A therapeutic target for lymph node metastatic breast cancer and its application

Abstract

The present invention relates to the field of biomedicine, and more particularly to a therapeutic target for lymph node metastatic breast cancer and its application. The exosomal piR-hsa-28212 of the present invention can synergistically enhance VEGFC / VEGFR3 signaling, thereby promoting lymphangiogenesis in breast cancer, demonstrating its potential as a therapeutic target for lymph node metastatic breast cancer. Furthermore, piR-hsa-28212 is significantly upregulated in serum exosomes from breast cancer patients with lymph node metastasis, suggesting its potential as a serum marker for predicting lymph node metastasis in breast cancer. It offers the advantages of being noninvasive, stable in vitro, and readily available in specimens.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a therapeutic target for lymph node metastasis breast cancer and an application thereof. Background Art

[0002] Breast cancer (BC) is one of the most common cancers worldwide, accounting for 32% of female cancers. Although increasing evidence indicates that lymph node (LN) metastasis is a poor prognostic factor for breast cancer, the precise mechanisms driving LN metastasis remain unclear. Therefore, fully elucidating the molecular mechanisms that trigger LN metastasis in breast cancer is of great clinical significance for identifying effective drug targets for therapeutic intervention in breast cancer patients.

[0003] The vascular endothelial growth factor C (VEGFC) / VEGF receptor 3 (VEGFR3) pathway is one of the most well-recognized lymph node metastasis signals in various tumors. The interaction between VEGFC and VEGFR3 has the potential to activate the formation and expansion of tumor-associated lymphatic vessels, thereby promoting the spread of cancer cells to lymph nodes, promoting tumor progression, and fostering distant metastasis. However, the precise mechanisms by which coordinated stimulation of VEGFC / VEGFR3 signaling promotes lymph node metastasis in BC remain to be fully elucidated.

[0004] Exosomes are nanoscale lipid bilayer vesicles ranging in diameter from 30 to 150 nm that harbor tissue-specific anchoring proteins to facilitate targeted endocytosis in recipient cells. Tumor-derived exosomes carry bioactive molecules and facilitate communication between tumor cells and the tumor microenvironment (TME). This transport is crucial for establishing a premetastatic niche, a key step in cancer metastasis.

[0005] Exosomes have the ability to penetrate the lymphatic system through the stroma, thereby acting as effective mediators of communication between tumor cells and the lymphatic system. PIWI-interacting RNAs (piRNAs), which are 24-32 nucleotides in length and have 2'-O-methylated 3' ends, represent the largest class of small noncoding RNAs. PiRNAs have been shown to exert pro- and anti-cancer effects by directly binding to PIWI proteins (highly conserved RNA-binding proteins) to form the RNA-induced silencing complex (RISC). PiRNAs can be encapsulated into exosomes and released into the circulation, where they are subsequently taken up by recipient cells to exert their biological functions. The widespread distribution of piRNAs within exosomes and their important regulatory functions enhance their potential as key players in cancer lymphatic metastasis. While numerous studies have focused on exosomal miRNAs, lncRNAs, and circRNAs, the role of exosomal piRNAs in breast cancer lymph node metastasis remains underexplored. Summary of the Invention

[0006] In order to make up for the deficiencies of the prior art, the present invention provides a target for treating lymph node metastatic breast cancer and its application.

[0007] The present invention is achieved through the following technical solutions:

[0008] In the first aspect, the present invention provides a therapeutic target for lymph node metastatic breast cancer. The target piR-hsa-28212 sequence is shown in SEQ ID NO.1. piR-hsa-28212 activates the METTL3 / IGF2BP2-m6A signaling pathway, leading to increased VEGFC expression and secretion.

[0009] In a second aspect, the present invention provides the use of the target piR-hsa-28212 in the preparation of a diagnostic product for lymph node metastatic breast cancer.

[0010] Compared with the prior art, the present invention has the following advantages:

[0011] (1) The exosomal piR-hsa-28212 of the present invention synergistically enhances VEGFC / VEGFR3 signaling, thereby promoting lymphangiogenesis in breast cancer, indicating its potential as a therapeutic target for lymphatic metastasis of breast cancer.

