighth primer set, the twenty-ninth primer set, the thirtieth primer set, the thirty-first primer set, the thirty-second primer set, and the thirty-sixth primer set.

[0016] In some embodiments, the gene is selected from the group consisting of SMN1, FLG, IKBKG, PKD1, and PKD2.

[0017] In some embodiments, the primer set satisfies one or more of the following features 1) to 4):

[0018] 1) The primer set for amplifying the SMN1 is selected from the group consisting of the first primer set, the second primer set, the third primer set, the fourth primer set, the fifth primer set, the sixth primer set, the seventh primer set and the eighth primer set;

[0019] 2) the primer set for amplifying the FLG is selected from the group consisting of the ninth primer set, the tenth primer set, the eleventh primer set, the twelfth primer set, the thirteenth primer set, the fourteenth primer set, the fifteenth primer set, the sixteenth primer set, the seventeenth primer set, the eighteenth primer set, the nineteenth primer set, the twentieth primer set, the twenty-first primer set, the twenty-second primer set, the twenty-third primer set, the twenty-fourth primer set, the twenty-fifth primer set, the twenty-sixth primer set, the twenty-seventh primer set, the twenty-eighth primer set, the twenty-ninth primer set and the thirtieth primer set;

[0020] 3) the primer set for amplifying the IKBKG is selected from the group consisting of the thirty-first primer set and the thirty-second primer set; and

[0021] 4) The primer set for amplifying the PKD1 and / or the PKD2 is selected from the group consisting of the thirty-third primer set, the thirty-fourth primer set, the thirty-fifth primer set, the thirty-sixth primer set, the thirty-seventh primer set, the thirty-eighth primer set, the thirty-ninth primer set and the fortieth primer set.

[0022] In some embodiments, the genetic variation is selected from the group consisting of a single nucleotide variation, an insertion or deletion, an exon deletion, and a monomeric sequence tandem duplication.

[0023] In a second aspect of the present application, a kit is provided, comprising an amplification system;

[0024] The amplification system comprises the nucleic acid product as described in the first aspect, and one or more of a buffer, a dNTP Mix, a DNA polymerase, gDNA and nuclease-free water.

[0025] In some embodiments, the method of detecting a disease associated with a gene variation in the kit comprises PCR.

[0026] In some embodiments, the method further comprises at least one of electrophoresis and sequencing; the sequencing is optionally selected from the group consisting of first generation sequencing, second generation sequencing and third generation sequencing.

[0027] In a third aspect of the present application, a device for detecting gene variation is provided, wherein the device satisfies one or more of the features (1) to (2):

[0028] (1) collecting sequence information after amplifying the sample to be tested using the nucleic acid product described in the first aspect or the kit described in the second aspect;

[0029] (2) Analyzing whether a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 is mutated: including analyzing single nucleotide variation, insertion or deletion, and exon deletion / duplication on the gene.

[0030] In the fourth aspect of the present application, a method for sequencing a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 is provided, the method comprising amplifying the gene using the nucleic acid product as described in the first aspect or the kit as described in the second aspect.

[0031] In some embodiments, the amplification conditions include:

[0032] Pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds, extension at 68°C for 30s / Kb, and cycle 30 to 40 times.

[0033] In the fifth aspect of the present application, there is provided use of the nucleic acid product as described in the first aspect, the kit as described in the second aspect, or the device as described in the third aspect in the preparation of a product for detecting diseases associated with gene mutations.

[0034] In some embodiments, the disease associated with the gene variation is selected from the group consisting of spinal muscular atrophy, skin disease, incontinence pigmenti and polycystic kidney disease.

[0035] The nucleic acid products, kits and devices in the present application can at least effectively solve the interference of pseudogenes (highly homologous sequences) on the target detection results, making the detection easier; the different primer sets included can share a reaction system and amplification conditions, without the need to add additional PCR enhancers, making the experimental operation simple and convenient; the targeted amplification products can be used for first-generation sequencing, second-generation sequencing, and third-generation sequencing; multiple scenarios can be applied simultaneously according to needs, and the targeted amplicon third-generation sequencing can distinguish between cis or trans mutations, and whether the mutation has a chain effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0037] Figure 1 The Sanger sequencing map in one embodiment of the present application is shown.

[0038] Figure 2 The Sanger sequencing map in one embodiment of the present application is shown.

[0039] Figure 3 The Sanger sequencing map in one embodiment of the present application is shown.

[0040] Figure 4 The Sanger sequencing map in one embodiment of the present application is shown.

[0041] Figure 5 The Sanger sequencing map in one embodiment of the present application is shown.

[0042] Figure 6 The Sanger sequencing map in one embodiment of the present application is shown.

[0043] Figure 7 The IGV diagram of the third-generation sequencing detection in one embodiment of the present application is shown; Note: the red box marks the missing area.

[0044] Figure 8 The Sanger sequencing map in one embodiment of the present application is shown.

[0045] Fig. 9 The agarose gel electrophoresis detection results of one embodiment of the present application are shown; wherein: M: DL15000, 1: female, 2: male, 3: child, 4: normal person (negative control), 5: NTC.

[0046] Fig.10 The Sanger sequencing map in one embodiment of the present application is shown.

[0047] Fig.11 The Sanger sequencing map of one embodiment of the present application is shown; Note: the chromosome coordinates of the red arrow are ChrX: 153786229, and the chromosome coordinates of the green arrow are ChrX: 153797930.

[0048] Fig.12The Sanger sequencing map in one embodiment of the present application is shown.

[0049] Fig.13 The agarose gel electrophoresis quality inspection results in one embodiment of the present application are shown; Note: M: DL2000; Lane 1: DF1+DR1; Lane 2: DF2+DR2; Lane 3: DF3+DR3; Lane 4: DF4+DR4; Lane 5: DF5+DR5; Lane 6: DF6+DR6.

