Kit for detecting pine wood nematodes and method for detecting pine wood nematodes

Abstract

The present invention discloses a kit for detecting pine wood nematodes, comprising: an amplification reagent, wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2; and a detection test paper. The present invention also discloses a method for detecting pine wood nematodes. Through the kit for detecting pine wood nematodes of the present invention, the sensitivity of detecting pine wood nematodes can detect 50 copies in each reaction system, and has good repeatability.

Description

Technical Field

[0001] The invention relates to the technical field of pine wood nematode disease detection, and in particular to a kit for detecting pine wood nematodes and a method for detecting pine wood nematodes. Background Art

[0002] The pine wood nematode (Bursaphelenchus xylophilus) is the pathogen of pine wilt disease and is known as the "cancer" of pine trees. It originated in coniferous woods (mainly pine) in North America, and was later introduced to Asia and Europe through pine logs and wooden packaging exported from North America, causing great damage to the pine forests in the region. In China, pine wood nematodes are one of the most harmful invasive alien species in forestry and an important quarantine target. Customs ports and forestry systems must detect and identify pine wood nematodes on imported wood, wooden packaging, and pine wood and its packaging transported across provinces in China, and quarantine and eliminate pests on pine wood carrying pine wood nematodes to prevent further spread in the country.

[0003] At present, the detection and identification methods of pine wood nematodes mainly include two categories: morphological identification and molecular biological identification. The morphological identification method is mainly based on the shape of the tail and tail tip of female insects of similar species such as pine wood nematodes and pseudopine wood nematodes. However, due to the morphological differences between pine wood nematode populations in different regions and strains, morphological identification becomes complicated. In addition, morphological identification requires not only proficient slide making and microscope use skills of identification personnel, but also rich identification experience. Moreover, the morphological method is only applicable to adults and cannot be used to identify larvae, so the detection method has limited functions.

[0004] Molecular biological identification methods include species-specific PCR identification methods, ITS-RFLP identification methods, real-time fluorescence PCR identification methods, DNA barcode identification methods, and multiple isothermal amplification identification methods such as LAMP, RPA, RCA, SEA, etc. Among them, the specific PCR identification method and ITS-RFLP identification method require PCR amplification and gel electrophoresis observation, which are long and cumbersome to operate. The real-time fluorescence PCR identification method requires expensive equipment, harsh experimental environment, and skilled professionals to operate. In addition, the fluorescence PCR technology requires the synthesis of personalized probes, which increases the cost to a certain extent.

[0005] Isothermal nucleic acid amplification methods are alternatives to thermal cycling-based PCR. These methods allow amplification at a constant temperature in the presence of appropriate enzymes or enzyme mixtures. They do not require expensive, precise thermal cycling equipment, are more energy-efficient, environmentally friendly and cost-effective, and are particularly suitable for resource-constrained environments such as on-site testing, customs, forest areas, remote testing agencies, etc.

[0006] Among these isothermal amplification methods, recombinase polymerase amplification (RPA) has been widely used in isothermal detection systems. It achieves extremely high detection sensitivity and specificity in a short time by dual amplification of target nucleic acid and fluorescent probe through multi-enzyme collaboration, and realizes exponential amplification of target nucleic acid under the condition of primer specific matching. It also uses fluorescent probes for signal amplification, with a ratio greater than 100 times, so it has extremely high detection accuracy and efficiency. In particular, it is used in combination with fluorescent RNA technology to further reduce the cost of detection. However, non-specific amplification problems often occur in isothermal amplification reactions, which may bring false positive test results for the detection of pine wood nematodes, which to some extent limits the wide application of isothermal systems in pine wood nematodes. Summary of the invention

[0007] The present invention provides a method for detecting pine wood nematodes based on RPA, which is used to solve the technical problem of non-specific amplification existing in the isothermal amplification technology itself.

[0008] In summary, the present invention utilizes isothermal amplification in combination with fluorescent RNA to establish a detection method that can visually and quickly detect pine wood nematodes.

[0009] In one embodiment, the present invention provides a kit for detecting pine wood nematodes, comprising an amplification reagent (e.g., freeze-dried microspheres), wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2; and a detection test strip.

