SNP (Single Nucleotide Polymorphism) site and application thereof

Abstract

The invention relates to the technical field of animal breeding, in particular to an SNP site and application thereof. The SNP site is located at the 11947562nd site of a honeybee chromosome 5, and the polymorphism is A / T. The applications include: i) growing bees with high flight efficiency or low energy consumption; ii) improvement of flight efficiency or energy consumption rate of bee germplasm resources; and iii) molecular marker-assisted breeding of bees. According to the method, bee sample data is adopted, the SNP site related to the bee vein corner B4 character is obtained through genome-wide association analysis and screening, and the detection result of the SNP site can reflect the bee vein corner B4 character. The SNP locus provided by the invention can be applied to breeding bees with specific bee vein angle B4 characters, so that germplasm resources of the bees are improved, and bee varieties with high flight efficiency and low energy consumption rate are bred.

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a SNP site and application thereof. Background Art

[0002] Chinese honey bee ( Apis cerana , also known as "Chinese honey bees") is a bee species with strong adaptability, strong disease resistance, and strong collection ability. It plays an important role in the natural ecosystem and helps maintain biodiversity and ecological balance. The Chinese honey bee not only plays an important role in agricultural production, but also has significantly higher benefits in ecological protection and economic benefits. Improving the germplasm resources of the Chinese honey bee can promote sustainable development and maintain ecological balance.

[0003] Traditional and classic methods of bee species identification and performance evaluation focus on morphological markers. Although morphological markers have the advantages of low cost and easy operation, they are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during the development process. In addition, the morphological measurement of Chinese bees is delicate, and there are strict requirements on the accuracy of the measuring instruments and the proficiency of the morphological anatomy of the measurement personnel. In addition, the workload of bee morphological measurement is huge and the operability is not strong. The wing vein angle B4 trait is one of the important morphological traits of bees. It affects the flight ability, energy consumption and efficiency of collecting pollen of bees to a certain extent. The development of molecular markers related to the wing vein angle B4 trait is conducive to the breeding of high-quality bee species. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a SNP site and application thereof.

[0005] In a first aspect, the present invention provides a SNP site, wherein the SNP site is located at position 11947562 of chromosome 5 of the honey bee, and the polymorphism is A / T.

[0006] Furthermore, the SNP site includes a nucleotide sequence as shown in SEQ ID NO.1, and there is a polymorphism at position 301 of the sequence, and the polymorphism is A / T.

[0007] The nucleotide sequence shown in SEQ ID NO.1 is as follows: .

[0008] In a second aspect, the present invention provides a KASP primer combination, wherein the KASP primer combination is used to amplify the aforementioned SNP site; the KASP primer combination comprises: F1: TGCTTAAGGCATTCTTATATATTCTTTTTATA, F2: TGCTTAAGGCATTCTTATATATTCTTTTTATT, R:TCGAAAGAAGCATTTTCGACA.

[0009] The sequences of the primers above are from 5' to 3'.

[0010] Furthermore, F1 and F2 carry different fluorescent markers respectively, and the fluorescent markers include: one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0011] For example, GAAGGTGACCAAGTTCATGCT (FAM) was linked to the 5' end of F1, and GAAGGTCGGAGTCAACGGATT (HEX) was linked to the 5' end of F2.

[0012] In a third aspect, the present invention provides a kit, which includes the aforementioned SNP site, or the aforementioned KASP primer combination.

[0013] In a fourth aspect, the present invention provides the use of the aforementioned SNP site, or the aforementioned KASP primer combination, or the aforementioned kit in identifying the B4 trait of honey bee wing vein angle.

[0014] The present invention further provides the use of the aforementioned SNP site, or the aforementioned KASP primer combination, or the aforementioned kit in any of the following: i) Breeding bees with high flight efficiency or low energy consumption rate; ii) Improvement of flight efficiency or energy consumption rate of honey bee germplasm; iii) Molecular marker-assisted breeding of honey bees.

[0015] In a fifth aspect, the present invention provides a method for identifying the trait of honey bee wing vein angle B4, comprising: The DNA of the bee to be tested is used as a template to detect the polymorphism of the aforementioned SNP site, and the wing vein angle B4 trait of the bee to be tested is determined based on the detection result.

[0016] Furthermore, the polymorphism of the aforementioned SNP sites is detected by gene sequencing, specific probes or PCR amplification.