[0050] Fig.14 The Sanger sequencing map in one embodiment of the present application is shown.

[0051] Fig.15 The Sanger sequencing map in one embodiment of the present application is shown.

[0052] Fig.16 The Sanger sequencing map in one embodiment of the present application is shown.

[0053] Fig.17 The electrophoresis diagram of the amplification primers in one embodiment of the present application is shown; Note: M: DL15000; Lane 1: LF+LR; Lane 2: LF1+LR1; Lane 3: LF2+LR1; Lane 4: LF3+LR3; Lane 4: LF3+LR4.

[0054] Fig.18 The agarose gel electrophoresis quality inspection profile in one embodiment of the present application is shown; Note: M: DL2000; Lane 1: Sample 1; Lane 2: Sample 2; Lane 3: Blank control; A: DF8+DR8; B: DF9+DR9; C: DF9+DR9-1; D: DF11+DR11; F: DF12+DR12; G: DF9+DR9-2; H: DF9+DR9-3; I: DF10+DR10; J: DF10-1+DR10.

[0055] Fig.19 The Sanger sequencing map in one embodiment of the present application is shown.

[0056] Fig. 20 The Sanger sequencing map in one embodiment of the present application is shown.

[0057] Fig.21 The Sanger sequencing map in one embodiment of the present application is shown.

[0058] Fig. 22 The Sanger sequencing map in one embodiment of the present application is shown.

[0059] Fig.23 The Sanger sequencing map in one embodiment of the present application is shown.

[0060] Fig.24 The Sanger sequencing map in one embodiment of the present application is shown.

[0061] Fig.25 The Sanger sequencing map in one embodiment of the present application is shown.

[0062] Fig.26 The Sanger sequencing map in one embodiment of the present application is shown.

[0063] Fig. 27 The Sanger sequencing map in one embodiment of the present application is shown.

[0064] Fig.28 The Sanger sequencing map in one embodiment of the present application is shown.

[0065] Fig.29 The Sanger sequencing map in one embodiment of the present application is shown. DETAILED DESCRIPTION

[0066] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0067] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present application belongs. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0068] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and the like, when used in other ways to mean "one or more", are also understood in the same way unless otherwise specified.

[0069] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0070] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. is based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0071] In this application, "further", "further", "particularly", "for example", "such as", "example", "for example", etc. are used for descriptive purposes, indicating that the previous and subsequent different technical solutions are related in terms of the content covered, but should not be understood as a limitation on the previous technical solution, nor can it be understood as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0072] In this application, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent. Unless otherwise specified, the descriptions of "optionally include", "optionally contain", etc. in this application, taking "optionally include" as an example, mean "may include or not include".

[0073] The terms "contain", "include" and "include" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0074] In this application, the technical features or technical solutions described in an open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0075] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form new technical solutions.

[0076] In the present application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0077] In the present application, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to an integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0078] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0079] In a first aspect of the present application, a nucleic acid product for detecting gene variation is provided, the nucleic acid product comprising one or more of the following primer sets: a first primer set: the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively; a second primer set: the sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; a third primer set: the sequences are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; a fourth primer set: the sequences are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; a fifth primer set: the sequences are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; a sixth primer set: the sequences are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; a seventh primer set: the sequences are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; an eighth primer set: the sequences are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; a ninth primer set: the sequences are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively; a tenth primer set: the sequences are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively. NO:20; the eleventh primer set: the sequences are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; the twelfth primer set: the sequences are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively; the thirteenth primer set: the sequences are shown in SEQ ID NO:25 and SEQ ID NO:26, respectively; the fourteenth primer set: the sequences are shown in SEQ ID NO:27 and SEQ ID NO:28, respectively; the fifteenth primer set: the sequences are shown in SEQ ID NO:29 and SEQ ID NO:30, respectively; the sixteenth primer set: the sequences are shown in SEQ ID NO:31 and SEQ ID NO:32, respectively; the seventeenth primer set: the sequences are shown in SEQ ID NO:33 and SEQ ID NO:34, respectively; the eighteenth primer set: the sequences are shown in SEQ ID NO:35 and SEQ ID NO:36, respectively; the nineteenth primer set: the sequences are shown in SEQ ID NO:37 and SEQ ID NO:38, respectively; the twentieth primer set: the sequences are shown in SEQ ID NO:39 and SEQ ID NO:40; the twenty-first primer set: the sequences are shown in SEQ ID NO:41 and SEQ ID NO:42 respectively; the twenty-second primer set: the sequences are shown in SEQ ID NO:43 and SEQ ID NO:44 respectively; the twenty-third primer set: the sequences are shown in SEQ ID NO:45 and SEQ ID NO:46 respectively; the twenty-fourth primer set: the sequences are shown in SEQ ID NO:47 and SEQ ID NO:48 respectively;The twenty-fifth primer set: the sequences are shown in SEQ ID NO:49 and SEQ ID NO:50, respectively; the twenty-sixth primer set: the sequences are shown in SEQ ID NO:51 and SEQ ID NO:52, respectively; the twenty-seventh primer set: the sequences are shown in SEQ ID NO:53 and SEQ ID NO:54, respectively; the twenty-eighth primer set: the sequences are shown in SEQ ID NO:55 and SEQ ID NO:56, respectively; the twenty-ninth primer set: the sequences are shown in SEQ ID NO:57 and SEQ ID NO:58, respectively; the thirtieth primer set: the sequences are shown in SEQ ID NO:59 and SEQ ID NO:60, respectively; the thirty-first primer set: the sequences are shown in SEQ ID NO:61 and SEQ ID NO:62, respectively; the thirty-second primer set: the sequences are shown in SEQ ID NO:63 and SEQ ID NO:64, respectively; the thirty-third primer set: the sequences are shown in SEQ ID NO:65 and SEQ ID NO:66, respectively; the thirty-fourth primer set: the sequences are shown in SEQ ID NO:67 and SEQ ID NO:68, respectively. NO:68; the 35th primer set: the sequences are shown in SEQ ID NO:69 and SEQ ID NO:70; the 36th primer set: the sequences are shown in SEQ ID NO:71 and SEQ ID NO:72; the 37th primer set: the sequences are shown in SEQ ID NO:73 and SEQ ID NO:74; the 38th primer set: the sequences are shown in SEQ ID NO:75 and SEQ ID NO:76; the 39th primer set: the sequences are shown in SEQ ID NO:77 and SEQ ID NO:78; the 40th primer set: the sequences are shown in SEQ ID NO:79 and SEQ ID NO:80.;