[0010] Optionally, the concentration of the upstream primer is 0.05 μM to 0.2 μM, and the concentration of the downstream primer is 0.1 μM to 0.2 μM.

[0011] Optionally, the amplification reagent further comprises: 0.1 mM to 5 mM Mg 2+ , 0.5 mM to 5 mM dNTPs solution, 0.01 U to 0.5 U pyrophosphatase, 100 U to 2000 U T7 RNA polymerase, and 0.5 mM to 5 mM spermidine.

[0012] Optionally, the amplification reaction reagent further comprises: no more than 50 U of RNase inhibitor.

[0013] Optionally, a positive control and a negative control are further included, wherein the positive control is a plasmid containing the pine wood nematode 18S rRNA gene, and the nucleotide sequence of the plasmid containing the pine wood nematode 18S rRNA gene is shown in SEQ ID NO:3.

[0014] Optionally, the test strip comprises a test line and a control line; the test line comprises a test line capture probe and streptavidin, the test line capture probe comprises a nucleotide fragment, a spacer and biotin as shown in SEQ ID NO: 4, and the nucleotide fragment as shown in SEQ ID NO: 4 is connected to biotin through the spacer of the test line capture probe; and the control line comprises a control line capture probe and streptavidin, the control line capture probe comprises a nucleotide fragment, a spacer and biotin as shown in SEQ ID NO: 5, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the test line capture probe.

[0015] In one embodiment, the present invention provides a method for detecting pine wood nematodes, characterized in that the method for detecting pine wood nematodes comprises:

[0016] S10: using an amplification reagent and performing RPA amplification with the target sequence of the 18S rRNA gene of pine wood nematode as a template to obtain an RPA amplification product, wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence is shown in SEQ ID NO: 6;

[0017] S20: allowing the RPA amplification product to react in a detection system containing at least T7 enzyme and fluorescent dye to obtain a reaction system

[0018] S30: Detecting the reaction system by using a test paper.

[0019] Optionally, the test strip comprises a test line and a control line; the test line comprises a test line capture probe and streptavidin, the test line capture probe comprises a nucleotide fragment, a spacer and biotin as shown in SEQ ID NO: 4, and the nucleotide fragment as shown in SEQ ID NO: 4 is connected to biotin through the spacer of the test line capture probe; and the control line comprises a control line capture probe and streptavidin, the control line capture probe comprises a nucleotide fragment, a spacer and biotin as shown in SEQ ID NO: 5, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the test line capture probe.

[0020] Optionally, in step S10, the RPA amplification is performed at a temperature of 35°C to 42°C.

[0021] Optionally, in step S10, the RPA amplification time is 15 to 45 minutes.

[0022] Optionally, the test strip is used to detect the RPA amplification product immediately after the RPA amplification is completed.

[0023] Optionally, the kit for detecting pine wood nematodes of the present invention may be a test kit, and may be applied to: preparing products for detecting pine wood nematodes, preparing samples for screening pine wood nematode infection; and detecting pine wood nematode genes for non-diagnostic purposes.

[0024] The beneficial effects of the present invention are: through the kit for detecting pine wood nematodes and the method for detecting pine wood nematodes of the present invention, pine wood nematodes are detected by utilizing nucleic acid constant temperature amplification and fluorescent RNA in combination, and the sensitivity can detect 50 copies in each reaction system, and through repeated experiments, it is confirmed that there is no significant difference in the detection results, and it has good repeatability. Furthermore, in the method for detecting pine wood nematodes of the present invention, the detection of samples can be completed in only 1 hour, which greatly shortens the detection time. In addition, the kit for detecting pine wood nematodes and the method for detecting pine wood nematodes of the present invention only require 1 person to complete all the operation processes, and one to hundreds of samples can be detected at a time, reducing manpower. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 A flow chart of the method for detecting pine wood nematodes of the present invention;

[0027] Figure 2A Display the test strip test results of the isothermal amplification detection kit;

[0028] Figure 2B A graph showing the dry fluorescence reader reading results for a negative test strip;

[0029] Figure 2C Graph showing the results of a dry fluorescence reader reading for a positive test strip. DETAILED DESCRIPTION

[0030] According to an embodiment of the present invention, a kit for detecting pine wood nematodes comprises: an amplification reagent (e.g., freeze-dried microspheres), wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2; and a detection test strip. Optionally, the kit can be a reagent kit.