[0012] (2) piR-hsa-28212 was significantly upregulated in serum exosomes of breast cancer patients with lymph node metastasis, and can be used as a serum marker for predicting breast cancer lymph node metastasis. It has the advantages of being non-invasive, stable in vitro, and easy to obtain specimens. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The present invention will be further described below with reference to the accompanying drawings.

[0014] Figure 1 Figures 1 and 2 show the experimental validation of piR-hsa-28212 overexpression. Figure A shows qRT-PCR analysis confirming the dysregulated expression of piRNAs in serum exosomes from 28 LN- and 28 LN+ breast cancer patients. Figure B shows the receiver operating characteristic (ROC) curve of piR-hsa-28212 in detecting lymph node metastasis in 56 breast cancer patients. Figure C shows qRT-PCR analysis of piR-hsa-28212 expression in MDA-MB-468 cells and their derived exosomes (MDA-MB-468-EXO) after piR-hsa-28212 inhibition. Figure D shows qRT-PCR analysis of piR-hsa-28212 expression in MDA-MB-231 cells and their derived exosomes (MDA-MB-231-EXO) after piR-hsa-28212 overexpression.

[0015] Figure 2Figure 2 shows the expression levels of piR-hsa-28212 in HLECs incubated under different conditions. Figure A shows the expression levels of piR-hsa-28212 in HLECs incubated with PBS, MDA-MB-231-EXO, or MDA-MB-468-EXO. Figure B shows the qRT-PCR analysis of piR-hsa-28212 expression in HLECs after incubation with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and their respective controls.

[0016] Figure 3 Figure 2 is a quantitative analysis of tube formation and Transwell migration of HLECs; A is a tube formation analysis of HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212; B is a relative node number diagram of HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212; C is a relative grid number diagram of HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212; D is a quantitative analysis of Transwell migration of HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212;

[0017] Figure 4 Figure 1 is a quantitative analysis of the popliteal lymph node volume and lymph node metastasis percentage of two groups of nude mouse models (n=6); Figure 2 is a quantitative analysis of the popliteal lymph node volume and lymph node metastasis percentage of two groups of nude mouse models (n=6); Figure 3 is a quantitative analysis of the popliteal lymph node volume and lymph node metastasis percentage of two groups of nude mouse models (n=6);

[0018] Figure 5: The figure shows the analysis of the effect of piR-hsa-28212 on the expression level of METTL3; wherein, A is a graph showing the protein level of METTL3 in MDA-MB-468 cells with piR-hsa-28212 knockdown and MDA-MB-231 cells with overexpression of piR-hsa-28212; B is a statistical analysis graph showing the protein level of METTL3 in MDA-MB-468 cells with piR-hsa-28212 knockdown and MDA-MB-231 cells with overexpression of piR-hsa-28212; C is a Transwell assay graph of MDA-MB-468 cells with METTL3 inhibition and MDA-MB-231 cells with overexpression of METTL3; D is a statistical analysis graph showing the Transwell assay of MDA-MB-468 cells with METTL3 inhibition and MDA-MB-231 cells with overexpression of METTL3;

[0019] Figure 6 The following are analysis diagrams of the effect of METTL3 on piR-hsa-28212; A is a Transwell assay analysis diagram showing that METTL3 overexpression can partially eliminate the effects of piR-hsa-28212 knockdown on the migration and invasion of MDA-MB-468 cells; B is a Transwell assay analysis diagram of METTL3 knockdown; C is a qRT-PCR and Western blot analysis diagram of VEGFC expression in MDA-MB-468 cells with piR-hsa-28212 knockdown; D is a qRT-PCR and Western blot analysis diagram of VEGFC expression in MDA-MB-468 cells with piR-hsa-28212 overexpression;

[0020] Figure 7 Graphs showing the expression levels of mA or VEGFC in breast cancer cells in which piR-hsa-28212 or METTL3 is inhibited or overexpressed; A is a graph showing the mA level analysis of VEGFC mRNA in breast cancer cells in which piR-hsa-28212 is inhibited or overexpressed using MeRIP-qPCR; B is a statistical graph showing the expression analysis of VEGFC after METTL3 knockdown in MDA-MB-468 cells by qRT-PCR and Western blotting; C is a statistical graph showing the expression analysis of VEGFC after overexpression in MDA-MB-231 cells by qRT-PCR and Western blotting; D is a graph showing the expression analysis of VEGFC after METTL3 knockdown in MDA-MB-468 cells by qRT-PCR and Western blotting; E is a graph showing the expression analysis of VEGFC after overexpression in MDA-MB-231 cells by qRT-PCR and Western blotting;