[0080] In some embodiments, the gene is selected from the group consisting of SMN1, FLG, IKBKG, PKD1, and PKD2.

[0081] In some embodiments, a nucleic acid product for detecting a variation in the SMN1 gene is provided, the nucleic acid product comprising one or more of the following primer sets:

[0082] The first primer set, the second primer set, the third primer set, the fourth primer set, the fifth primer set, the sixth primer set, the seventh primer set and the eighth primer set.

[0083] In some embodiments, the SMN1 gene variation is selected from the group consisting of SNV (Single nucleotide variant), Indel (Insertion or deletion), exon deletion and monomeric sequence tandem duplication.

[0084] Diseases associated with SMN1 mutations include, but are not limited to, spinal muscular atrophy.

[0085] Common variations in the SMN1 gene include but are not limited to SNV, Indel, and exon deletion.

[0086] The first primer set and / or the second primer set amplify the long amplicon in the SMN1 gene, and can be used for the detection of exon 7 deletion alone, as well as SNV and Indel detection. While detecting SNV and Indel, the deletion of exon 7 of the SMN1 gene is effectively taken into account, and at the same time, the detection of a deletion of an exon contained in the long-fragment primer is also taken into account to a certain extent; in addition, for the detection of SNV and Indel of the SMN1 gene, the use of the first primer set and / or the second primer set greatly reduces the requirements for DNA quality compared to other full-length amplifications, and the amplification success rate is higher.

[0087] The short amplicon primers of the SMN1 gene involved in the present application, such as the third primer set to the eighth primer set, can be used for nested PCR, SNV and Indel result verification.

[0088] In some embodiments, a nucleic acid product for detecting a variation in the gene FLG is provided, the nucleic acid product comprising one or more of the following primer sets:

[0089] The ninth primer set, the tenth primer set, the eleventh primer set, the twelfth primer set, the thirteenth primer set, the fourteenth primer set, the fifteenth primer set, the sixteenth primer set, the seventeenth primer set, the eighteenth primer set, the nineteenth primer set, the twentieth primer set, the twenty-first primer set, the twenty-second primer set, the twenty-third primer set, the twenty-fourth primer set, the twenty-fifth primer set, the twenty-sixth primer set, the twenty-seventh primer set, the twenty-eighth primer set, the twenty-ninth primer set and the thirtieth primer set.

[0090] In some embodiments, the disease associated with FLG variation includes but is not limited to a skin disease.

[0091] Common variations in the FLG gene include, but are not limited to, SNV, Indel, and tandem duplication of monomer sequences. The ninth to thirteenth primer sets are used to amplify the long amplicon in the FLG gene for SNV and Indel detection and tandem duplication detection of a 972bp filaggrin monomer sequence related but not identical on exon 3. While detecting SNV and Indel, the tandem duplication detection of a 972bp filaggrin monomer sequence related but not identical on exon 3 of the FLG gene is effectively taken into account, and at the same time, the detection of a deletion of an exon contained in the long-fragment primer is also taken into account to some extent.

[0092] The short amplicon primers of the FLG gene involved in the present application, such as the fourteenth primer set to the thirtieth primer set, can be used for nested PCR, SNV and Indel result verification, and can also be used alone for the detection and verification of known sites.

[0093] In some embodiments, a nucleic acid product for detecting a variation in the gene IKBKG is provided, the nucleic acid product comprising one or more of the following primer sets:

[0094] The thirty-first primer set and the thirty-second primer set.

[0095] In some embodiments, diseases associated with IKBKG variations include but are not limited to Incontinentia Pigmenti.

[0096] Common variations in the IKBKG gene include, but are not limited to, SNV, Indel, and exon deletion. The use of the thirty-first primer set and / or the thirty-second primer set to amplify the long amplicon in the IKBKG gene can be used for exon 4-10 deletion detection, and can also be used for exon 2-10 SNV and Indel detection (Note: exon 1 does not encode amino acids). While detecting SNV and Indel, the detection of exon 4-10 deletion of the IKBKG gene is effectively taken into account, and at the same time, the detection of a certain exon deletion contained in the long fragment primer is also taken into account to a certain extent.

[0097] In some embodiments, a nucleic acid product for detecting a variation in the gene PKD1 and / or PKD2 is provided, the nucleic acid product comprising one or more of the following primer sets:

[0098] the thirty-third primer set, the thirty-fourth primer set, the thirty-fifth primer set, the thirty-sixth primer set, the thirty-seventh primer set, the thirty-eighth primer set, the thirty-ninth primer set and the fortieth primer set.

[0099] In some embodiments, diseases associated with PKD1 and / or PKD2 mutations include but are not limited to polycystic kidney disease.

[0100] Common variations in PKD1 and / or PKD2 genes include but are not limited to SNV, Indel and exon deletion. Long amplicon primers of PKD1 and / or PKD2 genes, such as primer set 33 to primer set 40, can be used for SNV and Indel detection, and can also be used for the detection of a certain exon deletion contained in the long fragment primer; can be used for the detection of all exons, splicing regions, UTRs and some deep introns.