[0031] Specifically, the concentration of the upstream primer may be 0.05 μM to 0.2 μM, for example, 0.05, 0.1, or 0.2 μM. The concentration of the downstream primer may be 0.1 μM to 0.2 μM, for example, 0.1, 0.05, or 0.2 μM. In addition, the amplification reagent further comprises: 0.1 mM to 5 mM (for example, 0.1, 0.5, 1, 2, 3, 4, or 5 mM) Mg 2+ , 0.5mM to 5mM (e.g., 0.5, 1, 2, 3, 4, or 5mM) dNTPs solution, 0.01U to 0.5U (e.g., 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, or 0.5U) pyrophosphatase, 100U to 2000U (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000U) T7 RNA polymerase, 0.5 mM to 5 mM (e.g., 0.5, 1, 2, 3, 4, or 5 mM) spermidine, and 0.01 to 50 U (e.g., 0.05 to 10 U, 0.05 to 20 U, 0.05 to 30 U, 0.05 to 40 U, ​​0.05 to 50 U; e.g., 0.01, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 U) RNase inhibitor.

[0032] The test strip may be a lateral flow chromatography test strip, and may include a sample pad, a detection pad and an absorption pad arranged along the chromatography direction, wherein the detection pad comprises a detection line and a control line, the detection line comprises a detection line capture probe (T line probe), the detection line capture probe comprises a nucleotide fragment as shown in SEQ ID NO: 4, a spacer and biotin, the nucleotide fragment as shown in SEQ ID NO: 4 is connected to biotin via the spacer of the detection line capture probe, for example, its 5' to 3' structure is: nucleotide fragment SEQ ID NO: 4-spacer-biotin (AGTCACCAATCGCATCATCGTTTTTTTTTTTTTTT-spacer-biotin); and streptavidin. And the control line comprises a control line capture probe (C line probe), which includes a nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO: 5, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the detection line capture probe, for example, its 5' to 3' structure is: nucleotide fragment SEQ ID NO: 5-spacer-biotin (ATGCGAACCATCAGTAGGCGAAAAAAAAAAAAAAAAA-spacer-biotin); and streptavidin.

[0033] The kit for detecting pine wood nematodes may also include an RPA reaction tube, a positive control substance, and a negative control substance. The RPA reaction tube is used for performing an RPA amplification reaction, while the positive control substance and the negative control substance are used as a comparison when determining whether pine wood nematodes exist. The positive control is a plasmid containing the 18S rRNA gene of pine wood nematodes, and the nucleotide sequence of the plasmid containing the 18S rRNA gene of pine wood nematodes is shown in SEQ ID NO: 3. The negative control substance may be sterile double distilled water.

[0034] In one embodiment, the kit for detecting pine wood nematodes of the present invention may consist only of an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, a detection line capture probe as shown in SEQ ID NO: 4, and a control line capture probe as shown in SEQ ID NO: 5.

[0035] Reference Figure 1 According to another embodiment of the present invention, a method for detecting pine wood nematodes comprises the following steps:

[0036] S10: using an amplification reagent and using the target sequence of the 18S rRNA gene of pine wood nematode as a template to perform RPA amplification to obtain an RPA amplification product, wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence is shown in SEQ ID NO: 6. In detail, the entire RPA amplification is performed in an RPA reaction tube.

[0037] S20: reacting the RPA amplification product in a detection system containing at least T7 enzyme and fluorescent dye to obtain a reaction system. The fluorescent dye may be, for example, HBC dye.

[0038] S30: Detecting the reaction system by using a test strip to interpret the result according to the quality control line and the detection line observed on the test strip.