[0021] Figure 8Figure 2 is a study and analysis of potential binding sites between piR-hsa-28212 and TBX1 3'-UTR; A is a statistical analysis of qRT-PCR and Western blot analysis of VEGFR3 expression in HLECs treated with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and their controls; B is a qRT-PCR and Western blot analysis of VEGFR3 expression in HLECs treated with MDA-MB-468-EXOsh-28212 and their controls; C is a qRT-PCR and Western blot analysis of VEGFR3 expression in HLECs treated with MDA-MB-231-EXOmimic-28212 and their controls; D is a schematic diagram of potential binding sites between piR-hsa-28212 and TBX1 3'-UTR;

[0022] Figure 9 Figures 1 and 2 show dual-luciferase reporter gene assays and protein expression analysis of TBX1 and VEGFR3 in HLECs treated with different treatments. Figure A shows dual-luciferase reporter gene assays. Figure B shows qRT-PCR analysis of TBX1 expression in HLECs treated with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and their control groups. Figure C shows Western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with MDA-MB-468-EXOsh-28212 and its control group. Figure D shows Western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with MDA-MB-231-EXOmimic-28212 and its control group.

[0023] Figure 10 Figures 2 and 3 are dual luciferase reporter gene assays and qRT-PCR and western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with si-NC and si-TBX1; Figure A is a dual luciferase reporter gene assay demonstrating luciferase activity in HLECs transfected with a VEGFR3 reporter gene containing wild-type TBE or mutant TBE; Figure B is a statistical graph of qRT-PCR and western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with si-NC and si-TBX1; Figure C is a statistical graph of qRT-PCR and western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with si-NC and si-TBX1. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with the accompanying drawings.

[0025] Example 1

[0026] To investigate the expression profile of piRNAs associated with lymph node metastasis in breast cancer, we performed piRNA sequencing of serum exosomes and identified piR-hsa-28212, a protein with the sequence GGCGGGAGTAACTATGACTCTCTTAAGGTA, that was significantly associated with lymph node metastasis in a cohort of 28 lymph node-negative (LN-) and 28 lymph node-positive (LN+) breast cancer patients. The functional role of exosomal piR-hsa-28212 was further investigated using in vitro migration and tube formation assays and an in vivo footpad-popliteal lymph node metastasis model. To elucidate the regulatory mechanism of piR-hsa-28212, we employed a battery of assays, including RNA pull-down, RNA immunoprecipitation (RIP), luciferase reporter assay, and actinomycin D assay.

[0027] Materials and methods

[0028] 2.1 Clinical specimens

[0029] Serum samples were obtained from patients at the Second Hospital of Shandong University. Pathological confirmation of breast cancer was obtained by two independent professional pathologists. This example was approved by the Research Ethics Committee of the Second Hospital of Shandong University (KYLL-2022-338).

[0030] 2.2 Cell culture

[0031] Human breast cancer cell lines (MDA-MB-231, MCF-7, BT549, and MDA-MB-468) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HLECs were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA). Cell lines were maintained using standard culture media and conditions. MDA-MB-231, MCF-7, and MDA-MB-468 were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco). BT549 was maintained in Roswell Park Memorial Institute (RPMI, Gibco) 1640 medium supplemented with 10% FBS. HLECs were maintained in endothelial cell culture medium (ECM, ScienCell, CA, USA) supplemented with 5% FBS and 1% matching growth factors (ScienCell, CA, USA). All cell lines were grown in a 37°C, 5% CO2 cell culture incubator.