[0101] In the present application, long amplicon primers related to any one or more genes selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 can also be used to perform full-length gene amplification.

[0102] In some embodiments, the gene is at least two genes selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2. In some embodiments, the nucleic acid product at least detects the variation of the at least two genes. In some embodiments, the nucleic acid product includes at least two sets of primers. In some embodiments, the nucleic acid product includes at least two sets of primers, and the at least two sets of primers are used to amplify at least two different genes selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2. In some embodiments, the at least two sets of primers are amplified under the same amplification system conditions.

[0103] The use of the nucleic acid products described in the present application for the detection of gene variation can also achieve the following: when two or more mutations exist at the same gene locus at the same time, third-generation sequencing can be used to distinguish between cis and trans mutations, and whether the mutations have a linkage effect.

[0104] In a second aspect of the present application, a kit is provided, comprising an amplification system;

[0105] The amplification system comprises the nucleic acid product as described in the first aspect, and one or more of a buffer, a dNTP Mix, a DNA polymerase, gDNA and nuclease-free water.

[0106] In some embodiments, the method of detecting a disease associated with a gene variation in the kit comprises PCR.

[0107] In some embodiments, the method further comprises at least one of electrophoresis and sequencing; the sequencing is optionally selected from the group consisting of first generation sequencing, second generation sequencing and third generation sequencing.

[0108] In a third aspect of the present application, a device for detecting gene variation is provided, wherein the device satisfies one or more of the following features (1) to (2):

[0109] (1) collecting sequence information after amplifying the sample to be tested using the nucleic acid product described in the first aspect or the kit described in the second aspect;

[0110] (2) Analyzing whether a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 is mutated: including analyzing single nucleotide variation, insertion or deletion, and exon deletion / duplication on the gene.

[0111] The amplified product obtained by using the nucleic acid product described in the first aspect, the kit described in the second aspect, or the device described in the third aspect of the present application can be used for first-generation sequencing, second-generation sequencing, third-generation sequencing, and agarose electrophoresis detection. The platform used to implement the second-generation sequencing includes but is not limited to the BGI platform, the Illunima platform, and the Proton platform. The platform used to implement the third-generation sequencing includes but is not limited to Pacbio and Nanopore.

[0112] In the fourth aspect of the present application, a method for sequencing a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 is provided, the method comprising amplifying the gene using the nucleic acid product as described in the first aspect or the kit as described in the second aspect.

[0113] In some embodiments, the amplification conditions include:

[0114] Pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds, extension at 68°C for 30s / Kb, and cycle 30 to 40 times.

[0115] In the fifth aspect of the present application, there is provided use of the nucleic acid product as described in the first aspect, the kit as described in the second aspect, or the device as described in the third aspect in the preparation of a product for detecting diseases associated with gene mutations.

[0116] In some embodiments, the disease associated with the gene variation is selected from the group consisting of spinal muscular atrophy, skin disease, incontinence pigmenti and polycystic kidney disease.

[0117] Some examples are provided below.

[0118] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0119] Example 1

[0120] 1. Primer set design

[0121] Primer set Several upstream and downstream sequences of SMN1 / FLG / IKBKG / PKD1 / PKD2 genes were selected for primer design, and primer specificity analysis and partial full-length gene amplification primers were performed using the website https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome and https: / / www.ncbi.nlm.nih.gov / variation / view / ， The SNP site at the last base of the gene should be avoided.

[0122] When designing primers, some primers were designed using the ARMS method to improve primer specificity. At the same time, considering the convenience of subsequent detection, the uniformity of amplification of multiple gene combinations, and the high GC content, the primer Tm value was 67°C to 80°C, preferably 67°C to 72°C. The primer Tm was calculated based on the Salt Adjusted method or using https: / / crm.vazyme.com / cetool / tmcal.html.

[0123] Two pairs of long amplicon primers and six pairs of short amplicon primers were designed for the SMN1 gene; five pairs of long amplicon primers and 17 pairs of short amplicon primers were designed for the FLG gene; two pairs of long amplicon primers were designed for the IKBKG gene; five pairs of long amplicon primers were designed for PKD1; and three pairs of long amplicon primers were designed for PKD2.

[0124] The specific primer information used for SMN1 / FLG / IKBKG / PKD1 / PKD2 gene variation detection is shown in the following table.

[0125] Table 1

[0126]

[0127]

[0128]

[0129] 2. Primer Application

[0130] Sample requirements: peripheral blood, semen, urinary tract exfoliated cells or oral mucosal epithelial cells

[0131] Specific experimental operation process:

[0132] gDNA was extracted from peripheral blood, semen, urinary tract exfoliated cells or oral mucosal epithelial cells using nucleic acid extraction or purification reagents [Susu Medical Equipment No. 20210902].

[0133] 1) PCR amplification

[0134] Whether it is a short amplicon primer or a long amplicon primer, the same PCR amplification method can be used, and the amplification method is as follows:

[0135] a) Use gDNA as template for regional targeted enrichment. Prepare the amplification reaction mix on an ice box according to the following table:

[0136] Table 2

[0137] Components Volume (μL) Buffer 12.5 dNTP Mix 5 DNA Polymerase 0.5 F Primer 0.75 R Primer 0.75 gDNA50ng 1.5 Nuclease-free water 4 Total volume 25

[0138] b) Vortex to mix and centrifuge briefly.

[0139] c) Place the above PCR tube on the PCR instrument, select "105°C" for "Hot Cover", tighten the hot cover, and set the reaction parameters according to Table 3 below.

