Biomarker combination for early diagnosis of gastric cancer as well as detection reagent and application of biomarker combination

Abstract

The invention provides a gastric cancer early diagnosis biomarker combination and a detection reagent and application thereof, and belongs to the technical field of biological detection. The biomarker combination provided by the invention is composed of chr8: 53852064, chr12: 10541790, chr14: 22931150, and chr16: 58497231, and is characterized in that the biomarker combination is prepared from the following raw materials in parts by weight: 1, 1, 2, 3, 4, 5, 6, 7, 8, 7, 8, 10 The sensitivity, the specificity and the accuracy of the kit prepared from the biomarker combination can reach 92.00%, 96.67% and 93.75% respectively, and the operation gradually changes rapidly. The invention provides a technical guarantee for further development of accurate and efficient gastric cancer early diagnosis reagents.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a biomarker combination for early diagnosis of gastric cancer, a detection reagent and an application thereof. Background Art

[0002] Gastric cancer (GC) is one of the common tumors of the digestive tract and a malignant tumor that begins in the gastric mucosal epithelium. In recent years, the incidence and mortality of gastric cancer have been at a high level among global tumor diseases, seriously endangering human health. In clinical practice, gastric cancer can be divided into two types according to the depth of tumor lesion infiltration: early gastric cancer (EGC) and advanced gastric cancer (AGC). Early gastric cancer is expected to achieve a radical effect through early clear diagnosis and active and effective endoscopic treatment. However, EGC patients often lack more typical clinical symptoms and are easily misdiagnosed as other gastric diseases. Even if there are corresponding symptoms, they are very mild and not easy to attract people's attention. People often go to the doctor only when they have obvious discomfort symptoms. As a result, most patients have developed into advanced gastric cancer when they first visit the doctor. At this time, patients often miss the best time for treatment and have a poor prognosis.

[0003] At present, ordinary white light endoscopy plus endoscopic biopsy is the most commonly used examination method for diagnosing EGC. It has the advantages of convenient operation, low technical requirements and relatively favorable price, and is regarded as the first choice for EGC screening. Early gastric cancer lesions are relatively superficial, and white light endoscopy often shows slight color changes of the mucosa, mucosal vascular changes, or mucosal roughness and erosion, which are not easy to distinguish from inflammatory lesions. The clarity and magnification of the mucosal image under ordinary white light endoscopy are limited, and it is impossible to accurately locate the sampling site of the malignant lesion. The biopsy has a certain degree of randomness and blindness. The deviation of the biopsy sampling location can cause the difference in pathological diagnosis between inflammation and early gastric cancer, which is easy to cause the missed diagnosis of early gastric cancer and directly affect the prognosis of the patient. According to studies, there are still certain differences between endoscopic biopsy and subsequent resection specimens. Some lesions cannot be correctly diagnosed by tissue biopsy, which makes it difficult to choose the correct treatment method. If the specimen is not accurately taken by endoscopic biopsy forceps, the potential malignant structure lesions may be missed, resulting in misdiagnosis and improper treatment strategies.

[0004] Therefore, improving the detection rate of EGC is a major problem that needs to be solved urgently. The key to improving the prognosis and survival of gastric malignant tumors is to achieve "three early" for the disease, namely early detection, early diagnosis and early active and effective treatment. Finding reliable and non-invasive early diagnosis methylation sites for early detection and large-scale screening of gastric cancer has important clinical significance. Summary of the invention

[0005] In view of the above shortcomings, the present invention aims to provide a combination of biomarkers for early diagnosis of gastric cancer, its detection reagent and application. The biomarker combination provided by the present invention consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231. The biomarker combination provided by the present invention consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231. The sensitivity, specificity and accuracy of the kit prepared using the biomarker combination of the present invention can reach 92.00%, 96.67% and 93.75% respectively, and the operation is gradual and fast. The present invention provides technical guarantee for the further development of accurate and efficient early diagnosis reagents for gastric cancer.

[0006] The technical solution of the present invention includes:

[0007] In a first aspect, the present invention provides a biomarker combination, which consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

[0008] In a second aspect, the present invention provides a detection reagent for detecting the methylation status of a biomarker combination, wherein the detection reagent comprises primers and probes, and the methylation biomarker combination consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

[0009] Specifically, the nucleotide sequence of the primer is shown in SEQ ID NO.1-8.

[0010] Preferably, the nucleotide sequence of the forward primer of chr8:53852064 is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2.

[0011] Preferably, the nucleotide sequence of the forward primer of chr12:10541790 is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0012] Preferably, the nucleotide sequence of the forward primer of chr14:22931150 is shown as SEQ ID NO.5, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.6.

[0013] Preferably, the nucleotide sequence of the forward primer of chr16:58497231 is shown as SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.8.

[0014] Specifically, the nucleotide sequence of the probe is shown in SEQ ID NO.9-12.

[0015] Preferably, the nucleotide sequence of the probe of chr8:53852064 is as shown in SEQ ID NO.9.