[0032] 2.3 RNA sequencing and data analysis

[0033] Serum samples from breast cancer patients (six LN+ vs. six LN-) were used for small RNA sequencing. Total RNA was extracted using the miRNeasy MiniKit (Qiagen, Germany) according to the manufacturer's protocol. RNA concentration and quality were measured using a Qubit 2.0 Fluorometer (Life Technologies, USA) and a Nanodrop One Spectrophotometer (Thermo Fisher Scientific, USA). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, USA), and only samples with an RNA integrity number (RIN) higher than 7.0 were selected for sequencing. Library preparation and sequencing were performed by Huake Gene Co., Ltd. (Shanghai, China). Sequencing reads from each sample were mapped to the piRbank using CLC Genomics Workbench 5.5 to quantify piRNA expression (counts). piRNA levels are expressed as transcripts per million (TPM).

[0034] 2.4 Mouse popliteal lymph node metastasis model

[0035] BALB / c nude mice (4–5 weeks old, 18–20 g) were purchased from Beijing Huafukang Biotechnology Co., Ltd. (China) and used to establish the popliteal lymph node metastasis model. Footpad tumors and popliteal lymph nodes were then excised and embedded in paraffin for further analysis. The experiments were conducted with approval from the Research Ethics Committee of the Second Hospital of Shandong University. MDA-MB-468 cells (5 × 10 cells / mL) were incubated with 100 μl of phosphate-buffered saline (PBS) for 24 h. 6 ) was slowly injected into the footpad of mice. Mice were then randomly divided into two groups (n=6) and injected intratumorally with exosomes (20 μg / dose) every three days. Footpad tumors and popliteal lymph nodes (lymph node volume = 0.5 × width) were removed when tumors reached 200 mm. 2 Pathological sections of primary tumors and popliteal lymph nodes were analyzed by in situ hybridization (ISH), hematoxylin and eosinophil (HE), and immunofluorescence (IF) staining.

[0036] 2.5 RNA pull-down analysis

[0037] For RNA pulldown, the Pierce™ Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, 0164) was used. Biotinylated piR-hsa-28212 and antisense sequences were incubated with cell lysates overnight at 4°C. Prewashed beads were then added to capture piR-hsa-28212-bound proteins, which were then further analyzed by Western blotting.

[0038] 2.6 RNA immunoprecipitation (RIP) analysis

[0039] Magna RIP™ RNA Binding Protein Immunoprecipitation Kit (17-700, Millipore, USA) was used to perform RIP assay according to the manufacturer’s instructions. Briefly, 1 × 10 7 MDA-MB-468 cells were incubated with lysates and magnetic beads conjugated with 5 μg of anti-MEETL3 antibody (Abcam, ab195352) or anti-IgG (negative control) for 6 hours at 4°C. Immunoprecipitated RNA was eluted, purified, and dissolved in RNase-free water for further measurement by qRT-PCR assay, in which U6 was used as a nonspecific control.

[0040] 2.7 Tube formation experiment

[0041] HLECs were treated with exosomes (MDA-MB-468-EXOsh-NC or MDA-MB-468-EXOsh-28212) for 48 hours. Pretreated HLECs were then seeded onto 96-well plates coated with reduced growth factor Matrigel (BD Biosciences) and incubated for 6 hours at 37°C in 5% CO2. The formed lymphatic vessels were imaged using light microscopy and automatically analyzed using the Angiogenesis Analyzer plugin in ImageJ software.

[0042] 2.8 m6A dot plot analysis

[0043] RNA was heated at 95°C for 5 minutes to denature the mRNA and immediately cooled on ice. The sample was then spotted onto a nylon membrane, air-dried for 10 minutes, and cross-linked by UV irradiation. After blocking in TBST containing 5% BSA for 1 hour, the membrane was incubated with a 1:1000 dilution of anti-m6A antibody and a horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody. The membrane was then developed using enhanced chemiluminescence. Methylene blue staining was also used to verify the presence of equal amounts of RNA sample on the membrane.

[0044] 2.9 m6A RNA immunoprecipitation and qPCR (MeRIP-qPCR)

[0045] Total RNA was extracted using the Trizol method. RNA fragmentation and m6A RNA immunoprecipitation were performed using the m6A MeRIP kit (5203-2, BersinBio) according to the manufacturer's instructions. IP production and RT-qPCR were performed as described above.