[0140] Table 3

[0141]

[0142] 2) Purification of enriched products

[0143] Add AMPure XP magnetic beads to the targeted enrichment product at 0.8× volume, mix with a gun, leave at room temperature for 5 minutes, place on a magnetic stand, wait for the liquid to become clear, remove the supernatant, wash with 200μL of 70% alcohol, repeat once, dry the magnetic beads at room temperature, resuspend the magnetic beads with 25μL Low TE, and elute the DNA. Quantification was performed using the Qubit dsDNA HS Assay Kit.

[0144] The purified products are used for library construction and sequencing according to needs.

[0145] 3. Characterization data and effect data

[0146] 1) SMN1 gene mutation detection

[0147] We recruited a family that had undergone WES testing, and found that the male and his offspring were suspected of having SMN1 c.510_513del. Therefore, we used the reported primers F: GTTGGGGGATCAAATATCTTCTAGTGTT (SEQ ID NO: 81), R: CCCCCACCCCAGTCTTTTACAGATGGT (SEQ ID NO: 82) (DOI: 10.1038 / jhg.2015.16) for verification, and found that neither the male nor the child had SMN1 gene c.510_513del. Therefore, the variation needs to be re-verified. Peripheral blood was collected from the male and the child, and the detection method was used for detection and verification. Genomic DNA from peripheral blood samples was extracted using nucleic acid extraction or purification reagents [Susu Medical Preparation No. 20210902]. The amplification reaction system and reaction parameters are shown in Tables 2 and 3 in "2. Primer Application" above.

[0148] The SMN1 gene LF+LR (sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively) primer set was used for true and false gene detection verification, and the LF1+LR1 (sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively) primer set was used for detection verification of c.510_513del. The amplification reaction system and reaction parameters are shown in Tables 2 and 3 in "2. Primer Application" above. The results are as follows:

[0149] a) In the amplicon region of the LF+LR primer set, the differences in the true and false gene sequences are as follows:

[0150] (1) True gene amplification region sequence (SMN1 gene exon 7):

[0151] GGTTT c AGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA(SEQ ID NO:83)

[0152] (2) Pseudogene amplification region sequence (SMN2 gene exon 7):

[0153] GGTTT t AGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA(SEQ ID NO:84)

[0154] C and T difference detection, sanger sequencing Figure 1 shown.

[0155] b) In the amplicon region of LF1+LR1 (sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively), the differences in the true and false gene sequences are as follows:

[0156] (1) True gene amplification region sequence (partial):

[0157] GAGTTCGAGAACAGCCTGGCCAACATGGCAAAACCCC a TTTCTACTGAAAGTACAAAAAATTAG CCAGGCATGGTGGTGGGGACCTCTAATCCCAGCTACTTGGGAGG c TGAGGCAGGAGAATCACTTGAA CCCAGGAGGCGGAGGCTGCAGTGAGCTGAGATTTACACCACTGCAC (SEQ ID NO:85)

[0158] (2) Pseudogene amplification region sequence (partial):

[0159] GAGTTCGAGAACAGCCTGGCCAACATGGCAAAACCCC g TTTCTACTGAAAGTACAAAAAATTAG CCAGGCATGGTGGTGGGGACCTCTAATCCCAGCTACTTGGGAGG t TGAGGCAGGAGAATCACTTGAA CCCAGGAGGCGGAGGCTGCAGTGAGCTGAGATTTACACCACTGCAC (SEQ ID NO:86)

[0160] A and G difference detection, Sanger sequencing map Figure 2 As shown; C and T difference detection, Sanger sequencing map is as follows Figure 3 shown.

[0161] The male's Sanger sequencing map is as follows Figure 5 The Sanger sequencing map of the patient is shown in Figure 6 shown.

[0162] According to the Sanger sequencing results, the amplicon was the target fragment, and both the man and the child had the SMN1 gene c.510_513del heterozygous deletion.

[0163] Using the PCR amplification products of SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 as templates, nested PCR was performed using SMN1 short primers DF1+DR1 (sequences shown in SEQ ID NO:5 and SEQ ID NO:6, respectively), DF2+DR2 (sequences shown in SEQ ID NO:7 and SEQ ID NO:8, respectively), DF3+DR3 (sequences shown in SEQ ID NO:9 and SEQ ID NO:10, respectively), DF4+DR4 (sequences shown in SEQ ID NO:11 and SEQ ID NO:12, respectively), DF5+DR5 (sequences shown in SEQ ID NO:13 and SEQ ID NO:14, respectively) and DF6+DR6 (sequences shown in SEQ ID NO:15 and SEQ ID NO:16, respectively). The quality inspection results of agarose gel electrophoresis are as follows: Fig.13 shown.

[0164] The DF6+DR6 (sequences are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively) primer amplicon sequences were subjected to Sanger sequencing, and 6 specific sites for distinguishing true and false genes were identified, such as Figure 14 to Figure 16 shown.

[0165] The above results show that long amplification primers can effectively distinguish true and false genes, and at the same time, nested PCR can be effectively performed using short amplicon primers.

[0166] 2) FLG gene SNVs mosaicism detection and SNVs and Indels verification

[0167] We recruited one patient who had undergone WES testing. He developed the disease in childhood and was visually diagnosed with ichthyosis by a doctor at the age of 17. He had a family history of genetic diseases. According to the test results, he had the FLG gene NM_002016.1:c.8442_8452delCCATCACAGCC (p.Ser2817Ilefs*6), but due to technical limitations, it could not be verified, and the possibility of false positives was not ruled out. Therefore, it is necessary to re-verify the variant, and peripheral blood is now taken for detection and verification using this detection method. The genomic DNA of peripheral blood samples was extracted using nucleic acid extraction or purification reagents [Su Su Medical Preparation No. 20210902]. The extracted DNA was amplified, and the amplification reaction system and reaction parameters are shown in Tables 2 and 3 in "2. Primer Application" above.