[0017] Further, judging the wing vein angle B4 trait of the bee to be tested according to the test result includes: For the bees to be tested, the bees with a polymorphism test result of A / A at the aforementioned SNP site have a smaller wing vein angle B4 trait than those with a test result of T / T.

[0018] The structure of wing veins is an important morphological indicator of insects. In the long-term evolution of insects, wing veins will evolve traits that adapt to the environment in many aspects. Wing veins with good fitness need to take into account wing vein weight, structural strength, etc. Existing research shows that when bees experience low temperature stress, pesticide pollution, and virus infection, they will experience serious wing vein mutations, and even if the bees emerge from the hive, they will still have difficulty surviving.

[0019] The present invention has the following beneficial effects: The present invention obtains multiple SNP sites related to different physiological traits of honey bees based on the results of genome-wide association analysis of honey bees, and one of the SNP sites is related to the honey bee wing vein angle B4 trait. The identification of the size of the honey bee wing vein angle B4 trait can be achieved through the detection of the polymorphism of the SNP site. The SNP site provided by the present invention can also be used for the improvement of honey bee germplasm resources, and the cultivation of honey bee varieties with high flight efficiency and low energy consumption rate, and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 These are the statistics and typing results of the wing vein angle B4 trait of 106 Chinese honey bee samples provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0024] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0025] Example 1 The present invention obtains a SNP site related to the wing vein angle B4 trait through honey bee trait and genome association analysis, which specifically includes the following process: 1. The present invention measures the B4 of the forewing vein based on 110 groups of Chinese honey bees. For the worker bees after the above dissection, the genomic DNA of the thorax tissue of the worker bees is extracted and then the library is constructed using the Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly broken into 350bp fragments, and the DNA library is obtained through end repair, ployA tailing, sequencing adapter, amplification, purification and other steps. The insert size of the library is quality checked using Agilent 2100, and the effective concentration of the library is accurately quantified using the qPCR method. The DNA library is constructed after the quality meets the standard.

[0026] 2. Genome sequencing, alignment and SNPs identification: After the sample library was successfully constructed, the sample library was sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). During the sequencing process, low-quality reads were deleted to ensure the quality of the results (quality control standards: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads with low quality (phred quality <5) base content exceeding 50% of the length in the sequencing), and finally a single bee sample generated more than 4.5G high-quality paired-end clean reads, with Q20 and Q30 above 90% and 85%, respectively.

[0027] 3. The obtained high-quality paired-end clean reads were aligned to the reference genome using BWA 0.7.8 software Apis cerana (Genbank accession number: PRJNA738447). The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, and the average sequencing depth of the genome was above 20X.

[0028] 4. The Bayesian model in SAMTOOLS 1.15 software was used to detect group SNPs, and high-quality SNPs were screened according to the quality control standards (deleting SNPs with a sequencing error rate of >1% (Q20 quality control), deleting SNPs with a base number of <5 between adjacent SNP sites, and deleting SNPs with a coverage depth that exceeded the average depth by 1 / 3 to 5 times). ANNOVAR 20130520 software was used to annotate the detected SNPs, identify exon regions, intron regions, variable splicing sites, upstream and downstream regions of genes, and intergenic regions, and distinguish between synonymous mutation SNPs and non-synonymous mutation SNPs.

[0029] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted based on mrMLM 1.3 software to clarify the association between the wing vein angle B4 trait and SNPs loci. The SNPs quality control standard referred to MAF>5%, and the multi-locus random mixed linear model was selected as the model.

[0030] Table 1 Association between honey bee wing vein angle B4 phenotype and SNP

[0031] Based on the above method flow, the present invention screened and obtained multiple SNP sites related to the physical and chemical traits of honey bees (wing vein angle B4) (as shown in Table 1). After verification, one of the SNP sites was closely related to the honey bee wing vein angle B4. The SNP site (Chr5_11947562) was located at position 11947562 of chromosome 5 of the honey bee, and the polymorphism was A / T.

[0032] Example 2 1. The present invention selects 106 Chinese honey bee samples to carry out verification work, verifies the effect of the SNP site involved in Example 1, and specifically performs whole genome sequencing and wing vein angle B4 measurement on these 106 Chinese honey bees to obtain wing vein angle B4 data and SNP data of the 106 honey bees; The birds were grouped according to the genotypes at the SNP loci, and the SPSS 16.0 software was used to perform significance analysis on the wing vein angle B4 data of different groups to determine whether there were differences in wing vein angle B4 among different genotypes.