[0046] 2.10 Dual-luciferase reporter gene assay

[0047] Dual-luciferase reporter gene assays were performed using the Dual-Luciferase Reporter Gene Assay Kit (DL 101-01, Vazyme, China) according to the manufacturer's instructions. Briefly, cells with different pretreatments were harvested and washed three times with PBS, followed by further lysis in PBL lysis buffer for 20 minutes. The supernatant was then collected and added to a 96-well plate at a rate of 10 μl per well, followed by the addition of 100 μl of Luciferase Assay Reagent II for exactly 2 seconds. Luciferase intensity was subsequently recorded using a microplate luminometer (Promego, USA), and Renilla luciferase intensity was measured as a control.

[0048] 2.11 Statistical Analysis

[0049] All measurements and data were analyzed using GraphPad Prism v9.0 (GraphPad Prism, Inc., La Jolla, CA, United States). P < 0.05 was considered statistically significant. The significance of intergroup differences was assessed using the Student's t-test or chi-square test (χ2 test), as appropriate. Results are expressed as the mean ± standard error of the mean (SEM) of three independent experiments.

[0050] Example 2

[0051] like Figure 1 As shown in Figure A, qRT-PCR analysis confirmed the dysregulated expression of piRNAs in serum exosomes from 28 LN- and 28 LN+ breast cancer patients. Figure 1 As shown in Figure B, the ROC curve illustrates the diagnostic efficacy of piR-hsa-28212 in detecting lymph node metastasis in 56 breast cancer patients; Figure 1 As shown in C, qRT-PCR analysis of piR-hsa-28212 expression in MDA-MB-468 cells and their derived exosomes (MDA-MB-468-EXO) was performed after inhibition of piR-hsa-28212. After inhibition of piR-hsa-28212, the expression of piR-hsa-28212 in MDA-MB-468 cells and their derived exosomes (MDA-MB-468-EXO) was reduced; Figure 1 Middle D shows qRT-PCR analysis of piR-hsa-28212 expression in MDA-MB-231 cells and their derived exosomes (MDA-MB-231-EXO) after piR-hsa-28212 overexpression. The results showed that piR-hsa-28212 expression was increased in both MDA-MB-231 cells and their derived exosomes (MDA-MB-231-EXO) after piR-hsa-28212 overexpression.

[0052] Figure 2 Figure A shows the expression level of piR-hsa-28212 in HLECs incubated with PBS, MDA-MB-231-EXO, or MDA-MB-468-EXO. Compared with PBS, the expression level of piR-hsa-28212 in HLECs incubated with MDA-MB-231-EXO or MDA-MB-468-EXO was increased. Figure 2 qRT-PCR analysis of piR-hsa-28212 expression in HLECs after incubation with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and their respective controls (B) shows that piR-hsa-28212 expression in HLECs was decreased after incubation with MDA-MB-468-EXOsh-28212 compared to the control, whereas piR-hsa-28212 expression was increased after incubation with MDA-MB-231-EXOmimic-28212 compared to the control.

[0053] Figure 3 Figures AD show quantitative analysis of tube formation and Transwell migration of HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212. This indicates that exosomes produced by MDA-MB-468 cells with piR-hsa-28212 knockdown reduced the tube formation and Transwell migration abilities of HLECs, whereas exosomes produced by MDA-MB-231 cells with piR-hsa-28212 overexpression enhanced the tube formation and Transwell migration abilities of HLECs.

[0054] Figure 4 Figures A and B show quantitative analysis of popliteal lymph node volume and lymph node metastasis percentage in two groups of nude mice (n=6). This indicates that exosomes produced by MDA-MB-468 cells with piR-hsa-28212 knockdown reduced popliteal lymph node volume and metastasis percentage in mice.

[0055] Figure 5 Middle A indicates that Western blot analysis evaluated the protein levels of METTL3 in MDA-MB-468 cells with piR-hsa-28212 knockdown and MDA-MB-231 cells with piR-hsa-28212 overexpression. The protein level of METTL3 was decreased in MDA-MB-468 cells with piR-hsa-28212 knockdown, while the protein level of METTL3 was increased in MDA-MB-231 cells with piR-hsa-28212 overexpression. Figure 5 Zhong BC stated that Transwell assays of MDA-MB-468 cells with METTL3 inhibition and MDA-MB-231 cells with METTL3 overexpression showed that inhibition of METTL3 in MDA-MB-468 cells would lead to decreased cell migration and invasion abilities; overexpression of METTL3 in MDA-MB-231 cells would lead to enhanced cell migration and invasion abilities.