[0168] (1) Full-length primers LF1+LR1 (sequences shown in SEQ ID NO: 19 and SEQ ID NO: 20, respectively) and LF3+LR3 (sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively) were used for third-generation sequencing. The IGV was detected as shown in Figure 2. Figure 7 shown.

[0169] (2) Sanger sequencing using short amplification

[0170] The sample gDNA was directly amplified by PCR using the primer combination of DF3+DR3-1 (sequences are shown in SEQ ID NO: 33 and 34, respectively), and the amplified product was sequenced by Sanger sequencing. The Sanger sequencing map is shown in Figure 8 shown.

[0171] Both full-length primer third-generation sequencing and short amplicon primer direct amplification Sanger verification showed that the sample contained the FLG gene NM_002016.1:c.8442_8452delCCATCACAGCC (p.Ser2817Ilefs*6), which was a mosaic deletion.

[0172] Specificity analysis was performed using long fragment primers LF+LR (sequences as shown in SEQ ID NO: 17 and SEQ ID NO: 18, respectively), LF1+LR1 (sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20, respectively), LF2+LR1 (sequences as shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively), LF3+LR3 (sequences as shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively), and LF3+LR4 (sequences as shown in SEQ ID NO: 25 and SEQ ID NO: 26, respectively). The electrophoresis diagram of the amplification primers is shown in FIG. Fig.17 .

[0173] Seven patients were recruited and underwent WES testing. According to the test results, they had FLG gene NM_002016.2:c.6950_6957del, NM_002016.2:c.3321del, NM_002016.2:c.2476C>T, NM_002016.2:c.2476C>T, NM_002016.2:c.6449del, NM_002016 .2:c.6834_6838del and NM_002016.2:c.7264G>T, NM_002016.2:c.477dup and NM_002016.2:c.10624del (homozygous), but due to technical limitations, verification could not be performed and the possibility of false positives could not be ruled out. Therefore, this protocol was used for verification, in which some short amplicon primers DF8+DR8 (sequences as SEQ : SEQ ID NO:43 and SEQ ID NO:44), DF9+DR9 (sequences are shown in SEQ ID NO:45 and SEQ ID NO:46, respectively), DF9+DR9-1 (sequences are shown in SEQ ID NO:47 and SEQ ID NO:48, respectively), DF11+DR11 (sequences are shown in SEQ ID NO:57 and SEQ ID NO:58, respectively), DF12+DR12 (sequences are shown in SEQ ID NO:59 and SEQ ID NO:60, respectively), DF9+DR9-2 (sequences are shown in SEQ ID NO:49 and SEQ ID NO:50, respectively), DF9+DR9-3 (sequences are shown in SEQ ID NO:51 and SEQ ID NO:52, respectively), DF10+DR10 (sequences are shown in SEQ ID NO:53 and SEQ ID NO:54, respectively), DF10-1+DR10 (sequences are shown in SEQ ID NO:55 and SEQ ID NO:56, respectively) agarose gel electrophoresis quality inspection spectrum, as shown in Fig.18 shown.

[0174] The results of Sanger sequencing of the amplified products of primers NM_002016.2:c.6950_6957del DF4+DR4 (sequences are shown in SEQ ID NO:35 and SEQ ID NO:36, respectively) are shown in Fig.19 .

[0175] The sanger sequencing results of the amplified products of NM_002016.2:c.3321del DF9+DR9-2 primers (sequences are shown in SEQ ID NO:49 and SEQ ID NO:50, respectively) are shown in Fig. 20 .

[0176] The sanger sequencing results of the amplified products of NM_002016.2:c.3321del DF9+DR9-3 primers (sequences are shown in SEQ ID NO:51 and SEQ ID NO:52, respectively) are shown in Fig.21 .

[0177] NM_002016.2:c.2476C>T, DF10+DR10 primers (sequences are shown in SEQ ID NO:53 and SEQ ID NO:54, respectively) amplified product Sanger sequencing results are shown in Fig. 22 .

[0178] The results of Sanger sequencing of the amplified product of primers NM_002016.2:c.2476C>T DF10-1+DR10 (sequences are shown in SEQ ID NO:55 and SEQ ID NO:56, respectively) are shown in Fig.23 .

[0179] The results of Sanger sequencing of the amplified products of primers NM_002016.2:c.6449del DF6+DR6 (sequences are shown in SEQ ID NO:39 and SEQ ID NO:40, respectively) are shown in Fig.24 .

[0180] The results of Sanger sequencing of the amplified products of primers NM_002016.2:c.6834_6838del DF5+DR5 (sequences are shown in SEQ ID NO:37 and SEQ ID NO:38, respectively) are shown in Fig.25 .

[0181] The results of Sanger sequencing of the amplified products of primers NM_002016.2:c.7249C>T DF4+DR4 (sequences are shown in SEQ ID NO:35 and SEQ ID NO:36, respectively) are shown in Fig.26 .

[0182] The results of sanger sequencing of the amplified products of primers NM_002016.2:c.7264G>T DF5+DR5 (sequences are shown in SEQ ID NO:37 and SEQ ID NO:38, respectively) are shown in Fig. 27 .

[0183] The results of Sanger sequencing of the amplified product of primers NM_002016.2:c.477dup DF12+DR12 (sequences are shown in SEQ ID NO:59 and SEQ ID NO:60, respectively) are shown in Fig.28 .

[0184] The sanger sequencing results of the amplified products of NM_002016.2:c.10624del DF1+DR1 primers (sequences are shown in SEQ ID NO:27 and SEQ ID NO:28, respectively) are shown in Fig.29 .