[0039] In detail, the test paper can be a flow chromatography test strip, and may include a sample pad, a detection pad and an absorption pad arranged along the chromatography direction, wherein the detection pad includes a detection line and a control line, the detection line includes a detection line capture probe (T line probe), and the detection line capture probe includes a nucleotide fragment as shown in SEQ ID NO: 4, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 4 is connected to biotin through the spacer of the detection line capture probe, for example, its 5' to 3' structure is: nucleotide fragment SEQ ID NO: 4-spacer-biotin (AGTCACCAATCGCATCATCGTTTTTTTTTTTTTTT-spacer-biotin); and streptavidin. And the control line comprises a control line capture probe (C line probe), which includes a nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO: 5, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the detection line capture probe, for example, its 5' to 3' structure is: nucleotide fragment SEQ ID NO: 5-spacer-biotin (ATGCGAACCATCAGTAGGCGAAAAAAAAAAAAAAAAA-spacer-biotin); and streptavidin.

[0040] Optionally, RPA amplification can be performed at a temperature of 35°C to 42°C; preferably, 38°C to 40°C; and the amplification time can be 15 minutes to 45 minutes; preferably, 20 minutes to 45 minutes; more preferably, 30 minutes to 45 minutes.

[0041] Preferably, the test strip is used to detect the RPA amplification product immediately after the RPA amplification is completed to improve the accuracy of the test result.

[0042] The present invention will be further described below in conjunction with specific examples. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0043] Example 1

[0044] Preparation method of test strips:

[0045] Test strip scratching method:

[0046] 75 μL of 20 μM biotin-modified capture probe (Jierui Biotechnology Co., Ltd.) was fully mixed with 25 μL of 1 mg / mL streptavidin solution and reacted at room temperature for 2 hours. The incubated samples were centrifuged at 6000 r / min for 20 minutes at 4°C, the supernatant was aspirated, and stored at 4°C for later use.

[0047] Use a gold spray film scribing instrument to draw the capture probe on the nitrocellulose membrane to form a test line (T line); draw the quality control capture probe on the side close to the absorbent pad to form a quality control line (C line); dry the sprayed nitrocellulose membrane at 45°C overnight and store it in a dry environment at room temperature away from light for later use.

[0048] How to assemble the test strips:

[0049] Glue the nitrocellulose membrane, sample pad, conjugate pad and absorbent pad to the pad in sequence, with an overlap of 2 mm between adjacent pads. After assembly, cut into 3.6 mm wide test strips, mount them on a card, and store them dry and away from light at room temperature for later use.

[0050] Primers:

[0051] Upstream primer F (5'-3')

[0052] TAATACGACTCACTATAGGGCGGCTGGATCATTACCGATCCTATGA C (SEQ ID NO: 1);

[0053] Downstream primer R (5'-3')

[0054] GGAGTCAGCCGGCTGGGGCCTTTCGGCCCAGCGCCAGTACCTGC CGAAGCAGGTCGACACGCCACGATGCCGGCTGACTCCATGCGAACCA TCAGTAGGCGGAACGACG (SEQ ID NO: 2)

[0055] The nucleic acid sequence of the above detection capture probe after modification with biotin is as follows:

[0056] T-line capture probe (T-line probe):

[0057] The 5' to 3' structure is: Nucleotide fragment SEQ ID NO: 4-spacer-biotin:

[0058] 5'-AGTCACCAATCGCATCATCGTTTTTTTTTTTTTTTT-biotin-3';

[0059] C-line capture probe (C-line probe):

[0060] The 5' to 3' structure is: Nucleotide fragment SEQ ID NO: 5-spacer-biotin

[0061] 5'-ATGCGAACCATCAGTAGGCGAAAAAAAAAAAAAAAA-biotin-3';

[0062] Method for streaking the test line and the quality control line: after incubation of the probe with streptavidin, streaking was performed according to the above streaking method, streaking volume: 1 μL / cm;

[0063] (2) Synthesis of template DNA:

[0064] The template DNA used in the present invention is a plasmid template composed of the full sequence of pine wood nematode and pUC57 vector (purchased from Universal Biology, item number G0306762-1, and the plasmid dilution step is strictly carried out in accordance with the company's synthetic product instructions).