[0056] Figure 6 Figure A indicates that Transwell experiments showed that METTL3 overexpression could partially eliminate the effects of piR-hsa-28212 knockdown on the migration and invasion of MDA-MB-468 cells; Figure 6 As shown in Figure 5B, Transwell assays demonstrated that knockdown of METTL3 partially attenuated the migration and invasion abilities of MDA-MB-231 cells, an effect that was enhanced by overexpression of piR-hsa-28212. Figure 6 Figures (C) and (D) show qRT-PCR and Western blot analysis of VEGFC expression in MDA-MB-468 cells with piR-hsa-28212 knockdown and MDA-MB-231 cells overexpressing piR-hsa-28212. The mRNA and protein levels of VEGFC were decreased in MDA-MB-468 cells with piR-hsa-28212 knockdown, whereas they were increased in MDA-MB-231 cells overexpressing piR-hsa-28212.

[0057] Figure 7 Middle A shows the quantification of mA levels of VEGFC mRNA in breast cancer cells in which piR-hsa-28212 was suppressed or overexpressed using MeRIP-qPCR. mA levels of VEGFC mRNA in breast cancer cells in which piR-hsa-28212 was suppressed decreased, while mA levels of VEGFC mRNA in breast cancer cells in which piR-hsa-28212 was overexpressed increased. Figure 7 Figure BE indicates that qRT-PCR and Western blot analysis were performed to analyze the expression of VEGFC in breast cancer cells after METTL3 knockdown or overexpression. The expression of VEGFC in breast cancer cells was decreased after METTL3 knockdown, while it was increased after METTL3 overexpression.

[0058] Figure 8Panels A to C show qRT-PCR and Western blot analysis of VEGFR3 expression in HLECs treated with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and controls. Compared with the control, VEGFR3 expression was decreased in HLECs after incubation with MDA-MB-468-EXOsh-28212; compared with the control, VEGFR3 expression was increased in HLECs after incubation with MDA-MB-231-EXOmimic-28212. Figure 8 Middle D shows a schematic diagram of the potential binding site between piR-hsa-28212 and TBX1 3'-UTR. There is a potential binding site between piR-hsa-28212 and TBX1 3'-UTR.

[0059] like Figure 9 As shown in Figure A, dual-luciferase reporter gene assay demonstrated the effect of piR-hsa-28212 on the TBX1 reporter gene containing wild-type or mutant sequences. The dual-luciferase reporter gene assay demonstrated that piR-hsa-28212 can bind to the 3'-UTR of TBX1; Figure 9 B. qRT-PCR analysis of TBX1 expression in HLECs treated with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and their control. TBX1 expression was decreased in HLECs treated with MDA-MB-468-EXOsh-28212 compared with the control (MDA-MB-468-EXOsh-NC). TBX1 mRNA expression was increased in HLECs treated with MDA-MB-231-EXOmimic-28212 compared with the control (MDA-MB-231-EXOmimic-NC). Figure 9 C and D show Western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with MDA-MB-468-EXOsh-28212, MDA-MB-231-EXOmimic-28212, and controls. Compared to controls, TBX1 and VEGFR3 protein expression was decreased in HLECs treated with MDA-MB-468-EXOsh-28212 and MDA-MB-231-EXOmimic-28212, whereas TBX1 and VEGFR3 protein expression was increased in HLECs treated with MDA-MB-231-EXOmimic-2821 and MDA-MB-231-EXOmimic-28212 compared to controls.