[0016] Preferably, the nucleotide sequence of the probe of chr12:10541790 is as shown in SEQ ID NO.10.

[0017] Preferably, the nucleotide sequence of the probe of chr14:22931150 is as shown in SEQ ID NO.11.

[0018] Preferably, the nucleotide sequence of the probe of chr16:58497231 is as shown in SEQ ID NO.12.

[0019] Specifically, the probe may be labeled with a fluorescent group or a quenching group at the 5' end or the 3' end.

[0020] Preferably, the probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end.

[0021] More preferably, the fluorescent group is FAM; and the quenching group is BHQ1.

[0022] Specifically, the final concentration of the primers and probes in the detection reagent is 50-200 nM.

[0023] Preferably, the final concentration of the primer of chr8:53852064 is 100 nM, and the final concentration of the probe is 150 nM.

[0024] Preferably, the final concentration of the primer of chr12:10541790 is 100 nM, and the final concentration of the probe is 150 nM.

[0025] Preferably, the final concentration of the primer of chr14:22931150 is 100 nM, and the final concentration of the probe is 150 nM.

[0026] Preferably, the final concentration of the primer of chr16:58497231 is 200 nM, and the final concentration of the probe is 200 nM.

[0027] In a third aspect, the present invention provides the use of the above-mentioned biomarker combination or detection reagent in the preparation of a kit for early diagnosis of gastric cancer.

[0028] In a fourth aspect, the present invention provides a kit for early diagnosis of gastric cancer, wherein the kit comprises the above-mentioned biomarker combination or detection reagent.

[0029] Specifically, the kit further comprises one or more of DNA polymerase, dNTPs, PCR reaction buffer, positive quality control product, and negative quality control product.

[0030] Preferably, the positive quality control product is bisulfite-modified fully methylated human genomic DNA.

[0031] Preferably, the negative control material is bisulfite-modified non-methylated human genomic DNA.

[0032] The beneficial effects of the present invention are:

[0033] The sensitivity, specificity and accuracy of the kit prepared by using the biomarker combination of the present invention can reach 92.00%, 96.67% and 93.75% respectively, and the operation is fast. The present invention provides technical guarantee for further developing accurate and efficient early diagnosis reagents for gastric cancer. Specific embodiments

[0034] The present invention is described below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention so that the technical solution of the present invention is easier to understand and grasp. The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0035] Example 1 Biomarker combination and primers and probes thereof

[0036] The present invention provides a biomarker combination for early diagnosis of gastric cancer, which consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231. The primer sequence of the biomarker combination is shown in Table 1, and the probe sequence of the biomarker combination is shown in Table 2.

[0037] Table 1 Primer and probe sequences of biomarkers

[0038]

[0039] Note: "F" in the table stands for forward primer, and "R" stands for reverse primer.

[0040] Table 2 Primer and probe sequences of biomarkers

[0041]

[0042]

[0043] Example 2 Preparation and use of gastric cancer early diagnosis kit

[0044] The gastric cancer early diagnosis kit of the present invention comprises a PCR premix, a positive quality control product and a negative quality control product. The positive quality control product is bisulfite-modified fully methylated human genomic DNA, and the negative quality control product is bisulfite-modified non-methylated human genomic DNA.

[0045] 1. Preparation of primer-probe mixture:

[0046] Prepare primer-probe mix according to the composition in Table 3.

[0047] Table 3 Primer probe mixture

[0048]

[0049] Note: "F" in the table stands for forward primer, "R" stands for reverse primer, and "P" stands for probe.

[0050] The nucleotide sequence of the forward primer of the ACTB internal reference is shown in SEQ ID NO.13, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.14, and the nucleotide sequence of the probe is shown in SEQ ID NO.15.

[0051] SEQ ID NO.13: TGGTGATGGAGGAGGTTTAGTAAGT;

[0052] SEQ ID NO.14: AACCAATAAAAACCTACTCCTCCCTTAAA;

[0053] SEQ ID NO.15: VIC-ACCACCACCCAACACACAATAACAAACACA-BHQ1

[0054] 2. Preparation of PCR premix:

[0055] Prepare PCR master mix according to the components in Table 4.

[0056] Table 4 PCR premix

[0057] Components Volume (μL) Final concentration 4× Primer Probe Blocker Mix 5 1× 4× Enzyme Mix 5 1× Total reaction volume 10 none

[0058] The enzyme mixture comprises 10×PCR buffer, MgCl2, dNTP and DNA polymerase, and the volume ratio of 10×PCR buffer, MgCl2, dNTP and DNA polymerase is 10:6:2:1.

[0059] 3. PCR amplification

[0060] The amplification system of the present invention is shown in Table 4:

[0061] Table 4 PCR amplification system

[0062] Components volume Master mix 5μL DNA 1μL <![CDATA[ddH2O]]> 4μL

[0063] The PCR amplification program of the present invention is shown in Table 5:

[0064] Table 5 PCR amplification program

[0065]

[0066] 4. PCR result interpretation criteria

[0067] The PCR result interpretation criteria are as follows:

[0068] If the Ct value of the VIC fluorescence channel is ≤35, the experiment is valid; if the Ct value of the VIC fluorescence channel is >35 or there is no amplification, the experiment is invalid and needs to be repeated.