[0065] (3) Nucleic acid isothermal amplification:

[0066] Reaction reagent preparation:

[0067] The reaction reagents described here are used in this isothermal amplification reaction process, and all solvents should be prepared and used immediately;

[0068] Table 1: Reagent A

[0069]

[0070]

[0071] Table 2: Reagent B

[0072] Components Final concentration <![CDATA[Mg 2+ ]]> 5mM FLA43 1μM

[0073] Isothermal amplification:

[0074] Add 14.7 μL of A buffer from a commercial kit (Amp Future, catalog number WLE8202KIT) to the enzyme lyophilized reagent tube (purchased from Amp Future and stored in a -20°C refrigerator), and then add the components shown in Table 3 in sequence to the tube:

[0075] Table 3

[0076] Components Final concentration Upstream primer F (SEQ ID NO: 1) 0.05μM Plasmid concentration <![CDATA[5×10 -9 ng / μL,0ng / μL]]> Downstream primer R (SEQ ID NO: 2) 0.05μM Pyrophosphatase 0.5U T7 RNA polymerase 1000U <![CDATA[Mg 2+ ]]> 5mM FLA43 1μM dNTPs 2.5mM Spermidine 2mM

[0077] After adding the components in the above table, cover the lid, mix well, and put 200 μL of the reaction tube into the PCR instrument for reaction. The PCR instrument program (lid temperature 45°C) is set as shown in Table 4 below:

[0078] Table 4

[0079]

[0080]

[0081] The test strip detection operation is as follows:

[0082] After the amplification is completed, take 60 μL of the incubated sample and add it to the sample well of the test strip card, and incubate it in a 30°C test strip card incubator for 5 minutes. After the incubation, the test strip can be seen under the irradiation of ultraviolet light, etc., with bright green T-line and C-line fluorescent strips on the test strip of the positive sample, while the test strip of the negative sample only has a bright green C-line fluorescent strip and no T-line strip. FIG. 2A to FIG. 2C As shown, using a dry test strip (i.e., test paper) reader for fluorescence reading, both the T line and C line of the test strip of the positive sample have strong fluorescence signals, while the C line of the test strip of the negative sample has a strong fluorescence signal, and the T line has no fluorescence signal, indicating that the test strip can be used as a visual detection tool to make qualitative judgments on pine wood nematodes in the sample.

[0083] Example 2

[0084] Screening of primer concentration

[0085] The amount of upstream primer / downstream primer was changed: 0.05μM, 0.1μM, 0.15μM, 0.2μM, 0.25μM for amplification, double distilled water was used as template as negative sample, plasmid (5×10 -9 ng / μL) was used as a template as a positive sample, the amount of spermidine was 2.0 mM, and the other reaction systems were: 2.0 mM magnesium acetate, 1 mM rNTP, 2000U T7 RNA polymerase, 1 μM HBC530, supplemented to 100 μL with nuclease-free water, and the prepared reaction solution was placed in a PCR tube and reacted at 37°C for 30 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 5 below. When the concentrations of the upstream primer and the downstream primer were in the range of 0.1 to 0.2 μM, the system was able to effectively detect the target gene of pine wood nematode.

[0086] Table 5

[0087]

[0088]

[0089] Example 3

[0090] Screening of spermidine:

[0091] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9ng / μL) was used as a template as a positive sample, and the amount of spermidine was changed: 0mM, 0.5mM, 1.0mM, 2.0mM, 5.0mM. Other reaction systems were: 2.0mM magnesium acetate, 1mM rNTP, 2000U T7 RNA polymerase, and 1μM HBC530. The mixture was supplemented to 100μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 30°C for 120 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 6 below. When the spermidine concentration was between 0.5 and 5mM, the detection system could work normally.

[0092] Table 6

[0093]

[0094]

[0095] Example 4

[0096] Screening of magnesium ions

[0097] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9 ng / μL) was used as a template as a positive sample, the amount of spermidine was 3.0 mM, and the other reaction systems were: rNTP 1 mM, T7 RNA polymerase 2000U, HBC530 1 μM, the amount of magnesium acetate was changed: 0.1 mM, 0.5 mM, 1.0 mM, 2.0 mM, 5.0 mM, 10 mM, and supplemented to 100 μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 40°C for 90 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 7 below. When the magnesium ion concentration is between 0.1 and 5 mM, the system can normally detect the pine wood nematode target gene.