[0185] 3) IKBKG gene deletion and mutation detection and verification

[0186] We recruited two families of patients suspected of incontinence pigmenti who had undergone WES testing. The male in family 1 was normal, and the WES of the female and the child suggested suspected IKBKG exon deletion; the WES of the female in another family suggested suspected IKBKG gene NM_003639.4:c.1161dupC. Due to the interference of pseudogenes, NM_003639.4:c.1161dupC could not be judged as true or false. Therefore, it is necessary to re-verify the variant. Peripheral blood was collected from both male and female families and the child in family 1, and peripheral blood from the female in family 2 was used for detection and verification using this detection method. Genomic DNA from peripheral blood samples was extracted using nucleic acid extraction or purification reagents [Susu Medical Preparation No. 20210902]. The amplification reaction system and reaction parameters are shown in Tables 2 and 3 in "2. Primer Application" above.

[0187] Family 1:

[0188] PCR amplification was performed using the LF+LR primer set of the IKBKG gene (sequences are shown in SEQ ID NO:61 and SEQ ID NO:62, respectively), and the amplified product was detected by agarose gel electrophoresis and Sanger sequencing. Fig. 9 shown.

[0189] Sanger sequencing, the female's profile is as follows Fig.10 As shown, the patient's atlas is as follows Fig.11 shown.

[0190] According to the test results, both the girl and the child had a deletion of exons 4-10 of the IKBKG gene, and the precise breakpoints were ChrX:153786229 and ChrX:153797930.

[0191] Family 2:

[0192] PCR amplification was performed using the IKBKG gene LF1+LR1 primer set (sequences are shown in SEQ ID NO:63 and SEQ ID NO:64, respectively), and the amplified product was subjected to Sanger sequencing. The Sanger sequencing map is as follows Figure 4 shown.

[0193] According to the test results, the female had a heterozygous mutation in the IKBKG gene NM_003639.4:c.1161dupC.

[0194] 4) PKD1 / PKD2 coverage

[0195] Targeted amplification was performed using full-length amplification primers for PKD1 and PKD2 genes, and the amplified products were used for second-generation library construction to determine the coverage of each amplicon. The specific results are shown in Table 4.

[0196] Table 4

[0197]

[0198] Detection performance verification

[0199] We recruited a patient with polycystic kidney disease who had undergone WES testing and was found to have NM_001009944.3:c.10094T>C. Considering the particularity of the gene, the mutation needed to be revalidated. We collected peripheral blood from the patient and used this detection method for second-generation sequencing and first-generation detection verification.

[0200] The PKD1 / PKD2 gene primer set (5 pairs of primers for PKD1 gene and 3 pairs of primers for PKD2 gene) was used for detection, and the second-generation sequencing variation call results are shown in Table 5.

[0201] Table 5

[0202]

[0203]

[0204]

[0205] First Generation Verification

[0206] The PKD1 gene LF3+LR3 (sequences are shown in SEQ ID NO: 71 and 72, respectively) was subjected to Sanger sequencing verification. The Sanger sequencing map is shown in Fig.12 shown.

[0207] This primer set can effectively cover the target area and can effectively detect. According to the test results, the test results of the primer set of this application are consistent with the known results, with a consistency rate of 100%, and the sequencing depth meets the requirements.

[0208] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0209] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. A nucleic acid product for detecting gene variation, characterized in that: The nucleic acid product includes one or more of the following primer sets: The first primer set: the sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; The second primer set: the sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively; The third primer set: the sequences are shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively; The fourth primer set: the sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively; The fifth primer set: the sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively; The sixth primer set: the sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively; The seventh primer set: the sequences are shown in SEQ ID NO: 13 and SEQ ID NO: 14 respectively; The eighth primer set: the sequences are shown in SEQ ID NO: 15 and SEQ ID NO: 16 respectively; The ninth primer set: the sequences are shown in SEQ ID NO: 17 and SEQ ID NO: 18 respectively; The tenth primer set: the sequences are shown in SEQ ID NO: 19 and SEQ ID NO: 20 respectively; The eleventh primer set: the sequences are shown in SEQ ID NO: 21 and SEQ ID NO: 22 respectively; The twelfth primer set: the sequences are shown in SEQ ID NO: 23 and SEQ ID NO: 24 respectively; Thirteenth primer set: the sequences are shown in SEQ ID NO: 25 and SEQ ID NO: 26 respectively; Fourteenth primer set: the sequences are shown in SEQ ID NO: 27 and SEQ ID NO: 28 respectively; The fifteenth primer set: the sequences are shown in SEQ ID NO: 29 and SEQ ID NO: 30 respectively; The sixteenth primer set: the sequences are shown in SEQ ID NO:31 and SEQ ID NO:32 respectively; The seventeenth primer set: the sequences are shown in SEQ ID NO: 33 and SEQ ID NO: 34 respectively; The eighteenth primer set: the sequences are shown in SEQ ID NO: 35 and SEQ ID NO: 36 respectively; Nineteenth primer set: the sequences are shown in SEQ ID NO: 37 and SEQ ID NO: 38 respectively; The 20th primer set: the sequences are shown in SEQ ID NO:39 and SEQ ID NO:40 respectively; The twenty-first primer set: the sequences are shown in SEQ ID NO:41 and SEQ ID NO:42 respectively; The 22nd primer set: the sequences are shown in SEQ ID NO:43 and SEQ ID NO:44 respectively; The twenty-third primer set: the sequences are shown in SEQ ID NO:45 and SEQ ID NO:46 respectively; The twenty-fourth primer set: the sequences are shown in SEQ ID NO:47 and SEQ ID NO:48 respectively; The twenty-fifth primer set: the sequences are shown in SEQ ID NO:49 and SEQ ID NO:50 respectively; The twenty-sixth primer set: the sequences are shown in SEQ ID NO:51 and SEQ ID NO:52 respectively; The twenty-seventh primer set: the sequences are shown in SEQ ID NO:53 and SEQ ID NO:54 respectively; Primer set 28: the sequences are shown in SEQ ID NO:55 and SEQ ID NO:56 respectively; The twenty-ninth primer set: the sequences are shown in SEQ ID NO: 57 and SEQ ID NO: 58 respectively; The 30th primer set: the sequences are shown in SEQ ID NO:59 and SEQ ID NO:60 respectively; The thirty-first primer set: the sequences are shown in SEQ ID NO:61 and SEQ ID NO:62 respectively; The thirty-second primer set: the sequences are shown in SEQ ID NO:63 and SEQ ID NO:64 respectively; The thirty-third primer set: the sequences are shown in SEQ ID NO: 65 and SEQ ID NO: 66 respectively; The thirty-fourth primer set: the sequences are shown in SEQ ID NO: 67 and SEQ ID NO: 68 respectively; The thirty-fifth primer set: the sequences are shown in SEQ ID NO: 69 and SEQ ID NO: 70 respectively; The thirty-sixth primer set: the sequences are shown in SEQ ID NO: 71 and SEQ ID NO: 72 respectively; The thirty-seventh primer set: the sequences are shown in SEQ ID NO: 73 and SEQ ID NO: 74 respectively; Primer set 38: the sequences are shown in SEQ ID NO: 75 and SEQ ID NO: 76 respectively; The thirty-ninth primer set: the sequences are shown in SEQ ID NO: 77 and SEQ ID NO: 78 respectively; The 40th primer set: the sequences are shown in SEQ ID NO: 79 and SEQ ID NO: 80 respectively.