[0069] Positive interpretation: ΔCt>2.0157 and the amplification curve of the FAM channel is S-shaped;

[0070] Negative interpretation: ΔCt≤2.0157 or no amplification in the FAM channel;

[0071] ΔCt=Ct value of VIC fluorescence channel × Ct value of FAM fluorescence channel.

[0072] Comparative Example 1 Preparation and Use of Gastric Cancer Early Diagnosis Kit

[0073] The difference between Comparative Example 1 and Example 2 is only that: "1. Preparation of primer-probe mixture" is different.

[0074] Prepare primer-probe mixture according to the composition in Table 6.

[0075] Table 6 Primer probe mixture

[0076]

[0077] Note: "F" in the table stands for forward primer, "R" stands for reverse primer, and "P" stands for probe.

[0078] Comparative Example 2 Preparation and Use of Gastric Cancer Early Diagnosis Kit

[0079] The difference between Comparative Example 2 and Example 2 is only that: "1. Preparation of primer-probe mixture" is different.

[0080] Prepare primer-probe mix according to the composition in Table 7.

[0081] Table 7 Primer probe mixture

[0082]

[0083]

[0084] Note: "F" in the table represents forward primer, "R" represents reverse primer, and "P" represents probe. Comparative Example 3 Preparation and Use of Gastric Cancer Early Diagnosis Kit

[0085] The difference between Comparative Example 3 and Example 2 is only in: "1. Preparation of primer-probe mixture". A primer-probe mixture was prepared according to the components in Table 8.

[0086] Table 8 Primer probe mixture

[0087]

[0088] Note: "F" in the table represents forward primer, "R" represents reverse primer, and "P" represents probe. Experimental Example 1 Application of Gastric Cancer Early Diagnosis Kit

[0089] The research subjects of this example are: 50 gastric cancer patients confirmed by histopathology and 30 healthy volunteers. 3 mL of blood was taken from the research subjects, peripheral blood mononuclear cells were separated, genomic DNA was extracted and sulfite converted, and PCR amplification and detection were performed using the kits prepared in Example 2 and Comparative Examples 1-3, respectively. The measurement results are shown in Table 9.

[0090] Table 9 Measurement results

[0091]

[0092] The test results show that the kit prepared in Example 2 of the present invention has the highest sensitivity, specificity and accuracy, which are 92.00%, 96.67% and 93.75% respectively, and can be used for early diagnosis of gastric cancer.

[0093] The above detailed description is a specific description of one of the feasible embodiments of the present invention, and the embodiment is not intended to limit the scope of the present invention. It should be pointed out that any equivalent implementation or change that does not deviate from the present invention should be included in the scope of the technical solution of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached requirements.

Claims

1. A biomarker combination, characterized in that: The biomarker combination consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

2. A detection reagent for detecting the methylation status of a biomarker combination, characterized in that: The detection reagent includes primers and probes, and the methylation biomarker combination consists of chr8:53852064, chr12:10541790, chr14:22931150 and chr16:58497231.

3. The detection reagent according to claim 2, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NO.1-8; The nucleotide sequence of the forward primer of chr8:53852064 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer of chr12:10541790 is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; The nucleotide sequence of the forward primer of chr14:22931150 is shown in SEQ ID NO.5, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6; The nucleotide sequence of the forward primer of chr16:58497231 is shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

8.

4. The detection reagent according to claim 2, characterized in that The nucleotide sequences of the probes are shown in SEQ ID NOs. 9-12; The nucleotide sequence of the probe of chr8:53852064 is shown in SEQ ID NO.9; The nucleotide sequence of the probe of chr12:10541790 is shown in SEQ ID NO.10; The nucleotide sequence of the probe of chr14:22931150 is shown in SEQ ID NO.11; The nucleotide sequence of the probe of chr16:58497231 is shown in SEQ ID NO.

12.

5. The detection reagent according to claim 3, characterized in that The probe may be labeled with a fluorescent group or a quenching group at the 5' end or the 3' end.

6. The detection reagent according to claim 5, characterized in that The fluorescent group is FAM; the quenching group is BHQ1.

7. The detection reagent according to claim 2, characterized in that The final concentration of the primers and probes in the detection reagent is 50-200 nM.

8. Use of the biomarker combination according to claim 1 and the detection reagent according to any one of claims 2 to 7 in the preparation of a kit for early diagnosis of gastric cancer.

9. A kit for early diagnosis of gastric cancer, characterized in that: The kit comprises the biomarker combination according to claim 1 and the detection reagent according to any one of claims 2-7.

10. The kit according to claim 9, characterized in that The kit also includes one or more of DNA polymerase, dNTPs, PCR reaction buffer, positive quality control products, and negative quality control products.

Images