[0098] Table 7

[0099]

[0100] Example 5

[0101] Screening of rNTPs:

[0102] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9ng / μL) was used as a template as a positive sample, the amount of spermidine was 3.0 mM, and the other reaction systems were: 2 mM magnesium sulfate, 2000 U T7 RNA polymerase, and 1 μM HBC530. The amount of rNTPs was changed: 0.25 mM, 0.5 mM, 1.0 mM, 2.0 mM, 5.0 mM, and 10 mM. The mixture was supplemented to 100 μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 37°C for 45 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 8 below. When the amount of rNTPs was in the concentration range of 0.5 to 5 mM, the reaction system could be amplified normally and could effectively detect the target gene of pine wood nematode.

[0103] Table 8

[0104]

[0105]

[0106] Example 6

[0107] Screening of pyrophosphatase:

[0108] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9 ng / μL) was used as a template as a positive sample, the amount of spermidine was 3.0 mM, and the other reaction systems were: 2 mM magnesium sulfate, 2000 U T7 RNA polymerase, 1 μM HBC530, the amounts of dNTPs were changed: 0.25 mM, 0.5 mM, 1.0 mM, 2.0 mM, 5.0 mM, 10 mM, and supplemented to 100 μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 30°C for 180 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 9 below. When the concentration of pyrophosphatase was in the range of 0.01 to 0.5 U, the reaction system could be amplified normally and could effectively detect the target gene of pine wood nematode.

[0109] Table 9

[0110]

[0111]

[0112] Example 7

[0113] Screening of T7 polymerase:

[0114] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9ng / μL) was used as a template as a positive sample, the amount of spermidine was 3.0 mM, and the other reaction systems were: 2 mM magnesium sulfate, 2000 U of T7 RNA polymerase, and 1 μM HBC530. The amount of T7 polymerase was changed: 50 U, 100 U, 500 U, 1000 U, and 2000 U, and it was supplemented to 100 μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 45°C for 15 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 10 below. When the concentration of T7 RNA polymerase was in the range of 100 to 2000 U, the system could be used for RNA transcription of the kit and could effectively detect pine wood nematode targets.

[0115] Table 10

[0116]

[0117]

[0118] Example 8

[0119] Screening of RNA polymerase types:

[0120] The upstream primer / downstream primer was used as amplification primer, plasmid (0 ng / μL) was used as template as negative sample, and plasmid (5×10 -9 ng / μL) was used as a template as a positive sample, the amount of spermidine was 3.0 mM, and the other reaction systems were: 2 mM magnesium sulfate, 2000 U T7 RNA polymerase, 1 μM HBC530, the source of RNA polymerase was changed, the amount of polymerase was 1000 U, and it was supplemented to 100 μL with nuclease-free water. The prepared reaction solution was placed in a PCR tube and reacted at 39°C for 25 minutes. The fluorescence intensity results of the test strip detection system are shown in Table 11 below. RNA polymerases from different sources can be used for RNA transcription of the kit and can effectively detect pine wood nematode targets.

[0121] Table 11

[0122]

[0123]

[0124] Example 8

[0125] Taking the detection of pine wood nematode sawdust samples as an example: 28 sawdust samples to be detected, 1 pine wood nematode sample, and 2 pseudo-pine wood samples were taken as examples, and the fluorescence quantitative PCR detection method was compared with the detection method of the present invention.

[0126] Table 12

[0127]

[0128] Table 13 (Amplification system)

[0129]

[0130]

[0131] Table 14 (Amplification conditions)

[0132]

[0133] The kit includes the following components, see Table 15:

[0134] Table 15

[0135] Components 10T 50T Reaction tube (containing freeze-dried microspheres) 10 50 Pipette 1 1 Tips 20 100 Centrifuge tubes 20 100 Filters 10 sets 50 sets Sample spoon 1 2

[0136] Reagent preparation:

[0137] After obtaining the above components, the process of reagent preparation is as follows:

[0138] Sample preparation:

[0139] Take 25 to 30 mg of sawdust sample, put it into a 1.5 mL centrifuge tube, add 600 μL of nucleic acid releaser; boil the sample tube with the releaser at 100°C for 5 minutes; use a syringe to draw the supernatant through the filter into a new 1.5 mL centrifuge tube for standby use.