2. The nucleic acid product according to claim 1, characterized in that The nucleic acid product includes one or more of the following primer sets: The first primer set, the second primer set, the third primer set, the fourth primer set, the fifth primer set, the sixth primer set, the seventh primer set, the eighth primer set, the ninth primer set, the tenth primer set, the eleventh primer set, the twelfth primer set, the thirteenth primer set, the fourteenth primer set, the seventeenth primer set, the eighteenth primer set, the nineteenth primer set, the twentieth primer set, the twenty-second primer set, the twenty-third primer set, the twenty-fourth primer set, the twenty-fifth primer set, the twenty-sixth primer set, the twenty-seventh primer set, the twenty-eighth primer set, the twenty-ninth primer set, the thirtieth primer set, the thirty-first primer set, the thirty-second primer set, and the thirty-sixth primer set.

3. The nucleic acid product according to claim 1, characterized in that The gene is selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2; Optionally, the primer set satisfies one or more of the following features 1) to 4): 1) The primer set for amplifying the SMN1 is selected from the group consisting of the first primer set, the second primer set, the third primer set, the fourth primer set, the fifth primer set, the sixth primer set, the seventh primer set and the eighth primer set; 2) the primer set for amplifying the FLG is selected from the group consisting of the ninth primer set, the tenth primer set, the eleventh primer set, the twelfth primer set, the thirteenth primer set, the fourteenth primer set, the fifteenth primer set, the sixteenth primer set, the seventeenth primer set, the eighteenth primer set, the nineteenth primer set, the twentieth primer set, the twenty-first primer set, the twenty-second primer set, the twenty-third primer set, the twenty-fourth primer set, the twenty-fifth primer set, the twenty-sixth primer set, the twenty-seventh primer set, the twenty-eighth primer set, the twenty-ninth primer set and the thirtieth primer set; 3) The primer set for amplifying the IKBKG is selected from the group consisting of the thirty-first primer set and the thirty-second primer set; as well as 4) The primer set for amplifying the PKD1 and / or the PKD2 is selected from the group consisting of the thirty-third primer set, the thirty-fourth primer set, the thirty-fifth primer set, the thirty-sixth primer set, the thirty-seventh primer set, the thirty-eighth primer set, the thirty-ninth primer set and the fortieth primer set.

4. The nucleic acid product according to any one of claims 1 to 3, characterized in that The genetic variation is selected from the group consisting of single nucleotide variation, insertion or deletion, exon deletion and monomeric sequence tandem duplication.

5. A kit, characterized in that: It comprises an amplification system; The amplification system comprises the nucleic acid product according to any one of claims 1 to 4, and: One or more of buffer, dNTP Mix, DNA polymerase, gDNA and nuclease-free water; Optionally, the method of the kit for detecting diseases associated with gene mutations includes PCR; Further optionally, the method also includes at least one of electrophoresis and sequencing; the sequencing is optionally selected from the group consisting of first-generation sequencing, second-generation sequencing and third-generation sequencing.

6. A device for detecting gene mutation, characterized in that: The device satisfies one or more of the features (1) to (2): (1) collecting sequence information after amplifying a sample using the nucleic acid product according to any one of claims 1 to 4 or the kit according to claim 5; (2) Analyzing whether a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2 is mutated: including analyzing single nucleotide variation, insertion or deletion, and exon deletion / duplication on the gene.

7. A method for sequencing a gene selected from the group consisting of SMN1, FLG, IKBKG, PKD1 and PKD2, characterized in that: The method comprises amplifying the gene using the nucleic acid product according to any one of claims 1 to 4 or the kit according to claim 5.

8. The method according to claim 7, characterized in that The amplification conditions include: Pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds, extension at 68°C for 30s / Kb, and cycle 30 to 40 times.

9. Use of the nucleic acid product according to any one of claims 1 to 4, the kit according to claim 5, or the device according to claim 6 in the preparation of a product for detecting a disease associated with gene variation.

10. The use according to claim 9, characterized in that The disease associated with the gene variation is selected from the group consisting of spinal muscular atrophy, skin disease, incontinence pigmenti and polycystic kidney disease.

Images