[0060] like Figure 10A dual-luciferase reporter assay demonstrates luciferase activity in HLECs transfected with a VEGFR3 reporter gene containing either a wild-type TBE or a mutant TBE. The dual-luciferase reporter assay demonstrates that VEGFR3 binds to the TBE region of TBX1 in HLECs. Figure 10 Figures B and C show qRT-PCR and Western blot analysis of TBX1 and VEGFR3 expression in HLECs treated with si-NC and si-TBX1, respectively. TBX1 knockdown in HLECs showed decreased mRNA and protein levels of TBX1 and VEGFR3. Metastasis is the leading cause of death in breast cancer patients. The extent of axillary lymph node metastasis is a key predictor of distant metastasis and mortality in breast cancer. A higher density of lymphatic vessels within and around tumors is associated with increased lymph node metastasis and mortality. VEGFC, a member of the VEGF family, binds to VEGFR3 on the surface of lymphatic endothelial cells (LECs), stimulating lymphangiogenesis and potentially facilitating tumor cell access to the lymphatic drainage system. However, the regulatory mechanisms underlying VEGFC / VEGFR3 signaling activation that triggers breast cancer lymph node metastasis remain largely unknown. The findings presented here comprehensively elucidate the molecular mechanism by which exosomal piR-hsa-28212 induces synergistic activation of VEGFC / VEGFR3 signaling, thereby enhancing our understanding of the role of VEGFC in tumor lymphatic metastasis.

[0061] The present study's results demonstrate that silencing exosomal piR-hsa-28212 significantly inhibits VEGFC / VEGFR3 signaling-induced breast cancer lymphangiogenesis and lymph node metastasis in vitro and promotes lymphangiogenesis and lymph node metastasis in mouse footpad tumors in vivo. This suggests that targeting exosomal piR-hsa-28212 with a specifically designed safe oligonucleotide (miR2210914093907 (RiboBio, China)) may represent a promising therapeutic strategy to mitigate pathological overactivation of VEGFC / VEGFR3 signaling. Therefore, this approach could provide a novel treatment and intervention for patients with lymphatic metastasis-causing breast cancer.

[0062] Early detection and dynamic assessment of the metastatic status of breast cancer patients are crucial for effective treatment. Currently, ultrasonography and mammography combined with histopathology are considered the gold standard for breast cancer diagnosis and metastatic status assessment. However, these methods have several limitations, highlighting the need for continued research and development of alternative diagnostic methods for the assessment of breast cancer and its metastasis.

[0063] Compared to traditional tumor tissue biopsies, liquid biopsies using molecular classifiers identified in patient blood samples offer a minimally invasive alternative with reduced complications and enhanced longitudinal monitoring capabilities. The billions of exosomes circulating in the blood may constitute a key element of liquid biopsies. Notably, the membrane encapsulation of exosomes preserves their structural integrity, and exosomal contents exhibit greater stability than other serological components due to protection from degradation by circulating proteases and other enzymes. Given their ease of detection and ubiquitous presence in serum, exosomes provide a wealth of material for downstream analyses for cancer detection, prognosis, and treatment monitoring, making them a promising non-invasive liquid biopsy approach. In the diagnostic field, many studies have proposed the use of exosomes as diagnostic tools because they contain disease-specific biomarkers.

[0064] Due to the accessibility and critical functions of exosomal noncoding RNAs, they hold great potential for BC diagnosis as a complementary and adjunctive modality to the current clinical gold standard. PiRNA sequencing revealed that piR-hsa-28212 is overexpressed in serum exosomes from breast cancer patients with lymph node metastasis. This finding was confirmed in serum exosomal piRNAs from 28 paired breast cancer patients (28 LN+ and 28 LN-).

[0065] PiR-hsa-28212 is significantly upregulated in serum exosomes from breast cancer patients with lymphatic metastasis. In vitro, exosomal piR-hsa-28212 promotes migration and tube formation in human lymphatic endothelial cells (HLECs), while in vivo, it enhances lymphangiogenesis and lymph node metastasis. Mechanistically, piR-hsa-28212 in breast cancer cells activates the METTL3 / IGF2BP2-m6A signaling pathway, leading to increased VEGFR3 expression and secretion. Furthermore, piR-hsa-28212 is transferred to HLECs by exosomes, stabilizing TBX1 mRNA, leading to elevated VEGFR3 expression and promoting lymph node metastasis.

[0066] Conclusion: The results of this study reveal a novel mechanism by which exosomal piR-hsa-28212 synergistically enhances VEGFC / VEGFR3 signaling-induced breast cancer lymph node metastasis. This piRNA may become a promising therapeutic target for breast cancer patients.

Claims

1. Use of a reagent for detecting piR-hsa-28212 in the preparation of a diagnostic product for lymph node metastatic breast cancer, wherein the sequence of the piR-hsa-28212 is shown in SEQ ID NO.1.

Images