[0140] Add sample:

[0141] Take 100 μL of sample / positive control / negative control, add it to the sample loading chamber of the one-piece test strip card, mix thoroughly; put it in the device at 37°C and incubate for 40 minutes.

[0142] Test card detection:

[0143] Product to be tested: Centrifuge in a handheld centrifuge for 5 seconds; take 70 μL of the product and add it to the sample well of the test paper card, incubate at 30°C for 5 minutes, insert the incubated test paper card into the sample compartment of the dry test paper card reader in the indicated direction, and read the fluorescence signal value of the test paper card.

[0144] Negative control: The fluorescence signal value of the quality control C (X2) line is ≥300 and the fluorescence signal value of the detection T (X1) line is <50, which is considered negative.

[0145] Positive control: The fluorescence signal value of the quality control C (X2) line ≥ 300 and the fluorescence signal value of the detection T (X1) line ≥ 50 were judged as positive.

[0146] Test result explanation:

[0147] Invalid: If the fluorescence signal value of the quality control C (X2) line is less than 300 or there is no fluorescence signal value, it is judged as invalid and needs to be retested.

[0148] Positive (+): The fluorescence signal value of the quality control C (X2) line is ≥300 and the fluorescence signal value of the detection T (X1) line is ≥50, which is considered positive.

[0149] Negative (-): If the fluorescence signal value of the quality control C (X2) line is ≥300 and the fluorescence signal value of the detection T (X1) line is <50, it is judged as negative or the content is lower than the minimum detection limit of this product.

[0150] Table 16

[0151]

[0152]

[0153]

[0154] The above results show that the positive and negative coincidence rates of the kit are 100%, and the fluorescence signal value of P. xylophilus is 0.

[0155] Example 9

[0156] Sensitivity test:

[0157] Sensitivity study: In this study, 5×10 -8 μg / μL, 5×10 -9 μg / μL, 5×10 -10 μg / μL, 5×10 -11 The four sensitivity levels of 1 μg / μL were set up, and each level was tested twice. At the same time, a negative control group was set up to exclude nonspecific interference.

[0158] Table 17: Sensitivity study

[0159]

[0160] Table 17 shows the test results of 4 different concentrations of pine wood nematodes: When the sample concentration was 5×10 -11 μg / μL, the detected viral load reached 500copy / mL;

[0161] Sensitivity study 2: The following four concentrations were used: 1 / 2 × 5 × 10 -10 μg / μL, 1 / 3×5×10 -10 μg / μL, 1 / 4×5×10 -10 μg / μL, 1 / 5×5×10 -10 μg / μL, and each concentration was tested twice. At the same time, negative control experiments were also performed to ensure the accuracy of the experimental results.

[0162] Table 18: Sensitivity study

[0163]

[0164] It can be seen from Table 18 that, under the same concentration, the test results tend to be consistent when different proportions are taken, and all show a positive reaction. In addition, the table also includes the test results of negative controls, in which all negative control test results are negative.

[0165] Sensitivity study 3: Using 1 / 5×5×10 -10 μg / μL and negative control groups were tested 20 times:

[0166] Table 19: Sensitivity Confirmation

[0167]

[0168]

[0169] It can be seen from Table 19 that in 1 / 5×10 -10 At the concentration of μg / μL, the copy number of pine wood nematodes detected was 593.6copy / mL; the test was repeated 25 times, 24 results were normal, the detection rate was 96%, and the test results were relatively stable.

[0170] Precision testing:

[0171] In this study, 5×10 -8 μg / μL, 1.25×10 -9 μg / μL, 0μg / μL, high, low and negative concentration precision, each concentration was tested 10 times.