[0033] The combined measurement results and sequencing results showed that 27 Chinese bees showed A / A genotype, 51 Chinese bees showed A / T genotype, and 28 Chinese bees showed T / T genotype. Through LSD, Duncan data analysis, the following table and Figure 1 The results shown are from Figure 1 It can be seen that the A / A genotype and the T / T genotype showed significant differences ( P <0.05), the wing vein angle B4 trait of the A / A genotype Chinese bee is significantly smaller than that of the T / T genotype Chinese bee. From Tables 2 and 3, it can also be seen that genotype 1 (A / A) has a smaller wing vein angle B4 trait than genotype 2 (T / T) (the difference is negative), and the P <0.05, significant.

[0034] Table 2 Comparison of wing vein angle B4 of individuals with different genotypes at Chr5_11947562 locus in A. cerana

[0035] * expressP <0.05, the difference is significant.

[0036] Table 3 Comparison of wing vein angle B4 of individuals with different genotypes at Chr5_11947562 locus in A. cerana

[0037] It can be seen that the present invention can detect the polymorphism of position 11947562 of chromosome 5 of honey bees by a sequencing method similar to the above, and the detection result is that honey bees with A / A genotype tend to show a smaller wing vein angle B4 trait than honey bees with T / T genotype. The wing vein angle B4 trait is related to the flight efficiency and energy consumption efficiency of honey bees, so the SNP site can be used to breed honey bees with high flight efficiency and low energy consumption efficiency.

[0038] 2. The present invention further develops a KASP primer combination for detecting the SNP site, comprising: F1: GAAGGTGACCAAGTTCATGCTtgcttgaaggcattcttatatattctttttatA, F2:GAAGGTCGGAGTCAACGGATTtgcttgaaggcattcttatatattctttttatT, R:TCGAAAGAAGCATTTTCGACA.

[0039] Among them, F1 carries FAM and F2 carries HEX. In actual situations, the KASP primer combination can be used to detect the sample to be tested, and at the same time, the detection can be carried out through the existing fluorescence equipment in the prior art, and the detection results of the FAM and HEX fluorescence channels can be used to determine whether the genotype of the sample to be tested is T / T (HEX fluorescence signal exceeds the threshold), A / T (both FAM and HEX fluorescence signals exceed the threshold) or A / A (FAM fluorescence signal exceeds the threshold).

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP site, characterized in that: The SNP site is located at position 11947562 of chromosome 5 of the honey bee, and the polymorphism is A / T.

2. The SNP site according to claim 1, characterized in that: The SNP site includes a nucleotide sequence as shown in SEQ ID NO.1, and there is a polymorphism at position 301 of the sequence, and the polymorphism is A / T.

3. A KASP primer combination, characterized in that: The KASP primer combination includes: F1: TGCTTAAGGCATTCTTATATATTCTTTTTATA, F2: TGCTTAAGGCATTCTTATATATTCTTTTTATT, R:TCGAAAGAAGCATTTTCGACA.

4. A kit, characterized in that: The kit comprises the SNP site described in claim 1 or 2, or the KASP primer combination described in claim 3.

5. Use of the SNP site described in claim 1 or 2, or the KASP primer combination described in claim 3, or the kit described in claim 4 in identifying the B4 trait of honey bee wing vein angle.

6. Use of the SNP site according to claim 1 or 2, or the KASP primer combination according to claim 3, or the kit according to claim 4 in any of the following: i) Breeding bees with high flight efficiency or low energy consumption rate; ii) Improvement of flight efficiency or energy consumption rate of honey bee germplasm; iii) Molecular marker-assisted breeding of honey bees.

7. The use according to claim 5 or 6, characterized in that: The honey bee is an oriental honey bee, preferably a cerana ....

8. A method for identifying the B4 trait of honey bee wing vein angle, characterized in that: include: The DNA of the bee to be tested is used as a template to detect the polymorphism of the SNP site as claimed in claim 1 or 2, and the wing vein angle B4 trait of the bee to be tested is determined according to the detection result.

9. The method according to claim 8, characterized in that The polymorphism of the SNP site as claimed in claim 1 or 2 is detected by gene sequencing, specific probe or PCR amplification.

10. The method according to claim 8 or 9, characterized in that: The trait of the wing vein angle B4 of the bee to be tested is determined according to the test result, including: For the bees to be tested, the bees whose polymorphism detection result of the SNP site is A / A as claimed in claim 1 or 2 have a smaller wing vein angle B4 trait than those whose detection result is T / T.

Images