[0172] Table 20: Precision study of low concentration samples

[0173]

[0174] Table 21: Precision study of high concentration samples

[0175]

[0176] Table 22: Negative sample precision study

[0177]

[0178] It can be seen from Table 20 that at 1.25×10 -9μg / μL concentration, the copy number was 30000 copies / mL of pine wood nematodes; after repeated detection for 10 times, the fluorescence signal values ​​obtained were between 3067 and 4999, with an average value of 3989.1 and a relative standard deviation SD of 602.85; as can be seen from Table 21, at 5×10 -8 At the concentration of 0 μg / μL, the copy number was 836770 copies / mL of pine wood nematodes; the test was repeated 10 times, and the fluorescence signal value obtained was between 9948 and 14382, with an average value of 12086.4 and a relative standard deviation SD of 1530.62; as can be seen from Table 22, at the concentration of 0 μg / μL; the test was repeated 10 times, and the results were all negative; the test results were relatively stable. This shows that the method has good repeatability and accuracy and can be used for the analysis of multiple actual samples.

[0179] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and modifications without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for detecting pine wood nematodes, characterized in that: The invention comprises: an amplification reagent, wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2; and a detection test strip.

2. The kit for detecting pine wood nematodes according to claim 1, characterized in that: In the amplification reagent, the concentration of the upstream primer is 0.05 μM to 0.2 μM, and the concentration of the downstream primer is 0.05 μM to 0.2 μM.

3. The kit for detecting pine wood nematodes according to claim 1, characterized in that: The amplification reaction agent further comprises: in the amplification reaction agent, 0.1mM to 5mM Mg 2+ , 0.5 mM to 5 mM dNTPs solution, 0.01 U to 0.5 U pyrophosphatase, 100 U to 2000 U T7 RNA polymerase, and 0.5 mM to 5 mM spermidine.

4. The kit for detecting pine wood nematodes according to claim 3, characterized in that: The amplification reaction agent further comprises: in the amplification reaction agent, no more than 50U of RNase inhibitor.

5. The kit for detecting pine wood nematodes according to claim 1, characterized in that: The method also comprises a positive control and a negative control, wherein the positive control is a plasmid containing the 18S rRNA gene of pine wood nematode, and the nucleotide sequence of the plasmid containing the 18S rRNA gene of pine wood nematode is shown in SEQ ID NO:

3.

6. The kit for detecting pine wood nematodes according to claim 1, characterized in that: The test strip comprises a test line and a control line; The detection line comprises a detection line capture probe and streptavidin, wherein the detection line capture probe comprises a nucleotide fragment as shown in SEQ ID NO: 4, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 4 is connected to the biotin via the spacer of the detection line capture probe; and The control line comprises a control line capture probe and streptavidin, wherein the control line capture probe comprises a nucleotide fragment having a nucleotide sequence as shown in SEQ ID NO: 5, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the detection line capture probe.

7. A method for detecting pine wood nematodes, characterized in that: The method for detecting pine wood nematodes comprises: S10: using an amplification reagent and performing RPA amplification with a target sequence of the 18S rRNA gene of pine wood nematodes as a template to obtain an RPA amplification product, wherein the amplification reagent comprises: an upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2, and the nucleotide sequence of the target sequence is shown in SEQ ID NO: 6 shown; S20: allowing the RPA amplification product to react in a detection system containing at least T7 enzyme and fluorescent dye to obtain a reaction system; S30: Detecting the reaction system by using a test paper.

8. The method for detecting pine wood nematodes according to claim 7, characterized in that: The test strip comprises a test line and a control line; The detection line comprises a detection line capture probe and streptavidin, wherein the detection line capture probe comprises a nucleotide fragment as shown in SEQ ID NO: 4, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 4 is connected to the biotin via the spacer of the detection line capture probe; and The control line comprises a control line capture probe and streptavidin, wherein the control line capture probe comprises a nucleotide fragment having a nucleotide sequence as shown in SEQ ID NO: 5, a spacer and biotin, and the nucleotide fragment as shown in SEQ ID NO: 5 is connected to biotin through the spacer of the detection line capture probe.

9. The method for detecting pine wood nematodes according to claim 7, characterized in that: In step S10, the RPA amplification is performed at a temperature of 35°C to 42°C.

10. The method for detecting pine wood nematodes according to claim 7, characterized in that: In step S10, the RPA amplification time is 15 to 45 minutes.

Images